Starting /dee2/code/volunteer_pipeline.sh SRR7169805 current disk space = 3053101985792 free memory = 1578344784 SRR7169805 SRAfilesize 0112eb67e1835361a0b97138f353ad23 SRR7169805.sra SRR7169805.sra file validated SRR7169805 is paired end SRR7169805 is conventional basespace SRR7169805 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.7235 32.0 25.0 33.0 18.0 33.0 2 30.3985 31.0 29.0 33.0 27.0 33.0 3 32.1645 33.0 33.0 33.0 30.0 33.0 4 32.51075 33.0 33.0 33.0 31.0 34.0 5 32.95025 33.0 33.0 34.0 32.0 34.0 6 37.045 38.0 37.0 38.0 36.0 38.0 7 37.42025 38.0 38.0 38.0 37.0 38.0 8 37.51375 38.0 38.0 38.0 37.0 38.0 9 37.64275 38.0 38.0 38.0 38.0 38.0 10-14 37.5778 38.0 38.0 38.0 38.0 38.0 15-19 37.609300000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.60324999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.62375 38.0 38.0 38.0 38.0 38.0 30-34 37.57625 38.0 38.0 38.0 38.0 38.0 35-39 37.52205 38.0 38.0 38.0 38.0 38.0 40-44 37.538850000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.47165 38.0 38.0 38.0 37.6 38.0 50-54 37.42125 38.0 38.0 38.0 37.4 38.0 55-59 37.375550000000004 38.0 38.0 38.0 37.0 38.0 60-64 36.88215 38.0 37.8 38.0 35.2 38.0 65-69 37.19345 38.0 38.0 38.0 36.6 38.0 70-74 37.31165 38.0 38.0 38.0 37.0 38.0 75-79 37.2333 38.0 38.0 38.0 37.0 38.0 80-84 37.177299999999995 38.0 38.0 38.0 36.4 38.0 85-89 37.14789999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.90655 38.0 38.0 38.0 35.4 38.0 95-99 36.97975 38.0 38.0 38.0 35.6 38.0 100-104 36.96635 38.0 38.0 38.0 36.0 38.0 105-109 36.6656 38.0 38.0 38.0 34.8 38.0 110-114 36.573 38.0 38.0 38.0 35.0 38.0 115-119 36.7062 38.0 38.0 38.0 34.8 38.0 120-124 36.57535 38.0 38.0 38.0 34.4 38.0 125-129 36.5199 38.0 38.0 38.0 34.0 38.0 130-134 36.192899999999995 38.0 37.4 38.0 33.4 38.0 135-139 36.05525000000001 38.0 37.0 38.0 33.0 38.0 140-144 35.82775 38.0 36.2 38.0 32.6 38.0 145-149 35.3179 38.0 36.0 38.0 31.0 38.0 150-151 31.50425 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 2.0 21 1.0 22 0.0 23 5.0 24 6.0 25 9.0 26 6.0 27 14.0 28 13.0 29 28.0 30 25.0 31 34.0 32 52.0 33 77.0 34 111.0 35 252.0 36 524.0 37 2835.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.50877192982456 12.431077694235588 8.62155388471178 35.43859649122807 2 23.674999999999997 15.1 32.975 28.249999999999996 3 19.25 20.275000000000002 25.575 34.9 4 22.5 29.299999999999997 23.075000000000003 25.124999999999996 5 23.125 34.375 23.225 19.275000000000002 6 19.7 35.449999999999996 24.825 20.025000000000002 7 14.524999999999999 27.275 40.25 17.95 8 18.45 25.924999999999997 30.375000000000004 25.25 9 17.2 24.375 33.324999999999996 25.1 10-14 19.42 30.04 27.05 23.49 15-19 19.77 28.925 27.515 23.79 20-24 20.0 29.215000000000003 27.105 23.68 25-29 19.99 29.049999999999997 27.439999999999998 23.52 30-34 19.627944191628742 28.974346151922788 27.57913687053058 23.818572785917887 35-39 20.189037807561512 29.390878175635127 27.130426085217042 23.289657931586316 40-44 19.985 29.185 27.58 23.25 45-49 20.369999999999997 28.599999999999998 27.095000000000002 23.935000000000002 50-54 20.09 29.415000000000003 26.855 23.64 55-59 20.24 28.610000000000003 27.389999999999997 23.76 60-64 19.994999999999997 28.625 27.534999999999997 23.845 65-69 20.52 28.12 27.37 23.990000000000002 70-74 20.205000000000002 28.88 27.265 23.65 75-79 19.89 28.305000000000003 27.48 24.325 80-84 20.34 28.43 27.339999999999996 23.89 85-89 20.68 29.14 26.66 23.52 90-94 21.095 28.12 27.255000000000003 23.53 95-99 20.97104855242762 28.266413320666032 26.89134456722836 23.871193559677984 100-104 20.471259192555905 28.905898244034216 26.89479213567462 23.728050427735255 105-109 20.62114294315388 28.603682705333398 27.033264763433845 23.741909588078872 110-114 20.92567465701794 28.961254334388663 26.609377355646014 23.503693652947387 115-119 21.279999999999998 29.134999999999998 26.240000000000002 23.345 120-124 20.885 28.78 26.27 24.065 125-129 21.51 28.16 26.045 24.285 130-134 20.91 28.910000000000004 26.11 24.07 135-139 21.895 28.199999999999996 25.785000000000004 24.12 140-144 21.32 27.500000000000004 26.790000000000003 24.39 145-149 21.205 27.91 26.375 24.51 150-151 21.883206202325873 26.972614730523947 26.39739902463424 24.746780042515944 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 1.5 25 2.5 26 3.5 27 5.0 28 10.0 29 9.5 30 15.0 31 28.0 32 31.5 33 34.0 34 52.0 35 74.5 36 90.5 37 107.0 38 122.0 39 146.0 40 188.5 41 217.5 42 235.5 43 260.5 44 270.0 45 280.0 46 278.5 47 246.0 48 222.5 49 206.5 50 179.0 51 148.5 52 124.5 53 101.5 54 75.5 55 61.0 56 45.0 57 34.5 58 28.0 59 15.0 60 9.5 61 8.0 62 7.5 63 6.5 64 3.5 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.055 105-109 0.345 110-114 0.505 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.75 0.0 0.0 0.0 0.0 108-109 3.3499999999999996 0.0 0.0 0.0 0.0 110-111 3.6625 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.1875 0.0 0.0 0.0 0.0 118-119 5.824999999999999 0.0 0.0 0.0 0.0 120-121 6.275 0.0 0.0 0.0 0.0 122-123 7.025 0.0 0.0 0.0 0.0 124-125 7.65 0.0 0.0 0.0 0.0 126-127 8.350000000000001 0.0 0.0 0.0 0.0 128-129 9.025 0.0 0.0 0.0 0.0 130-131 9.8875 0.0 0.0 0.0 0.0 132-133 10.712499999999999 0.0 0.0 0.0 0.0 134-135 11.4375 0.0 0.0 0.0 0.0 136-137 12.100000000000001 0.0 0.0 0.0 0.0 138-139 12.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATAC 10 0.006871484 144.71251 5 AAAGATA 10 0.006871484 144.71251 4 >>END_MODULE SRR7169805 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169805_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0045 33.0 33.0 34.0 32.0 34.0 2 33.112 34.0 33.0 34.0 33.0 34.0 3 33.1175 34.0 33.0 34.0 33.0 34.0 4 33.0695 34.0 33.0 34.0 33.0 34.0 5 33.06325 34.0 33.0 34.0 33.0 34.0 6 37.23125 38.0 38.0 38.0 37.0 38.0 7 37.29225 38.0 38.0 38.0 38.0 38.0 8 37.3125 38.0 38.0 38.0 37.0 38.0 9 37.2275 38.0 38.0 38.0 37.0 38.0 10-14 37.2141 38.0 38.0 38.0 37.0 38.0 15-19 37.223400000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.223349999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.165499999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.093300000000006 38.0 38.0 38.0 37.0 38.0 35-39 36.787099999999995 38.0 38.0 38.0 35.8 38.0 40-44 37.060199999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.10314999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.0173 38.0 38.0 38.0 37.0 38.0 55-59 36.9733 38.0 38.0 38.0 36.6 38.0 60-64 36.97255 38.0 38.0 38.0 36.6 38.0 65-69 37.00205 38.0 38.0 38.0 36.8 38.0 70-74 36.5958 38.0 38.0 38.0 36.0 38.0 75-79 35.739250000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.2638 38.0 38.0 38.0 34.0 38.0 85-89 36.832550000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.731700000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.5522 38.0 38.0 38.0 35.0 38.0 100-104 36.4019 38.0 38.0 38.0 34.4 38.0 105-109 35.3842 38.0 38.0 38.0 31.2 38.0 110-114 34.40644999999999 38.0 37.2 38.0 25.6 38.0 115-119 33.356049999999996 38.0 36.4 38.0 14.2 38.0 120-124 33.6785 38.0 36.0 38.0 19.4 38.0 125-129 33.721050000000005 38.0 35.2 38.0 21.8 38.0 130-134 35.1622 38.0 36.0 38.0 28.8 38.0 135-139 35.129900000000006 38.0 36.0 38.0 30.4 38.0 140-144 34.718849999999996 38.0 36.0 38.0 28.8 38.0 145-149 33.79635 38.0 34.0 38.0 23.6 38.0 150-151 29.737250000000003 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 2.0 5 1.0 6 2.0 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 4.0 13 2.0 14 3.0 15 3.0 16 2.0 17 4.0 18 3.0 19 4.0 20 7.0 21 6.0 22 9.0 23 16.0 24 14.0 25 12.0 26 15.0 27 19.0 28 53.0 29 64.0 30 72.0 31 76.0 32 76.0 33 101.0 34 121.0 35 247.0 36 506.0 37 2537.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85 21.9 12.45 25.8 2 28.825 24.65 29.45 17.075000000000003 3 20.505126281570394 29.332333083270818 30.107526881720432 20.05501375343836 4 23.1807951987997 34.733683420855215 24.006001500375092 18.079519879969993 5 23.80595148787197 36.55913978494624 21.48037009252313 18.154538634658664 6 20.275000000000002 37.95 23.5 18.275 7 20.075000000000003 21.6 39.300000000000004 19.025 8 21.7 25.374999999999996 27.224999999999998 25.7 9 22.15 25.35 29.625 22.875 10-14 23.401170058502927 28.746437321866093 26.336316815840792 21.516075803790187 15-19 23.74737473747375 27.69276927692769 27.312731273127312 21.247124712471248 20-24 22.873431014652198 27.954193128969347 28.079211881782268 21.09316397459619 25-29 23.286164308215408 28.036401820091005 27.471373568678437 21.20606030301515 30-34 23.178476771515726 27.999199879981994 27.934190128519276 20.888133219982997 35-39 23.194638927785558 27.850570114022805 27.71054210842168 21.244248849769953 40-44 23.654730946189236 27.38047609521904 28.255651130226045 20.709141828365674 45-49 23.06345951892784 27.349102365354806 28.34425163774566 21.243186477971694 50-54 23.63972794558912 27.935587117423484 27.645529105821165 20.779155831166232 55-59 23.562356235623565 27.61776177617762 27.94279427942794 20.877087708770876 60-64 23.68 27.42 28.51 20.39 65-69 23.794999999999998 27.6 27.76 20.845 70-74 24.098087693627328 27.614914980574195 27.751147888389927 20.535849437408547 75-79 23.130022666391923 27.30785081392953 28.513290747990933 21.048835771687617 80-84 23.62351753721928 27.88291698208428 28.130204390613173 20.36336109008327 85-89 23.956197809890494 27.821391069553474 28.07140357017851 20.15100755037752 90-94 23.419999999999998 27.310000000000002 28.144999999999996 21.125 95-99 23.895 27.500000000000004 27.884999999999998 20.72 100-104 24.306076519129782 27.026756689172295 28.722180545136283 19.94498624656164 105-109 24.433391447031074 27.407445390216388 27.90483027381807 20.254332888934467 110-114 24.10337552742616 27.231012658227847 28.14873417721519 20.5168776371308 115-119 24.256753084406764 27.887385183977393 27.631936518289034 20.223925213326808 120-124 24.790761733234454 26.978493484479287 27.614154041741713 20.61659074054455 125-129 25.107977311755214 27.7202476973513 27.35078316074309 19.82099183015039 130-134 25.7825411929684 27.60554915610758 26.939450092652876 19.672459558271147 135-139 25.8 27.05 27.47 19.68 140-144 26.090000000000003 27.675 26.884999999999998 19.35 145-149 26.424999999999997 27.439999999999998 26.840000000000003 19.295 150-151 27.193092228757354 26.792641721937176 27.71868351895883 18.29558253034664 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 4.0 28 4.0 29 5.5 30 7.5 31 13.5 32 25.5 33 30.0 34 36.0 35 55.5 36 84.0 37 112.5 38 140.5 39 174.5 40 205.5 41 223.5 42 246.0 43 271.5 44 280.0 45 279.0 46 281.5 47 265.5 48 234.5 49 213.0 50 178.0 51 147.5 52 123.5 53 91.0 54 64.5 55 48.0 56 35.5 57 26.5 58 18.0 59 12.0 60 12.0 61 10.5 62 9.0 63 8.0 64 6.5 65 3.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.015 25-29 0.005 30-34 0.015 35-39 0.02 40-44 0.02 45-49 0.015 50-54 0.02 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.905 75-79 2.94 80-84 0.9249999999999999 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.025 105-109 2.4899999999999998 110-114 5.2 115-119 8.004999999999999 120-124 5.609999999999999 125-129 3.9149999999999996 130-134 0.165 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.5250000000000004 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.325 0.0 0.0 0.0 0.0 116-117 4.7875 0.0 0.0 0.0 0.0 118-119 5.375 0.0 0.0 0.0 0.0 120-121 5.800000000000001 0.0 0.0 0.0 0.0 122-123 6.425 0.0 0.0 0.0 0.0 124-125 6.9875 0.0 0.0 0.0 0.0 126-127 7.675 0.0 0.0 0.0 0.0 128-129 8.337499999999999 0.0 0.0 0.0 0.0 130-131 9.2125 0.0 0.0 0.0 0.0 132-133 10.037500000000001 0.0 0.0 0.0 0.0 134-135 10.7625 0.0 0.0 0.0 0.0 136-137 11.45 0.0 0.0 0.0 0.0 138-139 12.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAGAC 10 0.007275278 141.97499 8 CAATACC 10 0.007275278 141.97499 3 CCGAAGA 10 0.007275278 141.97499 7 CAGATCG 40 0.0060355854 18.879654 125-129 >>END_MODULE Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656027 spots for SRR7169805.sra Written 656027 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra Read 656013 spots for SRR7169805.sra Written 656013 spots for SRR7169805.sra SRR ids: ['SRR7169805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_797da1cg SRR7169805.sra spots: 13120274 blocks: [[1, 656013], [656014, 1312026], [1312027, 1968039], [1968040, 2624052], [2624053, 3280065], [3280066, 3936078], [3936079, 4592091], [4592092, 5248104], [5248105, 5904117], [5904118, 6560130], [6560131, 7216143], [7216144, 7872156], [7872157, 8528169], [8528170, 9184182], [9184183, 9840195], [9840196, 10496208], [10496209, 11152221], [11152222, 11808234], [11808235, 12464247], [12464248, 13120274]] SRR7169805 file size 4424329 SRR7169805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169805 SRR7169805_1.fastq SRR7169805_2.fastq Input file: SRR7169805_1.fastq Paired file: SRR7169805_2.fastq trimmed: SRR7169805-trimmed-pair1.fastq, SRR7169805-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:21:51 2025 >> started Tue Feb 11 20:22:06 2025 >> done (14.929s) 13120274 read pairs processed; of these: 12607 ( 0.10%) short read pairs filtered out after trimming by size control 12096 ( 0.09%) empty read pairs filtered out after trimming by size control 13095571 (99.81%) read pairs available; of these: 6231782 (47.59%) trimmed read pairs available after processing 6863789 (52.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 1 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 8 0.00% 30 5 0.00% 31 12 0.00% 32 17 0.00% 33 9 0.00% 34 17 0.00% 35 9 0.00% 36 24 0.00% 37 17 0.00% 38 25 0.00% 39 28 0.00% 40 31 0.00% 41 38 0.00% 42 41 0.00% 43 35 0.00% 44 39 0.00% 45 42 0.00% 46 80 0.00% 47 84 0.00% 48 76 0.00% 49 103 0.00% 50 128 0.00% 51 133 0.00% 52 152 0.00% 53 167 0.00% 54 173 0.00% 55 208 0.00% 56 268 0.00% 57 278 0.00% 58 324 0.00% 59 366 0.00% 60 377 0.00% 61 498 0.00% 62 606 0.00% 63 696 0.01% 64 705 0.01% 65 725 0.01% 66 841 0.01% 67 994 0.01% 68 1128 0.01% 69 1283 0.01% 70 1472 0.01% 71 1716 0.01% 72 2048 0.02% 73 2385 0.02% 74 2630 0.02% 75 2803 0.02% 76 3210 0.02% 77 3487 0.03% 78 3781 0.03% 79 4179 0.03% 80 4525 0.03% 81 5394 0.04% 82 6128 0.05% 83 6926 0.05% 84 8192 0.06% 85 9105 0.07% 86 9687 0.07% 87 10261 0.08% 88 10621 0.08% 89 11426 0.09% 90 12139 0.09% 91 13129 0.10% 92 14416 0.11% 93 15906 0.12% 94 17235 0.13% 95 18145 0.14% 96 19026 0.15% 97 19564 0.15% 98 20204 0.15% 99 20818 0.16% 100 21986 0.17% 101 23058 0.18% 102 24572 0.19% 103 26196 0.20% 104 27608 0.21% 105 29142 0.22% 106 29992 0.23% 107 30559 0.23% 108 31315 0.24% 109 31760 0.24% 110 32400 0.25% 111 33602 0.26% 112 35412 0.27% 113 36750 0.28% 114 38692 0.30% 115 40066 0.31% 116 41199 0.31% 117 41788 0.32% 118 41756 0.32% 119 41891 0.32% 120 42807 0.33% 121 43686 0.33% 122 44703 0.34% 123 46627 0.36% 124 48545 0.37% 125 50229 0.38% 126 52841 0.40% 127 53448 0.41% 128 54056 0.41% 129 54214 0.41% 130 54617 0.42% 131 55727 0.43% 132 56207 0.43% 133 58140 0.44% 134 59948 0.46% 135 61969 0.47% 136 64466 0.49% 137 66202 0.51% 138 69541 0.53% 139 70953 0.54% 140 72937 0.56% 141 77201 0.59% 142 81867 0.63% 143 87750 0.67% 144 98715 0.75% 145 115203 0.88% 146 129587 0.99% 147 166926 1.27% 148 238260 1.82% 149 446221 3.41% 150 2657059 20.29% 151 6863789 52.41% 13095571 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=56.71 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.3 sequence=AAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.53 fanout-score-rank=21 prefix-density=0.33 prefix-fanout=4.0 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=45.20 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=12.0 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7169805 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:22:49 Started mapping on | Feb 11 20:22:49 Finished on | Feb 11 20:23:54 Mapping speed, Million of reads per hour | 725.29 Number of input reads | 13095571 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12520721 Uniquely mapped reads % | 95.61% Average mapped length | 289.56 Number of splices: Total | 11044476 Number of splices: Annotated (sjdb) | 10856418 Number of splices: GT/AG | 10890715 Number of splices: GC/AG | 122811 Number of splices: AT/AC | 8641 Number of splices: Non-canonical | 22309 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225035 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 71221 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 360252 360252 360252 N_multimapping 225035 225035 225035 N_noFeature 298042 12341850 374143 N_ambiguous 150026 721 46780 UnstrandedReadsAssigned:12072653 PositiveStrandReadsAssigned:178150 NegativeStrandReadsAssigned:12099798 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169805 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169805-trimmed-pair1.fastq SRR7169805-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,095,571 reads, 12,066,907 reads pseudoaligned [quant] estimated average fragment length: 211.44 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7169805.ke.tsv 34699 SRR7169805.se.tsv 87100 total ==> SRR7169805.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.56 188 9.02681 Potri.005G024800.1.v4.1 1035 824.56 46 4.84178 Potri.004G059700.1.v4.1 961 750.582 0 0 Potri.007G009000.2.v4.1 1416 1205.56 0 0 Potri.003G141000.2.v4.1 2943 2732.56 212.069 6.73562 Potri.016G087400.1.v4.1 270 95.0853 1216.6 1110.46 Potri.015G069301.1.v4.1 564 356.049 0 0 Potri.010G195200.1.v4.1 1773 1562.56 17 0.944238 Potri.012G127500.1.v4.1 977 766.575 2650 300.027 ==> SRR7169805.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1515 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 5 SRR7169805 completed mapping pipeline successfully