Starting /dee2/code/volunteer_pipeline.sh SRR7169806 current disk space = 3053271166976 free memory = 1309279040 SRR7169806 SRAfilesize ab63049f7f1f697250a63a0a49cbff47 SRR7169806.sra SRR7169806.sra file validated SRR7169806 is paired end SRR7169806 is conventional basespace SRR7169806 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169806_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0445 32.0 30.0 33.0 18.0 33.0 2 32.19 33.0 33.0 33.0 30.0 34.0 3 32.62425 33.0 33.0 34.0 31.0 34.0 4 33.028 33.0 33.0 34.0 32.0 34.0 5 33.3255 34.0 33.0 34.0 33.0 34.0 6 37.239 38.0 38.0 38.0 36.0 38.0 7 37.42475 38.0 38.0 38.0 37.0 38.0 8 37.51825 38.0 38.0 38.0 38.0 38.0 9 37.58575 38.0 38.0 38.0 38.0 38.0 10-14 37.597950000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.59575 38.0 38.0 38.0 38.0 38.0 20-24 37.56269999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.58 38.0 38.0 38.0 38.0 38.0 30-34 37.5925 38.0 38.0 38.0 38.0 38.0 35-39 37.5175 38.0 38.0 38.0 38.0 38.0 40-44 37.48625 38.0 38.0 38.0 37.8 38.0 45-49 37.41525 38.0 38.0 38.0 37.4 38.0 50-54 37.36775 38.0 38.0 38.0 37.0 38.0 55-59 37.20505 38.0 38.0 38.0 36.8 38.0 60-64 37.001549999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.2054 38.0 38.0 38.0 36.8 38.0 70-74 37.18065 38.0 38.0 38.0 36.8 38.0 75-79 37.04085 38.0 38.0 38.0 36.2 38.0 80-84 37.0342 38.0 38.0 38.0 36.0 38.0 85-89 37.0264 38.0 38.0 38.0 36.0 38.0 90-94 36.822700000000005 38.0 38.0 38.0 35.8 38.0 95-99 36.889599999999994 38.0 38.0 38.0 36.0 38.0 100-104 36.886700000000005 38.0 38.0 38.0 36.0 38.0 105-109 36.78335 38.0 38.0 38.0 35.4 38.0 110-114 36.64190000000001 38.0 38.0 38.0 34.8 38.0 115-119 36.4486 38.0 38.0 38.0 34.4 38.0 120-124 36.3794 38.0 38.0 38.0 34.2 38.0 125-129 36.23369999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.02910000000001 38.0 37.4 38.0 33.2 38.0 135-139 35.78189999999999 38.0 36.6 38.0 32.4 38.0 140-144 35.5746 38.0 36.0 38.0 32.2 38.0 145-149 35.019999999999996 38.0 36.0 38.0 30.2 38.0 150-151 30.863500000000002 36.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 3.0 19 10.0 20 3.0 21 4.0 22 1.0 23 7.0 24 5.0 25 10.0 26 7.0 27 9.0 28 16.0 29 27.0 30 24.0 31 37.0 32 56.0 33 76.0 34 104.0 35 215.0 36 506.0 37 2872.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.05 10.5 15.125 42.325 2 21.02102102102102 14.614614614614615 34.08408408408408 30.28028028028028 3 21.7 18.75 24.474999999999998 35.075 4 23.575 27.900000000000002 21.099999999999998 27.425 5 23.375 32.85 23.275000000000002 20.5 6 19.325 35.15 25.25 20.275000000000002 7 14.35 27.075 41.025 17.549999999999997 8 18.425 25.75 32.5 23.325000000000003 9 18.025 24.474999999999998 33.025 24.474999999999998 10-14 19.535 30.314999999999998 26.979999999999997 23.169999999999998 15-19 19.56 29.45 27.79 23.200000000000003 20-24 19.415 29.78 27.065 23.74 25-29 19.645000000000003 29.665000000000003 26.979999999999997 23.71 30-34 19.375 29.435 27.500000000000004 23.69 35-39 20.02 29.59 26.924999999999997 23.465 40-44 19.935 29.654999999999998 26.825 23.585 45-49 20.235 28.470000000000002 27.375 23.919999999999998 50-54 19.744999999999997 28.67 27.79 23.794999999999998 55-59 20.06 29.23 27.1 23.61 60-64 20.03 28.694999999999997 27.565 23.71 65-69 19.48 29.060000000000002 27.515 23.945 70-74 20.175 29.409999999999997 27.275 23.14 75-79 20.095 28.910000000000004 27.534999999999997 23.46 80-84 20.419999999999998 28.79 27.26 23.53 85-89 20.09 29.38 27.139999999999997 23.39 90-94 20.495 28.88 27.150000000000002 23.474999999999998 95-99 20.23 29.18 27.015 23.575 100-104 20.89 28.7 26.724999999999998 23.685000000000002 105-109 20.424999999999997 29.060000000000002 27.175 23.34 110-114 21.135567783891947 28.274137068534266 26.45822911455728 24.132066033016507 115-119 20.64 28.825 26.52 24.015 120-124 20.745 28.33 26.674999999999997 24.25 125-129 21.095 27.785 27.205000000000002 23.915 130-134 21.115000000000002 28.99 26.090000000000003 23.805 135-139 21.055 28.825 25.740000000000002 24.38 140-144 20.86 28.305000000000003 26.47 24.365000000000002 145-149 21.18 28.110000000000003 25.965 24.745 150-151 21.224999999999998 27.8375 26.275 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 4.0 26 5.5 27 9.0 28 14.0 29 15.0 30 20.5 31 29.0 32 34.0 33 41.0 34 57.5 35 78.0 36 96.0 37 114.5 38 134.0 39 172.5 40 200.5 41 214.5 42 240.0 43 263.0 44 262.0 45 255.5 46 259.5 47 236.0 48 229.5 49 218.0 50 166.0 51 135.5 52 117.0 53 97.5 54 72.5 55 56.5 56 42.0 57 28.0 58 24.0 59 13.0 60 8.5 61 9.0 62 9.0 63 5.0 64 2.0 65 1.0 66 1.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.4534005037783375 0.8999999999999999 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025188916876574305 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0125 0.0 0.0 0.0 60-61 0.07500000000000001 0.025 0.0 0.0 0.0 62-63 0.125 0.025 0.0 0.0 0.0 64-65 0.125 0.025 0.0 0.0 0.0 66-67 0.15 0.025 0.0 0.0 0.0 68-69 0.15 0.025 0.0 0.0 0.0 70-71 0.15 0.025 0.0 0.0 0.0 72-73 0.16249999999999998 0.025 0.0 0.0 0.0 74-75 0.225 0.025 0.0 0.0 0.0 76-77 0.2875 0.025 0.0 0.0 0.0 78-79 0.3375 0.025 0.0 0.0 0.0 80-81 0.4 0.025 0.0 0.0 0.0 82-83 0.4125 0.025 0.0 0.0 0.0 84-85 0.5875 0.025 0.0 0.0 0.0 86-87 0.825 0.025 0.0 0.0 0.0 88-89 0.9874999999999999 0.025 0.0 0.0 0.0 90-91 1.125 0.025 0.0 0.0 0.0 92-93 1.325 0.025 0.0 0.0 0.0 94-95 1.5125 0.025 0.0 0.0 0.0 96-97 1.8125 0.025 0.0 0.0 0.0 98-99 2.125 0.025 0.0 0.0 0.0 100-101 2.425 0.025 0.0 0.0 0.0 102-103 2.75 0.025 0.0 0.0 0.0 104-105 3.0875000000000004 0.025 0.0 0.0 0.0 106-107 3.55 0.025 0.0 0.0 0.0 108-109 3.9625 0.025 0.0 0.0 0.0 110-111 4.4 0.025 0.0 0.0 0.0 112-113 4.7625 0.025 0.0 0.0 0.0 114-115 5.25 0.025 0.0 0.0 0.0 116-117 5.85 0.025 0.0 0.0 0.0 118-119 6.237500000000001 0.025 0.0 0.0 0.0 120-121 7.0125 0.025 0.0 0.0 0.0 122-123 7.775 0.025 0.0 0.0 0.0 124-125 8.5625 0.025 0.0 0.0 0.0 126-127 9.0625 0.025 0.0 0.0 0.0 128-129 9.6625 0.025 0.0 0.0 0.0 130-131 10.3875 0.025 0.0 0.0 0.0 132-133 11.325 0.025 0.0 0.0 0.0 134-135 12.149999999999999 0.025 0.0 0.0 0.0 136-137 12.825 0.025 0.0 0.0 0.0 138-139 13.4125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTATA 10 0.006830828 145.0 2 CTGTTAT 10 0.006830828 145.0 3 >>END_MODULE SRR7169806 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169806_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.976 33.0 33.0 34.0 32.0 34.0 2 33.139 34.0 33.0 34.0 33.0 34.0 3 33.1415 34.0 33.0 34.0 33.0 34.0 4 33.11225 34.0 33.0 34.0 33.0 34.0 5 33.17225 34.0 33.0 34.0 33.0 34.0 6 37.32025 38.0 38.0 38.0 38.0 38.0 7 37.34675 38.0 38.0 38.0 38.0 38.0 8 37.328 38.0 38.0 38.0 38.0 38.0 9 37.30025 38.0 38.0 38.0 38.0 38.0 10-14 37.3223 38.0 38.0 38.0 37.8 38.0 15-19 37.1626 38.0 38.0 38.0 37.4 38.0 20-24 37.24265 38.0 38.0 38.0 37.6 38.0 25-29 37.18765 38.0 38.0 38.0 37.2 38.0 30-34 37.09895 38.0 38.0 38.0 36.8 38.0 35-39 37.12625 38.0 38.0 38.0 37.2 38.0 40-44 37.235749999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.13755 38.0 38.0 38.0 37.0 38.0 50-54 37.065200000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.8939 38.0 38.0 38.0 36.4 38.0 60-64 36.74785 38.0 38.0 38.0 35.8 38.0 65-69 36.98565 38.0 38.0 38.0 36.8 38.0 70-74 36.9751 38.0 38.0 38.0 36.8 38.0 75-79 35.978100000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.556799999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.589299999999994 38.0 37.8 38.0 34.8 38.0 90-94 36.588449999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.68205 38.0 38.0 38.0 36.0 38.0 100-104 36.5283 38.0 38.0 38.0 35.2 38.0 105-109 35.0376 38.0 37.0 38.0 27.8 38.0 110-114 34.42425 38.0 37.8 38.0 25.0 38.0 115-119 33.67935 38.0 37.0 38.0 16.0 38.0 120-124 33.8579 38.0 37.0 38.0 19.8 38.0 125-129 34.35575 38.0 36.6 38.0 24.2 38.0 130-134 34.8625 38.0 35.8 38.0 27.8 38.0 135-139 34.6779 38.0 35.8 38.0 26.6 38.0 140-144 34.768150000000006 38.0 36.0 38.0 29.0 38.0 145-149 33.319300000000005 38.0 33.8 38.0 21.2 38.0 150-151 30.008499999999998 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 2.0 5 0.0 6 2.0 7 2.0 8 0.0 9 2.0 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 3.0 16 3.0 17 7.0 18 6.0 19 8.0 20 11.0 21 2.0 22 14.0 23 14.0 24 29.0 25 14.0 26 14.0 27 17.0 28 25.0 29 49.0 30 64.0 31 68.0 32 93.0 33 99.0 34 134.0 35 208.0 36 486.0 37 2604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.775000000000002 17.175 24.725 28.325 2 26.23811905952976 24.212106053026513 30.540270135067534 19.009504752376188 3 21.26220886551465 27.64838467317806 30.453293263210618 20.63611319809667 4 24.67434869739479 29.959919839679362 25.826653306613228 19.539078156312627 5 26.082603254067582 33.81727158948686 22.478097622027533 17.622027534418024 6 20.225 37.7 23.75 18.325 7 20.849999999999998 19.650000000000002 39.775 19.725 8 22.275 25.775 27.6 24.349999999999998 9 22.3 24.55 30.325000000000003 22.825 10-14 23.615 28.549999999999997 25.96 21.875 15-19 23.555600020009003 27.372317542894304 28.27272272522635 20.79935971187034 20-24 23.845 27.889999999999997 27.089999999999996 21.175 25-29 23.165 28.625 27.655 20.555 30-34 22.94229422942294 28.742874287428744 28.047804780478046 20.267026702670268 35-39 23.265 27.99 28.249999999999996 20.495 40-44 23.36 27.775 27.675 21.19 45-49 23.139627925585117 27.870574114822965 28.110622124424882 20.879175835167032 50-54 23.783540248297957 27.948538245895072 27.983580296355626 20.28434120945134 55-59 23.87574408483818 28.052623680656296 27.88754939722875 20.184082837276772 60-64 23.587358735873586 27.04270427042704 28.322832283228323 21.04710471047105 65-69 23.435 27.889999999999997 28.46 20.215 70-74 23.88724778450909 27.61728333249887 27.947729434736896 20.547739448255147 75-79 23.837536446877078 27.448974372090646 28.359506880147322 20.353982300884958 80-84 23.609158465555332 27.987547700341437 27.600923880297252 20.802369953805986 85-89 23.44 27.955000000000002 28.575 20.03 90-94 23.85238523852385 27.30773077307731 28.297829782978294 20.54205420542054 95-99 24.19467787114846 27.3359343737495 28.59643857543017 19.87294917967187 100-104 24.169501701020614 27.181308785271163 28.46207724634781 20.187112267360416 105-109 23.718737187371875 26.839893398933988 29.002665026650266 20.43870438704387 110-114 24.57121747849491 27.067391419072244 28.291730434323707 20.069660668109137 115-119 25.545709963259135 27.755565161011454 27.52323319645559 19.17549167927383 120-124 25.227478316394404 27.712446123556646 27.499600915234396 19.56047464481456 125-129 25.410859163719575 27.563969211566462 27.68358643644685 19.34158518826711 130-134 25.41176470588235 27.8648310387985 27.284105131414265 19.43929912390488 135-139 26.3 27.685 26.965 19.05 140-144 25.7 27.900000000000002 27.365000000000002 19.035 145-149 26.436321816090803 27.466373318665934 26.976348817440872 19.12095604780239 150-151 27.38933601609658 27.200704225352112 26.483903420523134 18.926056338028168 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.5 26 3.0 27 2.5 28 4.5 29 8.5 30 13.0 31 16.0 32 20.5 33 32.5 34 47.5 35 60.0 36 76.0 37 104.0 38 141.5 39 171.5 40 205.5 41 240.5 42 263.0 43 277.0 44 288.0 45 291.0 46 275.5 47 260.0 48 228.0 49 187.5 50 170.5 51 149.0 52 107.0 53 92.0 54 76.5 55 50.0 56 38.0 57 27.5 58 21.0 59 13.0 60 7.5 61 3.0 62 2.5 63 4.5 64 5.0 65 4.0 66 2.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.05 3 0.17500000000000002 4 0.2 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.045 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.12 55-59 0.045 60-64 0.01 65-69 0.0 70-74 0.135 75-79 2.255 80-84 0.42 85-89 0.0 90-94 0.01 95-99 0.04 100-104 0.06 105-109 2.44 110-114 5.255 115-119 7.46 120-124 6.035 125-129 3.8600000000000003 130-134 0.125 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49647532729104 98.8 2 0.42799597180261834 0.8500000000000001 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025176233635448138 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.325 0.0 0.0 0.0 0.0 94-95 1.5125 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 3.0 0.0 0.0 0.0 0.0 106-107 3.45 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.262499999999999 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.1 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.0375 0.0 0.0 0.0 0.0 120-121 6.675 0.0 0.0 0.0 0.0 122-123 7.425 0.0 0.0 0.0 0.0 124-125 8.1125 0.0 0.0 0.0 0.0 126-127 8.587499999999999 0.0 0.0 0.0 0.0 128-129 9.2125 0.0 0.0 0.0 0.0 130-131 9.962499999999999 0.0 0.0 0.0 0.0 132-133 10.925 0.0 0.0 0.0 0.0 134-135 11.7375 0.0 0.0 0.0 0.0 136-137 12.3875 0.0 0.0 0.0 0.0 138-139 12.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665824 spots for SRR7169806.sra Written 665824 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra Read 665813 spots for SRR7169806.sra Written 665813 spots for SRR7169806.sra SRR ids: ['SRR7169806.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3vcdvhfc SRR7169806.sra spots: 13316271 blocks: [[1, 665813], [665814, 1331626], [1331627, 1997439], [1997440, 2663252], [2663253, 3329065], [3329066, 3994878], [3994879, 4660691], [4660692, 5326504], [5326505, 5992317], [5992318, 6658130], [6658131, 7323943], [7323944, 7989756], [7989757, 8655569], [8655570, 9321382], [9321383, 9987195], [9987196, 10653008], [10653009, 11318821], [11318822, 11984634], [11984635, 12650447], [12650448, 13316271]] SRR7169806 file size 4490746 SRR7169806 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169806 SRR7169806_1.fastq SRR7169806_2.fastq Input file: SRR7169806_1.fastq Paired file: SRR7169806_2.fastq trimmed: SRR7169806-trimmed-pair1.fastq, SRR7169806-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:48:30 2025 >> started Tue Feb 11 19:48:47 2025 >> done (16.116s) 13316271 read pairs processed; of these: 18061 ( 0.14%) short read pairs filtered out after trimming by size control 94971 ( 0.71%) empty read pairs filtered out after trimming by size control 13203239 (99.15%) read pairs available; of these: 6370971 (48.25%) trimmed read pairs available after processing 6832268 (51.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 17 0.00% 21 16 0.00% 22 12 0.00% 23 11 0.00% 24 12 0.00% 25 11 0.00% 26 9 0.00% 27 16 0.00% 28 9 0.00% 29 6 0.00% 30 13 0.00% 31 23 0.00% 32 19 0.00% 33 24 0.00% 34 19 0.00% 35 19 0.00% 36 26 0.00% 37 33 0.00% 38 46 0.00% 39 33 0.00% 40 48 0.00% 41 67 0.00% 42 77 0.00% 43 79 0.00% 44 66 0.00% 45 107 0.00% 46 141 0.00% 47 174 0.00% 48 206 0.00% 49 182 0.00% 50 248 0.00% 51 247 0.00% 52 345 0.00% 53 377 0.00% 54 360 0.00% 55 386 0.00% 56 427 0.00% 57 496 0.00% 58 581 0.00% 59 703 0.01% 60 726 0.01% 61 880 0.01% 62 925 0.01% 63 1089 0.01% 64 1132 0.01% 65 1289 0.01% 66 1407 0.01% 67 1439 0.01% 68 1644 0.01% 69 1872 0.01% 70 2093 0.02% 71 2471 0.02% 72 2935 0.02% 73 3186 0.02% 74 3613 0.03% 75 3967 0.03% 76 5646 0.04% 77 5809 0.04% 78 5255 0.04% 79 5744 0.04% 80 6204 0.05% 81 6897 0.05% 82 7605 0.06% 83 8570 0.06% 84 9971 0.08% 85 11393 0.09% 86 12066 0.09% 87 12548 0.10% 88 13600 0.10% 89 14628 0.11% 90 15438 0.12% 91 16107 0.12% 92 17534 0.13% 93 18481 0.14% 94 19898 0.15% 95 21569 0.16% 96 22320 0.17% 97 23293 0.18% 98 24402 0.18% 99 24810 0.19% 100 26363 0.20% 101 26750 0.20% 102 28276 0.21% 103 29628 0.22% 104 30901 0.23% 105 32363 0.25% 106 33927 0.26% 107 34796 0.26% 108 35712 0.27% 109 36647 0.28% 110 37652 0.29% 111 38464 0.29% 112 39246 0.30% 113 40613 0.31% 114 41797 0.32% 115 43588 0.33% 116 44516 0.34% 117 45932 0.35% 118 46991 0.36% 119 47137 0.36% 120 47917 0.36% 121 49010 0.37% 122 50021 0.38% 123 50953 0.39% 124 51789 0.39% 125 53232 0.40% 126 54781 0.41% 127 56702 0.43% 128 57663 0.44% 129 58460 0.44% 130 59576 0.45% 131 59980 0.45% 132 60638 0.46% 133 61958 0.47% 134 62888 0.48% 135 63978 0.48% 136 66560 0.50% 137 68386 0.52% 138 71467 0.54% 139 73691 0.56% 140 76687 0.58% 141 79707 0.60% 142 83102 0.63% 143 88703 0.67% 144 95600 0.72% 145 107539 0.81% 146 124658 0.94% 147 156591 1.19% 148 225387 1.71% 149 477830 3.62% 150 2568057 19.45% 151 6832268 51.75% 13203239 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=99.17 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=2.7 sequence=CTCATAATCTTGCAAGATACATACATCATGAATTGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.13 fanout-score-rank=19 prefix-density=0.23 prefix-fanout=4.0 sequence=AGTGAGCAATTCACAGCTATGTTCAGGAGGAAGGCTTTCTTGCACTGGTACACCGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=33 fanout-score=54.15 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=11.8 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7169806 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:49:28 Started mapping on | Feb 11 19:49:28 Finished on | Feb 11 19:50:42 Mapping speed, Million of reads per hour | 642.32 Number of input reads | 13203239 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12708468 Uniquely mapped reads % | 96.25% Average mapped length | 288.42 Number of splices: Total | 10808295 Number of splices: Annotated (sjdb) | 10604604 Number of splices: GT/AG | 10654630 Number of splices: GC/AG | 117590 Number of splices: AT/AC | 9649 Number of splices: Non-canonical | 26426 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217632 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 48962 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.66% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 290024 290024 290024 N_multimapping 217632 217632 217632 N_noFeature 360102 12536153 422937 N_ambiguous 163921 609 54014 UnstrandedReadsAssigned:12184445 PositiveStrandReadsAssigned:171706 NegativeStrandReadsAssigned:12231517 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169806 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169806-trimmed-pair1.fastq SRR7169806-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,203,239 reads, 12,200,489 reads pseudoaligned [quant] estimated average fragment length: 204.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7169806.ke.tsv 34699 SRR7169806.se.tsv 87100 total ==> SRR7169806.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.23 211 9.81096 Potri.005G024800.1.v4.1 1035 831.232 19 1.92821 Potri.004G059700.1.v4.1 961 757.232 1 0.111402 Potri.007G009000.2.v4.1 1416 1212.23 0 0 Potri.003G141000.2.v4.1 2943 2739.23 180.026 5.54406 Potri.016G087400.1.v4.1 270 96.2682 1085 950.755 Potri.015G069301.1.v4.1 564 361.79 0 0 Potri.010G195200.1.v4.1 1773 1569.23 21 1.1289 Potri.012G127500.1.v4.1 977 773.232 2275 248.195 ==> SRR7169806.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1616 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169806 completed mapping pipeline successfully