Starting /dee2/code/volunteer_pipeline.sh SRR7169803 current disk space = 3053590855680 free memory = 1479565468 SRR7169803 SRAfilesize 09dea1fb7425c0134c2b985723394673 SRR7169803.sra SRR7169803.sra file validated SRR7169803 is paired end SRR7169803 is conventional basespace SRR7169803 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169803_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.922 18.0 18.0 25.0 18.0 32.0 2 28.9545 29.0 27.0 31.0 27.0 33.0 3 31.2025 33.0 31.0 33.0 29.0 33.0 4 32.3715 33.0 33.0 33.0 31.0 33.0 5 32.99375 33.0 33.0 34.0 33.0 34.0 6 37.2105 38.0 37.0 38.0 36.0 38.0 7 37.58475 38.0 38.0 38.0 37.0 38.0 8 37.70925 38.0 38.0 38.0 38.0 38.0 9 37.70575 38.0 38.0 38.0 38.0 38.0 10-14 37.7105 38.0 38.0 38.0 38.0 38.0 15-19 37.72205 38.0 38.0 38.0 38.0 38.0 20-24 37.673950000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.58715 38.0 38.0 38.0 38.0 38.0 30-34 37.5721 38.0 38.0 38.0 37.8 38.0 35-39 37.40645 38.0 38.0 38.0 37.6 38.0 40-44 37.37495 38.0 38.0 38.0 37.4 38.0 45-49 37.36035 38.0 38.0 38.0 37.0 38.0 50-54 37.06225 38.0 38.0 38.0 36.0 38.0 55-59 37.28455 38.0 38.0 38.0 36.8 38.0 60-64 37.333299999999994 38.0 38.0 38.0 36.8 38.0 65-69 36.9647 38.0 38.0 38.0 35.6 38.0 70-74 37.161899999999996 38.0 38.0 38.0 36.2 38.0 75-79 37.0904 38.0 38.0 38.0 36.0 38.0 80-84 36.85505 38.0 38.0 38.0 35.2 38.0 85-89 36.73909999999999 38.0 38.0 38.0 34.8 38.0 90-94 36.72135 38.0 38.0 38.0 35.0 38.0 95-99 36.651450000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.59045 38.0 38.0 38.0 34.2 38.0 105-109 36.46554999999999 38.0 37.8 38.0 34.2 38.0 110-114 36.0142 38.0 37.2 38.0 33.4 38.0 115-119 35.41445 38.0 36.0 38.0 29.4 38.0 120-124 36.0751 38.0 37.0 38.0 33.4 38.0 125-129 34.986399999999996 38.0 35.4 38.0 27.0 38.0 130-134 35.09215 38.0 35.4 38.0 28.2 38.0 135-139 35.4341 38.0 36.0 38.0 30.6 38.0 140-144 34.8231 38.0 35.2 38.0 28.6 38.0 145-149 34.2971 38.0 35.0 38.0 27.0 38.0 150-151 30.63275 36.5 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 0.0 15 3.0 16 1.0 17 1.0 18 2.0 19 4.0 20 3.0 21 2.0 22 3.0 23 5.0 24 8.0 25 7.0 26 7.0 27 8.0 28 24.0 29 29.0 30 38.0 31 30.0 32 61.0 33 94.0 34 158.0 35 347.0 36 954.0 37 2205.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75975671566143 11.556006082108464 12.924480486568676 37.75975671566143 2 21.875 15.575 34.925 27.625 3 20.65 20.775 25.474999999999998 33.1 4 23.375 28.799999999999997 21.775 26.05 5 22.425 33.375 24.525 19.675 6 18.875 36.9 24.2 20.025000000000002 7 15.15 26.575 41.4 16.875 8 19.1 24.85 30.725 25.324999999999996 9 18.025 24.95 31.95 25.074999999999996 10-14 19.84 29.87 27.275 23.015 15-19 19.744999999999997 28.775000000000002 27.689999999999998 23.79 20-24 19.605 28.955 27.744999999999997 23.695 25-29 20.549999999999997 28.705000000000002 27.339999999999996 23.405 30-34 20.365 28.499999999999996 27.694999999999997 23.44 35-39 19.869999999999997 28.449999999999996 28.345 23.335 40-44 20.380000000000003 28.435 27.839999999999996 23.345 45-49 20.349999999999998 28.235 27.27 24.145 50-54 19.98 29.12 27.450000000000003 23.45 55-59 20.65 28.64 27.495000000000005 23.215 60-64 20.39 28.175 27.529999999999998 23.905 65-69 20.685000000000002 28.444999999999997 27.63 23.24 70-74 20.31 29.175 27.425 23.09 75-79 20.985 27.97 27.675 23.369999999999997 80-84 20.07 28.76 27.065 24.104999999999997 85-89 20.755000000000003 28.660000000000004 27.165 23.419999999999998 90-94 20.73 28.925 27.1 23.244999999999997 95-99 20.445 28.215 27.49 23.849999999999998 100-104 21.135 28.815 26.77 23.28 105-109 20.69 28.4 27.515 23.395 110-114 20.55463284513564 28.00845538275706 27.615884040465044 23.821027731642257 115-119 21.44 28.005000000000003 26.995 23.56 120-124 20.695 28.945 27.075 23.285 125-129 20.76 29.075 26.840000000000003 23.325000000000003 130-134 21.59 28.215 26.21 23.985 135-139 20.76 28.99 26.525 23.724999999999998 140-144 21.075 28.935 26.529999999999998 23.46 145-149 20.919999999999998 28.88 25.924999999999997 24.275 150-151 20.7875 28.749999999999996 25.900000000000002 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.5 26 3.0 27 5.0 28 8.5 29 11.5 30 15.5 31 26.5 32 38.5 33 37.0 34 48.0 35 75.0 36 86.0 37 99.5 38 129.0 39 171.0 40 195.5 41 203.5 42 236.5 43 240.0 44 248.0 45 282.5 46 279.0 47 247.5 48 232.5 49 220.5 50 189.0 51 154.0 52 133.5 53 117.5 54 74.5 55 44.5 56 36.0 57 30.5 58 22.5 59 12.0 60 4.5 61 4.0 62 5.0 63 4.5 64 6.0 65 5.0 66 2.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.655 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.05 0.0 0.0 0.0 0.0 94-95 1.2999999999999998 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.3375 0.0 0.0 0.0 0.0 104-105 2.65 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.25 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 3.9625000000000004 0.0 0.0 0.0 0.0 114-115 4.4 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.3875 0.0 0.0 0.0 0.0 120-121 5.887499999999999 0.0 0.0 0.0 0.0 122-123 6.525 0.0 0.0 0.0 0.0 124-125 7.1 0.0 0.0 0.0 0.0 126-127 7.5875 0.0 0.0 0.0 0.0 128-129 8.1875 0.0 0.0 0.0 0.0 130-131 8.7 0.0 0.0 0.0 0.0 132-133 9.3625 0.0 0.0 0.0 0.0 134-135 10.05 0.0 0.0 0.0 0.0 136-137 10.825 0.0 0.0 0.0 0.0 138-139 11.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGACTG 10 0.006830828 145.0 3 GGACTGA 10 0.006830828 145.0 4 CTCAGTT 10 0.006830828 145.0 6 CTCCAGT 25 8.7132835E-4 87.0 145 CTGAACT 40 2.9585467E-4 21.75 140-144 TGAACTC 40 2.9585467E-4 21.75 140-144 ACGTCTG 45 6.5511256E-4 19.333332 135-139 CACGTCT 45 6.5511256E-4 19.333332 135-139 GAACTCC 45 6.5511256E-4 19.333332 140-144 GAGCACA 50 0.0013298223 17.4 130-134 CGGAAGA 55 0.0025160722 15.818182 125-129 GGAAGAG 55 0.0025160722 15.818182 125-129 AGCACAC 55 0.0025160722 15.818182 130-134 AGATCGG 65 0.0076375785 13.384615 120-124 >>END_MODULE SRR7169803 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169803_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.935 33.0 33.0 34.0 32.0 34.0 2 33.0975 33.0 33.0 34.0 33.0 34.0 3 32.22975 33.0 33.0 34.0 31.0 34.0 4 32.53975 33.0 33.0 34.0 32.0 34.0 5 33.06125 33.0 33.0 34.0 32.0 34.0 6 37.4715 38.0 38.0 38.0 37.0 38.0 7 37.43625 38.0 38.0 38.0 37.0 38.0 8 37.46975 38.0 38.0 38.0 38.0 38.0 9 37.562 38.0 38.0 38.0 38.0 38.0 10-14 37.4615 38.0 38.0 38.0 38.0 38.0 15-19 37.47485 38.0 38.0 38.0 38.0 38.0 20-24 37.0398 38.0 38.0 38.0 35.6 38.0 25-29 37.47255 38.0 38.0 38.0 38.0 38.0 30-34 37.4951 38.0 38.0 38.0 38.0 38.0 35-39 37.423199999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.38685 38.0 38.0 38.0 38.0 38.0 45-49 37.416450000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.37855 38.0 38.0 38.0 37.8 38.0 55-59 37.2505 38.0 38.0 38.0 37.4 38.0 60-64 37.142 38.0 38.0 38.0 36.8 38.0 65-69 37.128949999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.05210000000001 38.0 38.0 38.0 36.6 38.0 75-79 36.569849999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.284650000000006 38.0 37.4 38.0 33.8 38.0 85-89 36.83475 38.0 38.0 38.0 35.8 38.0 90-94 37.03435 38.0 38.0 38.0 36.4 38.0 95-99 36.87294999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.6919 38.0 38.0 38.0 35.4 38.0 105-109 35.3352 38.0 37.0 38.0 29.0 38.0 110-114 34.96825 38.0 37.4 38.0 29.8 38.0 115-119 34.35695 38.0 37.0 38.0 25.4 38.0 120-124 34.216699999999996 38.0 36.0 38.0 23.6 38.0 125-129 34.3015 38.0 36.2 38.0 24.2 38.0 130-134 34.99225 38.0 36.0 38.0 27.6 38.0 135-139 35.2984 38.0 36.0 38.0 30.8 38.0 140-144 35.063900000000004 38.0 36.0 38.0 30.6 38.0 145-149 34.46525 38.0 35.2 38.0 28.6 38.0 150-151 30.12075 35.5 27.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 0.0 6 0.0 7 1.0 8 3.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 3.0 16 1.0 17 3.0 18 4.0 19 7.0 20 2.0 21 4.0 22 5.0 23 11.0 24 14.0 25 12.0 26 17.0 27 9.0 28 24.0 29 45.0 30 48.0 31 70.0 32 68.0 33 113.0 34 144.0 35 215.0 36 592.0 37 2570.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.725 19.325 13.750000000000002 28.199999999999996 2 25.324999999999996 26.724999999999998 31.05 16.900000000000002 3 20.45 28.249999999999996 30.675 20.625 4 25.05 33.15 22.900000000000002 18.9 5 23.1 36.275 22.45 18.175 6 21.15 37.95 23.400000000000002 17.5 7 21.625 22.325 37.075 18.975 8 22.275 24.925 26.625 26.174999999999997 9 22.400000000000002 25.374999999999996 28.999999999999996 23.225 10-14 23.91 28.63 26.13 21.33 15-19 23.34 27.63 27.605 21.425 20-24 23.22 27.779999999999998 27.965 21.035 25-29 22.67 28.22 27.93 21.18 30-34 22.88 27.865000000000002 28.410000000000004 20.845 35-39 23.425 27.169999999999998 28.625 20.78 40-44 23.455000000000002 28.17 27.67 20.705000000000002 45-49 23.189999999999998 28.285 28.01 20.515 50-54 23.21 27.595 28.575 20.62 55-59 23.799999999999997 27.175 28.244999999999997 20.78 60-64 23.200000000000003 26.895000000000003 28.860000000000003 21.044999999999998 65-69 23.93 27.79 28.08 20.200000000000003 70-74 23.419999999999998 27.715 28.34 20.525 75-79 23.434333198216457 27.807053100932304 28.344142683421158 20.414471017430078 80-84 23.562264150943395 27.290566037735847 28.226415094339625 20.920754716981133 85-89 23.56 27.68 27.865000000000002 20.895 90-94 23.56 27.71 28.499999999999996 20.23 95-99 24.32 27.439999999999998 27.74 20.5 100-104 24.180553470449883 27.878696892358505 27.723565030275733 20.21718460691588 105-109 24.392830093410755 27.912143398131782 27.745518808381718 19.94950770007574 110-114 24.109275994598526 27.97860184896645 27.942245767113327 19.9698763893217 115-119 24.18304115248133 28.240029659446 27.403209575764 20.17371961230867 120-124 24.861009126193224 27.897828595405432 27.273680897933495 19.96748138046785 125-129 24.952859836580767 28.053635030379215 26.93274670018856 20.060758432851454 130-134 25.523520485584218 27.698533131006574 26.899342438037433 19.878603945371776 135-139 25.264999999999997 27.96 27.275 19.5 140-144 25.685000000000002 27.605 27.045 19.665 145-149 25.86 28.16 26.61 19.37 150-151 26.950000000000003 27.500000000000004 26.025 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 2.5 26 3.5 27 2.5 28 6.0 29 9.0 30 8.5 31 12.0 32 20.5 33 30.0 34 42.0 35 60.0 36 77.5 37 102.5 38 131.0 39 158.0 40 197.5 41 229.5 42 261.5 43 278.5 44 279.0 45 289.0 46 297.5 47 274.0 48 242.5 49 211.5 50 167.5 51 134.0 52 111.0 53 99.5 54 81.5 55 55.5 56 35.0 57 25.5 58 20.0 59 10.5 60 3.0 61 4.5 62 5.0 63 3.5 64 1.5 65 1.0 66 1.0 67 2.0 68 3.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 1.32 80-84 0.625 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.975 110-114 3.73 115-119 5.595 120-124 4.67 125-129 4.54 130-134 1.15 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.05 0.0 0.0 0.0 0.0 94-95 1.2999999999999998 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.8250000000000002 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.6 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2 0.0 0.0 0.0 0.0 110-111 3.5875000000000004 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.6375 0.0 0.0 0.0 0.0 118-119 5.225 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.3375 0.0 0.0 0.0 0.0 124-125 6.875 0.0 0.0 0.0 0.0 126-127 7.3875 0.0 0.0 0.0 0.0 128-129 8.0125 0.0 0.0 0.0 0.0 130-131 8.575 0.0 0.0 0.0 0.0 132-133 9.2375 0.0 0.0 0.0 0.0 134-135 9.925 0.0 0.0 0.0 0.0 136-137 10.7 0.0 0.0 0.0 0.0 138-139 11.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATGG 10 0.0070190914 143.6875 3 CCTCAAT 10 0.0070190914 143.6875 1 AAAGAGT 25 9.0338744E-4 86.212494 145 TAGGGAA 40 3.146181E-4 21.553123 140-144 GAGCGTC 45 6.73198E-4 19.254606 130-134 AGCGTCG 45 6.73198E-4 19.254606 130-134 TCGTGTA 45 6.9647323E-4 19.158333 135-139 AGGGAAA 45 6.9647323E-4 19.158333 140-144 CGTGTAG 45 6.9647323E-4 19.158333 135-139 CAGATCG 40 0.005989012 18.906248 120-124 CGGAAGA 55 0.0021037771 16.243523 125-129 AGATCGG 65 0.0057607098 13.961538 120-124 >>END_MODULE Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655014 spots for SRR7169803.sra Written 655014 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra Read 655004 spots for SRR7169803.sra Written 655004 spots for SRR7169803.sra SRR ids: ['SRR7169803.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fw5oran0 SRR7169803.sra spots: 13100090 blocks: [[1, 655004], [655005, 1310008], [1310009, 1965012], [1965013, 2620016], [2620017, 3275020], [3275021, 3930024], [3930025, 4585028], [4585029, 5240032], [5240033, 5895036], [5895037, 6550040], [6550041, 7205044], [7205045, 7860048], [7860049, 8515052], [8515053, 9170056], [9170057, 9825060], [9825061, 10480064], [10480065, 11135068], [11135069, 11790072], [11790073, 12445076], [12445077, 13100090]] SRR7169803 file size 4417490 SRR7169803 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169803 SRR7169803_1.fastq SRR7169803_2.fastq Input file: SRR7169803_1.fastq Paired file: SRR7169803_2.fastq trimmed: SRR7169803-trimmed-pair1.fastq, SRR7169803-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:25:54 2025 >> started Tue Feb 11 19:26:10 2025 >> done (15.495s) 13100090 read pairs processed; of these: 8861 ( 0.07%) short read pairs filtered out after trimming by size control 20221 ( 0.15%) empty read pairs filtered out after trimming by size control 13071008 (99.78%) read pairs available; of these: 6536289 (50.01%) trimmed read pairs available after processing 6534719 (49.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 10 0.00% 26 4 0.00% 27 7 0.00% 28 4 0.00% 29 4 0.00% 30 8 0.00% 31 13 0.00% 32 15 0.00% 33 17 0.00% 34 10 0.00% 35 26 0.00% 36 25 0.00% 37 32 0.00% 38 18 0.00% 39 36 0.00% 40 39 0.00% 41 53 0.00% 42 65 0.00% 43 53 0.00% 44 62 0.00% 45 66 0.00% 46 75 0.00% 47 96 0.00% 48 122 0.00% 49 146 0.00% 50 160 0.00% 51 167 0.00% 52 199 0.00% 53 218 0.00% 54 234 0.00% 55 275 0.00% 56 316 0.00% 57 344 0.00% 58 407 0.00% 59 494 0.00% 60 570 0.00% 61 614 0.00% 62 724 0.01% 63 823 0.01% 64 919 0.01% 65 996 0.01% 66 1105 0.01% 67 1216 0.01% 68 1423 0.01% 69 1660 0.01% 70 1803 0.01% 71 2220 0.02% 72 2601 0.02% 73 2779 0.02% 74 3211 0.02% 75 3478 0.03% 76 4012 0.03% 77 4249 0.03% 78 4566 0.03% 79 5239 0.04% 80 5581 0.04% 81 6382 0.05% 82 6993 0.05% 83 8118 0.06% 84 9245 0.07% 85 10305 0.08% 86 10985 0.08% 87 11396 0.09% 88 12446 0.10% 89 13155 0.10% 90 14026 0.11% 91 14886 0.11% 92 16140 0.12% 93 17560 0.13% 94 18924 0.14% 95 19949 0.15% 96 20879 0.16% 97 21110 0.16% 98 21961 0.17% 99 22596 0.17% 100 24146 0.18% 101 24690 0.19% 102 26445 0.20% 103 27959 0.21% 104 29033 0.22% 105 30750 0.24% 106 31534 0.24% 107 32379 0.25% 108 32893 0.25% 109 33544 0.26% 110 34166 0.26% 111 35816 0.27% 112 36347 0.28% 113 37764 0.29% 114 39662 0.30% 115 40989 0.31% 116 41925 0.32% 117 42807 0.33% 118 43404 0.33% 119 43504 0.33% 120 44155 0.34% 121 45482 0.35% 122 46134 0.35% 123 48093 0.37% 124 49807 0.38% 125 51502 0.39% 126 52602 0.40% 127 53424 0.41% 128 54732 0.42% 129 55030 0.42% 130 56092 0.43% 131 56564 0.43% 132 58259 0.45% 133 60150 0.46% 134 61229 0.47% 135 63326 0.48% 136 65643 0.50% 137 67821 0.52% 138 69777 0.53% 139 72244 0.55% 140 74993 0.57% 141 79491 0.61% 142 85116 0.65% 143 89311 0.68% 144 100803 0.77% 145 115677 0.88% 146 136165 1.04% 147 178537 1.37% 148 258762 1.98% 149 507722 3.88% 150 2757207 21.09% 151 6534719 49.99% 13071008 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=268.76 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=9 fanout-score=33.18 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=9.6 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7169803 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:26:58 Started mapping on | Feb 11 19:26:58 Finished on | Feb 11 19:28:16 Mapping speed, Million of reads per hour | 603.28 Number of input reads | 13071008 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12497477 Uniquely mapped reads % | 95.61% Average mapped length | 288.87 Number of splices: Total | 10818370 Number of splices: Annotated (sjdb) | 10622414 Number of splices: GT/AG | 10664242 Number of splices: GC/AG | 120052 Number of splices: AT/AC | 9480 Number of splices: Non-canonical | 24596 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207273 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 80427 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 375114 375114 375114 N_multimapping 207273 207273 207273 N_noFeature 344854 12331196 412593 N_ambiguous 145447 855 46250 UnstrandedReadsAssigned:12007176 PositiveStrandReadsAssigned:165426 NegativeStrandReadsAssigned:12038634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169803 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169803-trimmed-pair1.fastq SRR7169803-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,071,008 reads, 11,985,187 reads pseudoaligned [quant] estimated average fragment length: 205.635 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR7169803.ke.tsv 34699 SRR7169803.se.tsv 87100 total ==> SRR7169803.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.36 248 12.1189 Potri.005G024800.1.v4.1 1035 830.365 30 3.20148 Potri.004G059700.1.v4.1 961 756.37 1 0.117156 Potri.007G009000.2.v4.1 1416 1211.36 0 0 Potri.003G141000.2.v4.1 2943 2738.36 210.098 6.79875 Potri.016G087400.1.v4.1 270 94.6579 1164 1089.67 Potri.015G069301.1.v4.1 564 360.872 0 0 Potri.010G195200.1.v4.1 1773 1568.36 26 1.46901 Potri.012G127500.1.v4.1 977 772.37 4141 475.092 ==> SRR7169803.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1584 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169803 completed mapping pipeline successfully