Starting /dee2/code/volunteer_pipeline.sh SRR7169807 current disk space = 3053396910080 free memory = 1409076176 SRR7169807 SRAfilesize 9b6af11d91f62fa4f7d5b942b700d5ee SRR7169807.sra SRR7169807.sra file validated SRR7169807 is paired end SRR7169807 is conventional basespace SRR7169807 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169807_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.589 32.0 30.0 33.0 18.0 33.0 2 31.33475 33.0 31.0 33.0 29.0 33.0 3 32.3575 33.0 33.0 33.0 31.0 34.0 4 32.86525 33.0 33.0 34.0 32.0 34.0 5 33.21475 34.0 33.0 34.0 33.0 34.0 6 37.14225 38.0 37.0 38.0 36.0 38.0 7 37.5005 38.0 38.0 38.0 37.0 38.0 8 37.58025 38.0 38.0 38.0 38.0 38.0 9 37.62725 38.0 38.0 38.0 38.0 38.0 10-14 37.62025 38.0 38.0 38.0 38.0 38.0 15-19 37.62355 38.0 38.0 38.0 38.0 38.0 20-24 37.5931 38.0 38.0 38.0 38.0 38.0 25-29 37.5904 38.0 38.0 38.0 38.0 38.0 30-34 37.57605 38.0 38.0 38.0 38.0 38.0 35-39 37.528749999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.477549999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.46825 38.0 38.0 38.0 37.6 38.0 50-54 37.345800000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2045 38.0 38.0 38.0 36.8 38.0 60-64 37.01649999999999 38.0 38.0 38.0 35.8 38.0 65-69 37.1946 38.0 38.0 38.0 36.8 38.0 70-74 37.27075000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.10765 38.0 38.0 38.0 36.4 38.0 80-84 37.146249999999995 38.0 38.0 38.0 36.4 38.0 85-89 37.09555 38.0 38.0 38.0 36.0 38.0 90-94 36.87435 38.0 38.0 38.0 35.8 38.0 95-99 36.96065 38.0 38.0 38.0 36.0 38.0 100-104 36.961099999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.866150000000005 38.0 38.0 38.0 35.8 38.0 110-114 36.72865 38.0 38.0 38.0 34.8 38.0 115-119 36.5644 38.0 38.0 38.0 34.8 38.0 120-124 36.447050000000004 38.0 38.0 38.0 34.2 38.0 125-129 36.317449999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.1099 38.0 37.8 38.0 33.4 38.0 135-139 35.85625 38.0 36.8 38.0 32.6 38.0 140-144 35.62975 38.0 36.0 38.0 32.4 38.0 145-149 35.18900000000001 38.0 36.0 38.0 31.2 38.0 150-151 30.703125 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 3.0 19 1.0 20 3.0 21 1.0 22 3.0 23 5.0 24 7.0 25 8.0 26 2.0 27 16.0 28 12.0 29 24.0 30 26.0 31 38.0 32 52.0 33 79.0 34 137.0 35 220.0 36 507.0 37 2848.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.625 10.75 9.700000000000001 39.925 2 22.86715036277208 15.936952714535902 33.249937453089814 27.9459594696022 3 20.0 18.275 25.674999999999997 36.05 4 22.7 27.450000000000003 21.95 27.900000000000002 5 23.724999999999998 31.3 25.074999999999996 19.900000000000002 6 19.650000000000002 34.175 24.425 21.75 7 14.325 27.05 40.175 18.45 8 18.075 25.724999999999998 31.65 24.55 9 17.675 24.325 34.35 23.65 10-14 20.315 29.630000000000003 26.72 23.335 15-19 19.470000000000002 29.310000000000002 27.584999999999997 23.635 20-24 20.485 28.955 27.505000000000003 23.055 25-29 20.0 29.315 26.945000000000004 23.74 30-34 20.615 28.599999999999998 27.375 23.41 35-39 19.88 29.18 27.310000000000002 23.630000000000003 40-44 19.68 29.189999999999998 27.884999999999998 23.244999999999997 45-49 20.69 28.665000000000003 27.075 23.57 50-54 20.375 28.055000000000003 27.810000000000002 23.76 55-59 20.435 28.33 27.334999999999997 23.9 60-64 20.275000000000002 28.050000000000004 27.675 24.0 65-69 20.215 28.365000000000002 27.99 23.43 70-74 20.215 28.28 27.944999999999997 23.56 75-79 20.605 28.325 27.125 23.945 80-84 20.305 28.660000000000004 26.99 24.044999999999998 85-89 20.435 28.325 27.715 23.525 90-94 20.465 28.27 26.605 24.66 95-99 20.474999999999998 28.645 27.235 23.645 100-104 21.355 28.28 26.88 23.485 105-109 21.18 28.000000000000004 27.38 23.44 110-114 20.280210157618214 28.57142857142857 26.735051288466348 24.413309982486865 115-119 21.01 28.065 27.045 23.880000000000003 120-124 20.91 28.68 26.340000000000003 24.07 125-129 21.029999999999998 28.18 26.255 24.535 130-134 21.025 28.560000000000002 26.21 24.205 135-139 20.849999999999998 28.599999999999998 26.455000000000002 24.095 140-144 21.560000000000002 28.215 25.995 24.23 145-149 21.365000000000002 28.470000000000002 25.979999999999997 24.185000000000002 150-151 20.95 28.050000000000004 26.224999999999998 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 2.0 26 4.0 27 5.0 28 9.0 29 12.0 30 10.5 31 13.5 32 28.0 33 41.5 34 51.0 35 65.0 36 86.0 37 106.0 38 132.0 39 164.0 40 191.0 41 207.0 42 231.5 43 274.0 44 275.5 45 258.5 46 263.5 47 248.5 48 223.5 49 194.0 50 184.5 51 168.5 52 128.0 53 107.5 54 82.5 55 58.0 56 51.0 57 42.5 58 22.5 59 13.5 60 12.5 61 8.5 62 6.0 63 5.0 64 3.0 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.075 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5750000000000002 0.0 0.0 0.0 0.0 98-99 1.9 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.6500000000000004 0.0 0.0 0.0 0.0 104-105 2.975 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 3.7625 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.625 0.0 0.0 0.0 0.0 114-115 5.112500000000001 0.0 0.0 0.0 0.0 116-117 5.5875 0.0 0.0 0.0 0.0 118-119 6.1 0.0 0.0 0.0 0.0 120-121 6.737500000000001 0.0 0.0 0.0 0.0 122-123 7.35 0.0 0.0 0.0 0.0 124-125 7.925000000000001 0.0 0.0 0.0 0.0 126-127 8.55 0.0 0.0 0.0 0.0 128-129 9.037500000000001 0.0 0.0 0.0 0.0 130-131 9.8 0.0 0.0 0.0 0.0 132-133 10.6875 0.0 0.0 0.0 0.0 134-135 11.525 0.0 0.0 0.0 0.0 136-137 12.175 0.0 0.0 0.0 0.0 138-139 13.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTGTG 10 0.006830828 145.0 2 >>END_MODULE SRR7169807 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169807_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09025 34.0 33.0 34.0 32.0 34.0 2 33.232 34.0 33.0 34.0 33.0 34.0 3 33.23875 34.0 33.0 34.0 33.0 34.0 4 33.19075 34.0 33.0 34.0 33.0 34.0 5 33.2385 34.0 33.0 34.0 33.0 34.0 6 37.38775 38.0 38.0 38.0 37.0 38.0 7 37.436 38.0 38.0 38.0 38.0 38.0 8 37.34025 38.0 38.0 38.0 38.0 38.0 9 37.443 38.0 38.0 38.0 38.0 38.0 10-14 37.404900000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.27335 38.0 38.0 38.0 37.2 38.0 20-24 37.326249999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.268600000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.12825 38.0 38.0 38.0 36.4 38.0 35-39 37.176300000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.2573 38.0 38.0 38.0 37.0 38.0 45-49 37.2198 38.0 38.0 38.0 37.0 38.0 50-54 37.143600000000006 38.0 38.0 38.0 37.0 38.0 55-59 36.9256 38.0 38.0 38.0 36.0 38.0 60-64 36.716049999999996 38.0 38.0 38.0 35.4 38.0 65-69 37.049749999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.975699999999996 38.0 38.0 38.0 36.2 38.0 75-79 35.9334 38.0 38.0 38.0 33.8 38.0 80-84 36.6158 38.0 38.0 38.0 35.2 38.0 85-89 36.5719 38.0 37.8 38.0 34.4 38.0 90-94 36.665949999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.71444999999999 38.0 38.0 38.0 35.8 38.0 100-104 36.50245 38.0 38.0 38.0 35.0 38.0 105-109 34.92529999999999 38.0 37.0 38.0 27.2 38.0 110-114 34.3015 38.0 37.0 38.0 22.8 38.0 115-119 33.42465 38.0 36.8 38.0 14.4 38.0 120-124 33.5945 38.0 36.0 38.0 16.6 38.0 125-129 34.1657 38.0 36.0 38.0 22.6 38.0 130-134 34.83755 38.0 35.8 38.0 26.8 38.0 135-139 34.565 38.0 35.4 38.0 26.0 38.0 140-144 34.71245 38.0 35.8 38.0 28.4 38.0 145-149 33.23955 38.0 33.2 38.0 20.6 38.0 150-151 30.256 35.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 4.0 14 3.0 15 0.0 16 3.0 17 2.0 18 8.0 19 10.0 20 2.0 21 9.0 22 11.0 23 10.0 24 15.0 25 20.0 26 14.0 27 21.0 28 42.0 29 60.0 30 61.0 31 79.0 32 113.0 33 129.0 34 143.0 35 253.0 36 509.0 37 2467.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.175000000000004 20.95 13.3 28.575 2 26.474999999999998 27.0 29.975 16.55 3 20.61546159619715 27.370527895921942 31.098323742807104 20.915686765073804 4 23.62953692115144 32.64080100125156 23.27909887359199 20.450563204005007 5 24.681170292573142 36.25906476619154 21.955488872218055 17.104276069017253 6 19.55 38.35 23.200000000000003 18.9 7 19.575 21.725 37.574999999999996 21.125 8 21.675 25.85 26.775 25.7 9 21.525 24.825 31.25 22.400000000000002 10-14 24.035 27.71 26.505000000000003 21.75 15-19 23.68118405920296 27.85139256962848 27.266363318165908 21.20106005300265 20-24 23.035 28.199999999999996 27.384999999999998 21.38 25-29 23.76 27.775 27.02 21.445 30-34 23.7 28.144999999999996 27.455000000000002 20.7 35-39 23.24 28.425 27.16 21.175 40-44 23.39 27.605 28.115000000000002 20.89 45-49 23.75 27.82 27.6 20.830000000000002 50-54 23.785946486621658 28.1470367591898 27.116779194798703 20.950237559389848 55-59 23.761188059402972 27.67638381919096 28.001400070003502 20.56102805140257 60-64 23.855 27.560000000000002 27.985 20.599999999999998 65-69 23.625 27.57 28.64 20.165 70-74 23.768028846153847 28.13000801282051 27.609174679487182 20.49278846153846 75-79 23.901914610422853 27.372785911743623 28.19698986382717 20.52830961400635 80-84 24.067098588719805 27.035307116669177 28.079955803324797 20.817638491286225 85-89 23.405 27.884999999999998 28.23 20.48 90-94 23.775 27.63 28.115000000000002 20.48 95-99 24.46 27.975 27.365000000000002 20.200000000000003 100-104 24.917442209546685 27.35915140598419 27.65936155308716 20.064044831381967 105-109 24.37621932436595 27.48228770921039 27.47715371188007 20.664339254543588 110-114 24.192436217047685 28.011457062536465 27.50225428313796 20.293852437277888 115-119 25.175739741703453 27.55163206364776 27.595226418178846 19.677401776469946 120-124 25.40566593477213 27.820917902854386 26.947999785786962 19.825416376586517 125-129 25.26721935450232 27.790812868241304 26.581156473225924 20.36081130403045 130-134 25.565792108952536 27.62367314239936 26.762467454436212 20.048067294211897 135-139 26.015 27.705000000000002 26.540000000000003 19.74 140-144 26.009999999999998 28.144999999999996 26.369999999999997 19.475 145-149 26.31 27.865000000000002 26.724999999999998 19.1 150-151 27.182389937106915 26.553459119496853 26.264150943396224 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 0.5 27 1.0 28 3.0 29 7.5 30 9.0 31 12.0 32 18.0 33 23.5 34 38.0 35 57.0 36 74.5 37 91.0 38 122.5 39 165.0 40 183.5 41 213.5 42 265.0 43 285.5 44 297.5 45 286.5 46 278.5 47 280.0 48 250.5 49 214.0 50 184.0 51 162.0 52 129.5 53 97.5 54 66.0 55 46.0 56 37.0 57 26.5 58 21.5 59 14.0 60 8.0 61 7.0 62 4.5 63 2.0 64 2.5 65 1.5 66 0.5 67 1.5 68 1.5 69 1.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.125 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.025 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.16 75-79 2.33 80-84 0.445 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 2.6100000000000003 110-114 5.734999999999999 115-119 8.245 120-124 6.635000000000001 125-129 4.105 130-134 0.13999999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.825 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 2.8 0.0 0.0 0.0 0.0 106-107 3.1500000000000004 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 3.825 0.0 0.0 0.0 0.0 112-113 4.262499999999999 0.0 0.0 0.0 0.0 114-115 4.6875 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.6 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.75 0.0 0.0 0.0 0.0 124-125 7.3 0.0 0.0 0.0 0.0 126-127 7.875 0.0 0.0 0.0 0.0 128-129 8.3125 0.0 0.0 0.0 0.0 130-131 9.075 0.0 0.0 0.0 0.0 132-133 9.925 0.0 0.0 0.0 0.0 134-135 10.75 0.0 0.0 0.0 0.0 136-137 11.3875 0.0 0.0 0.0 0.0 138-139 12.149999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGCAA 10 0.007088928 143.21251 3 TCGAGCA 10 0.007088928 143.21251 2 >>END_MODULE Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749903 spots for SRR7169807.sra Written 749903 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra Read 749892 spots for SRR7169807.sra Written 749892 spots for SRR7169807.sra SRR ids: ['SRR7169807.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dupo3qgk SRR7169807.sra spots: 14997851 blocks: [[1, 749892], [749893, 1499784], [1499785, 2249676], [2249677, 2999568], [2999569, 3749460], [3749461, 4499352], [4499353, 5249244], [5249245, 5999136], [5999137, 6749028], [6749029, 7498920], [7498921, 8248812], [8248813, 8998704], [8998705, 9748596], [9748597, 10498488], [10498489, 11248380], [11248381, 11998272], [11998273, 12748164], [12748165, 13498056], [13498057, 14247948], [14247949, 14997851]] SRR7169807 file size 5060579 SRR7169807 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169807 SRR7169807_1.fastq SRR7169807_2.fastq Input file: SRR7169807_1.fastq Paired file: SRR7169807_2.fastq trimmed: SRR7169807-trimmed-pair1.fastq, SRR7169807-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:17:32 2025 >> started Tue Feb 11 19:17:51 2025 >> done (19.366s) 14997851 read pairs processed; of these: 8904 ( 0.06%) short read pairs filtered out after trimming by size control 11621 ( 0.08%) empty read pairs filtered out after trimming by size control 14977326 (99.86%) read pairs available; of these: 7051648 (47.08%) trimmed read pairs available after processing 7925678 (52.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 4 0.00% 22 6 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 6 0.00% 27 2 0.00% 28 3 0.00% 29 6 0.00% 30 7 0.00% 31 8 0.00% 32 15 0.00% 33 10 0.00% 34 15 0.00% 35 9 0.00% 36 21 0.00% 37 16 0.00% 38 28 0.00% 39 34 0.00% 40 36 0.00% 41 31 0.00% 42 45 0.00% 43 61 0.00% 44 52 0.00% 45 69 0.00% 46 74 0.00% 47 96 0.00% 48 102 0.00% 49 128 0.00% 50 136 0.00% 51 152 0.00% 52 189 0.00% 53 182 0.00% 54 240 0.00% 55 274 0.00% 56 258 0.00% 57 329 0.00% 58 382 0.00% 59 474 0.00% 60 447 0.00% 61 614 0.00% 62 613 0.00% 63 798 0.01% 64 917 0.01% 65 972 0.01% 66 1087 0.01% 67 1175 0.01% 68 1296 0.01% 69 1505 0.01% 70 1796 0.01% 71 2046 0.01% 72 2351 0.02% 73 2856 0.02% 74 3126 0.02% 75 3522 0.02% 76 4016 0.03% 77 4426 0.03% 78 4663 0.03% 79 5136 0.03% 80 5473 0.04% 81 6331 0.04% 82 7148 0.05% 83 8175 0.05% 84 9529 0.06% 85 10580 0.07% 86 11399 0.08% 87 12242 0.08% 88 12941 0.09% 89 13651 0.09% 90 14562 0.10% 91 15707 0.10% 92 16905 0.11% 93 18193 0.12% 94 19805 0.13% 95 21161 0.14% 96 22258 0.15% 97 23118 0.15% 98 24243 0.16% 99 25000 0.17% 100 26252 0.18% 101 27143 0.18% 102 28508 0.19% 103 30137 0.20% 104 31587 0.21% 105 33416 0.22% 106 34825 0.23% 107 35329 0.24% 108 36457 0.24% 109 37514 0.25% 110 38073 0.25% 111 38951 0.26% 112 40362 0.27% 113 42485 0.28% 114 43645 0.29% 115 45194 0.30% 116 46766 0.31% 117 48152 0.32% 118 48340 0.32% 119 49233 0.33% 120 50171 0.33% 121 50775 0.34% 122 51417 0.34% 123 53515 0.36% 124 55502 0.37% 125 56923 0.38% 126 59203 0.40% 127 60892 0.41% 128 61430 0.41% 129 62225 0.42% 130 63627 0.42% 131 64545 0.43% 132 64598 0.43% 133 66302 0.44% 134 68095 0.45% 135 70161 0.47% 136 72653 0.49% 137 75145 0.50% 138 78041 0.52% 139 81301 0.54% 140 85059 0.57% 141 88915 0.59% 142 92772 0.62% 143 99149 0.66% 144 108768 0.73% 145 122265 0.82% 146 142240 0.95% 147 180358 1.20% 148 260891 1.74% 149 552177 3.69% 150 2944872 19.66% 151 7925678 52.92% 14977326 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=42 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=44 fanout-score=41.18 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.8 sequence=AGAAAGGAAAAACAAAAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=43 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=50.64 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.7 sequence=TGTTGGTGGTGG SRR7169807 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:18:56 Started mapping on | Feb 11 19:18:56 Finished on | Feb 11 19:20:21 Mapping speed, Million of reads per hour | 634.33 Number of input reads | 14977326 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14365948 Uniquely mapped reads % | 95.92% Average mapped length | 289.59 Number of splices: Total | 12994849 Number of splices: Annotated (sjdb) | 12778348 Number of splices: GT/AG | 12811395 Number of splices: GC/AG | 147125 Number of splices: AT/AC | 10440 Number of splices: Non-canonical | 25889 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249301 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 34510 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 370200 370200 370200 N_multimapping 249301 249301 249301 N_noFeature 313573 14190365 393347 N_ambiguous 148425 835 51984 UnstrandedReadsAssigned:13903950 PositiveStrandReadsAssigned:174748 NegativeStrandReadsAssigned:13920617 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169807 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169807-trimmed-pair1.fastq SRR7169807-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,977,326 reads, 13,837,264 reads pseudoaligned [quant] estimated average fragment length: 209.265 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR7169807.ke.tsv 34699 SRR7169807.se.tsv 87100 total ==> SRR7169807.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.74 238 9.84895 Potri.005G024800.1.v4.1 1035 826.735 37 3.35168 Potri.004G059700.1.v4.1 961 752.741 3 0.298472 Potri.007G009000.2.v4.1 1416 1207.74 0 0 Potri.003G141000.2.v4.1 2943 2734.74 260.031 7.12096 Potri.016G087400.1.v4.1 270 94.9284 1375.52 1085.17 Potri.015G069301.1.v4.1 564 357.931 0 0 Potri.010G195200.1.v4.1 1773 1564.74 9 0.430754 Potri.012G127500.1.v4.1 977 768.741 2454 239.069 ==> SRR7169807.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1631 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7169807 completed mapping pipeline successfully