Starting /dee2/code/volunteer_pipeline.sh SRR7169804 current disk space = 3053443465216 free memory = 1409418912 SRR7169804 SRAfilesize 33ec004a89059f12a06f407ad99c14e0 SRR7169804.sra SRR7169804.sra file validated SRR7169804 is paired end SRR7169804 is conventional basespace SRR7169804 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169804_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.93975 18.0 18.0 25.0 18.0 32.0 2 27.6255 28.0 27.0 30.0 25.0 31.0 3 28.356 29.0 27.0 31.0 25.0 33.0 4 30.9565 31.0 30.0 33.0 29.0 33.0 5 31.76075 33.0 32.0 33.0 30.0 33.0 6 36.18775 37.0 36.0 38.0 34.0 38.0 7 37.04425 38.0 37.0 38.0 35.0 38.0 8 37.0655 38.0 38.0 38.0 35.0 38.0 9 37.32775 38.0 38.0 38.0 36.0 38.0 10-14 37.5025 38.0 38.0 38.0 37.0 38.0 15-19 37.498850000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.52505 38.0 38.0 38.0 37.6 38.0 25-29 37.561699999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.50225 38.0 38.0 38.0 38.0 38.0 35-39 37.46825 38.0 38.0 38.0 37.4 38.0 40-44 37.469100000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.33825 38.0 38.0 38.0 37.2 38.0 50-54 37.376 38.0 38.0 38.0 37.0 38.0 55-59 37.3137 38.0 38.0 38.0 36.8 38.0 60-64 36.71015 38.0 37.8 38.0 34.0 38.0 65-69 37.04605 38.0 38.0 38.0 36.0 38.0 70-74 37.20120000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.18705 38.0 38.0 38.0 36.8 38.0 80-84 37.065549999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.99615 38.0 38.0 38.0 35.8 38.0 90-94 36.737899999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.788650000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.86325000000001 38.0 38.0 38.0 35.4 38.0 105-109 36.55715 38.0 38.0 38.0 34.6 38.0 110-114 36.4576 38.0 38.0 38.0 34.2 38.0 115-119 36.508950000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.4445 38.0 38.0 38.0 34.0 38.0 125-129 36.2896 38.0 37.8 38.0 34.0 38.0 130-134 36.03295000000001 38.0 37.0 38.0 33.0 38.0 135-139 35.8303 38.0 36.8 38.0 32.6 38.0 140-144 35.6569 38.0 36.0 38.0 32.0 38.0 145-149 35.04995 38.0 36.0 38.0 30.6 38.0 150-151 31.331375 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 5.0 22 3.0 23 2.0 24 5.0 25 5.0 26 8.0 27 15.0 28 15.0 29 30.0 30 41.0 31 50.0 32 68.0 33 91.0 34 142.0 35 246.0 36 681.0 37 2584.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.49246231155779 13.869346733668342 9.72361809045226 37.91457286432161 2 23.799999999999997 14.899999999999999 33.675 27.625 3 21.575 20.65 24.525 33.25 4 22.95 29.15 21.2 26.700000000000003 5 22.475 33.6 24.15 19.775000000000002 6 19.2 35.475 25.074999999999996 20.25 7 14.774999999999999 25.575 41.8 17.849999999999998 8 19.3 25.2 29.95 25.55 9 16.675 25.95 33.074999999999996 24.3 10-14 20.275000000000002 29.64 26.855 23.23 15-19 19.72 29.604999999999997 27.365000000000002 23.31 20-24 20.200000000000003 29.315 27.41 23.075000000000003 25-29 19.29 29.335 27.3 24.075 30-34 20.10600530026501 28.21641082054103 27.791389569478476 23.886194309715485 35-39 19.93599679983999 28.97644882244112 27.326366318315916 23.761188059402972 40-44 20.09 28.89 27.215 23.805 45-49 19.59 28.999999999999996 27.63 23.78 50-54 19.895 28.815 26.939999999999998 24.349999999999998 55-59 20.685000000000002 28.825 26.985 23.505000000000003 60-64 19.965 29.325000000000003 27.089999999999996 23.62 65-69 19.91 28.42 27.18 24.490000000000002 70-74 20.415 28.345 27.565 23.674999999999997 75-79 20.05 28.685 27.334999999999997 23.93 80-84 20.415 28.835 27.195000000000004 23.555 85-89 20.215 29.044999999999998 26.915 23.825 90-94 20.1 28.875 26.51 24.515 95-99 20.136006800340017 28.736436821841092 27.26136306815341 23.866193309665483 100-104 20.694138827765553 28.510702140428084 26.925385077015402 23.869773954790958 105-109 20.04416340459701 28.761417243802068 27.014955334738534 24.17946401686239 110-114 20.41370979918466 28.793598067341087 27.35920277819719 23.433489355277064 115-119 20.72 28.549999999999997 26.965 23.765 120-124 20.36 28.165000000000003 26.965 24.51 125-129 20.95 28.095 27.05 23.905 130-134 20.815 27.925 26.919999999999998 24.34 135-139 21.18 27.965 26.965 23.89 140-144 20.845 28.28 26.685 24.19 145-149 20.84 28.18 26.729999999999997 24.25 150-151 21.515189398674835 27.69096137017127 26.090761345168147 24.70308788598575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.0 26 3.0 27 3.5 28 7.0 29 14.0 30 17.0 31 20.5 32 29.5 33 45.5 34 61.0 35 67.0 36 85.0 37 106.0 38 129.0 39 158.0 40 184.0 41 214.5 42 245.0 43 255.5 44 256.0 45 260.5 46 257.0 47 255.5 48 245.5 49 222.5 50 181.5 51 149.5 52 138.0 53 109.0 54 75.5 55 56.0 56 38.0 57 25.0 58 20.5 59 15.5 60 12.0 61 7.0 62 3.0 63 3.5 64 4.5 65 4.0 66 1.5 67 1.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.02 105-109 0.37 110-114 0.655 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.35 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 6.1375 0.0125 0.0 0.0 0.0 130-131 6.5875 0.025 0.0 0.0 0.0 132-133 7.1375 0.025 0.0 0.0 0.0 134-135 7.6875 0.025 0.0 0.0 0.0 136-137 8.2 0.025 0.0 0.0 0.0 138-139 8.7625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATCT 10 0.0068502324 144.8625 2 >>END_MODULE SRR7169804 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169804_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.957 33.0 33.0 34.0 32.0 34.0 2 33.11 34.0 33.0 34.0 32.0 34.0 3 33.14125 34.0 33.0 34.0 32.0 34.0 4 33.052 34.0 33.0 34.0 33.0 34.0 5 33.12975 34.0 33.0 34.0 32.0 34.0 6 37.274 38.0 38.0 38.0 37.0 38.0 7 37.34725 38.0 38.0 38.0 37.0 38.0 8 37.32675 38.0 38.0 38.0 37.0 38.0 9 37.2765 38.0 38.0 38.0 37.0 38.0 10-14 37.162 38.0 38.0 38.0 36.8 38.0 15-19 37.1736 38.0 38.0 38.0 37.0 38.0 20-24 37.198249999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.179950000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.11129999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.63475 38.0 38.0 38.0 34.8 38.0 40-44 37.0124 38.0 38.0 38.0 36.6 38.0 45-49 37.094350000000006 38.0 38.0 38.0 36.8 38.0 50-54 37.02025 38.0 38.0 38.0 36.8 38.0 55-59 36.8552 38.0 38.0 38.0 36.0 38.0 60-64 36.94085 38.0 38.0 38.0 36.0 38.0 65-69 36.9323 38.0 38.0 38.0 36.0 38.0 70-74 36.382 38.0 38.0 38.0 35.2 38.0 75-79 35.34769999999999 38.0 38.0 38.0 32.0 38.0 80-84 36.00215000000001 38.0 38.0 38.0 31.8 38.0 85-89 36.7307 38.0 38.0 38.0 35.6 38.0 90-94 36.6207 38.0 38.0 38.0 35.0 38.0 95-99 36.437349999999995 38.0 38.0 38.0 34.6 38.0 100-104 36.2566 38.0 38.0 38.0 34.0 38.0 105-109 34.94330000000001 38.0 37.2 38.0 28.8 38.0 110-114 33.69855 38.0 36.4 38.0 18.2 38.0 115-119 32.6448 38.0 35.8 38.0 2.0 38.0 120-124 32.94045 38.0 35.0 38.0 12.0 38.0 125-129 33.016549999999995 38.0 34.0 38.0 17.4 38.0 130-134 35.00605 38.0 36.0 38.0 27.8 38.0 135-139 35.0448 38.0 36.0 38.0 29.4 38.0 140-144 34.667899999999996 38.0 36.0 38.0 28.0 38.0 145-149 33.76185 38.0 33.8 38.0 23.4 38.0 150-151 29.95575 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 1.0 6 4.0 7 1.0 8 0.0 9 0.0 10 2.0 11 3.0 12 1.0 13 3.0 14 2.0 15 1.0 16 5.0 17 4.0 18 3.0 19 3.0 20 6.0 21 7.0 22 9.0 23 23.0 24 24.0 25 15.0 26 15.0 27 35.0 28 59.0 29 81.0 30 81.0 31 97.0 32 62.0 33 122.0 34 166.0 35 254.0 36 531.0 37 2372.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 19.175 13.975000000000001 27.950000000000003 2 26.650000000000002 25.3 31.075000000000003 16.975 3 20.8 27.05 31.624999999999996 20.525 4 24.125 34.675 22.475 18.725 5 24.0 35.475 22.35 18.175 6 21.85 37.025000000000006 22.5 18.625 7 19.75 21.075 39.775 19.400000000000002 8 22.400000000000002 24.975 27.700000000000003 24.925 9 22.075 25.6 30.3 22.025 10-14 23.855 28.185 26.515 21.445 15-19 22.645 28.115000000000002 28.095 21.145 20-24 23.285 28.23 27.794999999999998 20.69 25-29 23.74 27.975 27.66 20.625 30-34 23.135 28.050000000000004 27.975 20.84 35-39 22.91 27.965 28.07 21.055 40-44 23.32 28.084999999999997 27.794999999999998 20.8 45-49 23.395 28.144999999999996 27.88 20.580000000000002 50-54 23.169999999999998 27.905 28.215 20.71 55-59 23.465 27.47 28.68 20.385 60-64 23.294999999999998 27.66 28.595 20.45 65-69 23.075000000000003 28.000000000000004 28.13 20.794999999999998 70-74 23.521076868579524 27.043165831688682 28.83457314913213 20.601184150599668 75-79 23.60006239276244 27.20844382051682 28.77866167524567 20.41283211147507 80-84 23.313753291472555 27.486327729390318 28.51427992708122 20.685639052055905 85-89 23.94 27.465 28.225 20.369999999999997 90-94 24.01 27.655 28.035 20.3 95-99 23.7 27.41 27.97 20.919999999999998 100-104 24.313234926194646 27.405554165624217 27.875906930197647 20.40530397798349 105-109 24.054235884696993 27.573358174196557 28.422087667546446 19.950318273560004 110-114 24.61794198080326 27.50817738216526 27.304413105260334 20.569467531771142 115-119 24.663974777366004 27.36323911720781 27.418551911057026 20.554234194369158 120-124 24.49617415669792 27.502963681431186 28.009483780579803 19.991378381291085 125-129 24.590942679193496 27.74728174812625 27.37781061965586 20.283964953024388 130-134 24.90475235612593 27.67194706236214 27.085422097453378 20.337878484058553 135-139 24.805 27.544999999999998 27.435 20.215 140-144 25.135 27.58 27.54 19.744999999999997 145-149 25.180000000000003 27.43 27.725 19.665 150-151 25.513527054108216 27.505010020040082 27.530060120240478 19.451402805611224 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 0.5 24 2.0 25 4.0 26 4.0 27 4.5 28 5.0 29 6.5 30 8.0 31 18.0 32 32.0 33 38.5 34 44.0 35 63.5 36 85.5 37 108.5 38 145.0 39 172.0 40 182.5 41 211.0 42 258.0 43 288.0 44 294.0 45 273.0 46 276.0 47 268.5 48 224.5 49 194.5 50 176.0 51 162.5 52 120.0 53 81.0 54 65.0 55 48.0 56 34.0 57 27.0 58 22.5 59 14.5 60 9.0 61 7.0 62 6.0 63 4.0 64 1.5 65 1.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 1.195 75-79 3.8350000000000004 80-84 1.26 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 3.385 110-114 6.755 115-119 9.605 120-124 7.21 125-129 5.27 130-134 0.26 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.275 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.1625 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.3875 0.0 0.0 0.0 0.0 126-127 5.0875 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.2375 0.0 0.0 0.0 0.0 136-137 7.725 0.0 0.0 0.0 0.0 138-139 8.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747495 spots for SRR7169804.sra Written 747495 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra Read 747482 spots for SRR7169804.sra Written 747482 spots for SRR7169804.sra SRR ids: ['SRR7169804.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kym7wuo7 SRR7169804.sra spots: 14949653 blocks: [[1, 747482], [747483, 1494964], [1494965, 2242446], [2242447, 2989928], [2989929, 3737410], [3737411, 4484892], [4484893, 5232374], [5232375, 5979856], [5979857, 6727338], [6727339, 7474820], [7474821, 8222302], [8222303, 8969784], [8969785, 9717266], [9717267, 10464748], [10464749, 11212230], [11212231, 11959712], [11959713, 12707194], [12707195, 13454676], [13454677, 14202158], [14202159, 14949653]] SRR7169804 file size 5044246 SRR7169804 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169804 SRR7169804_1.fastq SRR7169804_2.fastq Input file: SRR7169804_1.fastq Paired file: SRR7169804_2.fastq trimmed: SRR7169804-trimmed-pair1.fastq, SRR7169804-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:18:13 2025 >> started Tue Feb 11 19:18:37 2025 >> done (24.242s) 14949653 read pairs processed; of these: 11713 ( 0.08%) short read pairs filtered out after trimming by size control 12568 ( 0.08%) empty read pairs filtered out after trimming by size control 14925372 (99.84%) read pairs available; of these: 6703951 (44.92%) trimmed read pairs available after processing 8221421 (55.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 4 0.00% 28 3 0.00% 29 10 0.00% 30 6 0.00% 31 4 0.00% 32 12 0.00% 33 7 0.00% 34 15 0.00% 35 16 0.00% 36 19 0.00% 37 15 0.00% 38 23 0.00% 39 29 0.00% 40 30 0.00% 41 54 0.00% 42 64 0.00% 43 49 0.00% 44 57 0.00% 45 58 0.00% 46 62 0.00% 47 57 0.00% 48 91 0.00% 49 99 0.00% 50 138 0.00% 51 117 0.00% 52 144 0.00% 53 170 0.00% 54 208 0.00% 55 195 0.00% 56 213 0.00% 57 242 0.00% 58 311 0.00% 59 337 0.00% 60 399 0.00% 61 480 0.00% 62 534 0.00% 63 637 0.00% 64 636 0.00% 65 760 0.01% 66 792 0.01% 67 830 0.01% 68 930 0.01% 69 1126 0.01% 70 1253 0.01% 71 1425 0.01% 72 1750 0.01% 73 1960 0.01% 74 2084 0.01% 75 2391 0.02% 76 2709 0.02% 77 2764 0.02% 78 2942 0.02% 79 3310 0.02% 80 3641 0.02% 81 4302 0.03% 82 4764 0.03% 83 5378 0.04% 84 6486 0.04% 85 7227 0.05% 86 7656 0.05% 87 8165 0.05% 88 8656 0.06% 89 9181 0.06% 90 9748 0.07% 91 10889 0.07% 92 11619 0.08% 93 12575 0.08% 94 13507 0.09% 95 14655 0.10% 96 15191 0.10% 97 15915 0.11% 98 16312 0.11% 99 17099 0.11% 100 17676 0.12% 101 18981 0.13% 102 19938 0.13% 103 21217 0.14% 104 22779 0.15% 105 23684 0.16% 106 24811 0.17% 107 25364 0.17% 108 25631 0.17% 109 26477 0.18% 110 26941 0.18% 111 28104 0.19% 112 29620 0.20% 113 31036 0.21% 114 32462 0.22% 115 33600 0.23% 116 34377 0.23% 117 35159 0.24% 118 35515 0.24% 119 35753 0.24% 120 36230 0.24% 121 37611 0.25% 122 38856 0.26% 123 40357 0.27% 124 42362 0.28% 125 44045 0.30% 126 46277 0.31% 127 47617 0.32% 128 47641 0.32% 129 47530 0.32% 130 48665 0.33% 131 49135 0.33% 132 50666 0.34% 133 52745 0.35% 134 54302 0.36% 135 56873 0.38% 136 58864 0.39% 137 61025 0.41% 138 63714 0.43% 139 66729 0.45% 140 70528 0.47% 141 75560 0.51% 142 80750 0.54% 143 89101 0.60% 144 101709 0.68% 145 122877 0.82% 146 142777 0.96% 147 190001 1.27% 148 281485 1.89% 149 547391 3.67% 150 3225848 21.61% 151 8221421 55.08% 14925372 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTACT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=295.03 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=20.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCTTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=35 prefix-density=0.26 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=89.07 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=20.6 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169804 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:19:30 Started mapping on | Feb 11 19:19:30 Finished on | Feb 11 19:20:53 Mapping speed, Million of reads per hour | 647.37 Number of input reads | 14925372 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14300317 Uniquely mapped reads % | 95.81% Average mapped length | 292.25 Number of splices: Total | 13035692 Number of splices: Annotated (sjdb) | 12813504 Number of splices: GT/AG | 12849252 Number of splices: GC/AG | 146454 Number of splices: AT/AC | 10559 Number of splices: Non-canonical | 29427 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249022 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 18623 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 386504 386504 386504 N_multimapping 249022 249022 249022 N_noFeature 378051 14139079 454506 N_ambiguous 142346 956 56808 UnstrandedReadsAssigned:13779920 PositiveStrandReadsAssigned:160282 NegativeStrandReadsAssigned:13789003 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169804 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169804-trimmed-pair1.fastq SRR7169804-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,925,372 reads, 13,703,001 reads pseudoaligned [quant] estimated average fragment length: 226.461 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7169804.ke.tsv 34699 SRR7169804.se.tsv 87100 total ==> SRR7169804.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.54 276 12.0446 Potri.005G024800.1.v4.1 1035 809.539 22 2.12588 Potri.004G059700.1.v4.1 961 735.554 2 0.212701 Potri.007G009000.2.v4.1 1416 1190.54 0 0 Potri.003G141000.2.v4.1 2943 2717.54 231 6.64951 Potri.016G087400.1.v4.1 270 87.4561 1264 1130.6 Potri.015G069301.1.v4.1 564 342.082 0 0 Potri.010G195200.1.v4.1 1773 1547.54 20.7178 1.04726 Potri.012G127500.1.v4.1 977 751.544 4744 493.792 ==> SRR7169804.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1671 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169804 completed mapping pipeline successfully