Starting /dee2/code/volunteer_pipeline.sh SRR7169808 current disk space = 3053583364096 free memory = 1017773484 SRR7169808 SRAfilesize 2c271d5c2d5a8b0fa633e16ac4c9967c SRR7169808.sra SRR7169808.sra file validated SRR7169808 is paired end SRR7169808 is conventional basespace SRR7169808 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.58475 32.0 30.0 33.0 18.0 33.0 2 31.3005 33.0 31.0 33.0 29.0 33.0 3 32.32 33.0 33.0 33.0 31.0 34.0 4 32.8145 33.0 33.0 34.0 32.0 34.0 5 33.15525 34.0 33.0 34.0 33.0 34.0 6 37.123 38.0 37.0 38.0 36.0 38.0 7 37.419 38.0 38.0 38.0 37.0 38.0 8 37.49975 38.0 38.0 38.0 37.0 38.0 9 37.58975 38.0 38.0 38.0 38.0 38.0 10-14 37.572050000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.5888 38.0 38.0 38.0 38.0 38.0 20-24 37.575399999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.5665 38.0 38.0 38.0 38.0 38.0 30-34 37.57145 38.0 38.0 38.0 38.0 38.0 35-39 37.52239999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.49465 38.0 38.0 38.0 38.0 38.0 45-49 37.4507 38.0 38.0 38.0 37.8 38.0 50-54 37.3316 38.0 38.0 38.0 37.0 38.0 55-59 37.219899999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.0332 38.0 38.0 38.0 35.8 38.0 65-69 37.207 38.0 38.0 38.0 36.6 38.0 70-74 37.2106 38.0 38.0 38.0 37.0 38.0 75-79 37.066050000000004 38.0 38.0 38.0 36.2 38.0 80-84 37.112500000000004 38.0 38.0 38.0 36.6 38.0 85-89 37.03404999999999 38.0 38.0 38.0 36.2 38.0 90-94 36.85985 38.0 38.0 38.0 35.8 38.0 95-99 36.94725 38.0 38.0 38.0 35.8 38.0 100-104 36.90935 38.0 38.0 38.0 35.8 38.0 105-109 36.77725 38.0 38.0 38.0 35.2 38.0 110-114 36.6555 38.0 38.0 38.0 34.8 38.0 115-119 36.508449999999996 38.0 38.0 38.0 34.4 38.0 120-124 36.467800000000004 38.0 38.0 38.0 34.2 38.0 125-129 36.2706 38.0 38.0 38.0 34.0 38.0 130-134 36.062 38.0 37.8 38.0 33.2 38.0 135-139 35.694900000000004 38.0 36.6 38.0 32.6 38.0 140-144 35.55500000000001 38.0 36.0 38.0 31.8 38.0 145-149 35.033100000000005 38.0 35.8 38.0 30.6 38.0 150-151 30.872 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 7.0 20 3.0 21 1.0 22 4.0 23 8.0 24 7.0 25 10.0 26 9.0 27 9.0 28 13.0 29 21.0 30 30.0 31 45.0 32 55.0 33 76.0 34 125.0 35 209.0 36 470.0 37 2889.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.699999999999996 10.925 9.8 36.575 2 21.562734785875282 15.001252191334835 34.76083145504633 28.67518156774355 3 20.075000000000003 21.6 26.8 31.525 4 22.35 29.725 22.825 25.1 5 22.45 34.150000000000006 23.7 19.7 6 20.349999999999998 34.625 23.375 21.65 7 14.625 26.325 41.9 17.150000000000002 8 17.9 25.6 31.55 24.95 9 17.5 25.224999999999998 31.95 25.324999999999996 10-14 20.200000000000003 30.320000000000004 26.72 22.759999999999998 15-19 19.98 28.794999999999998 27.88 23.345 20-24 20.080000000000002 28.735 27.62 23.565 25-29 20.21 28.64 27.605 23.544999999999998 30-34 20.3 29.32 27.185 23.195 35-39 20.32 28.410000000000004 27.315 23.955000000000002 40-44 20.125 29.020000000000003 27.54 23.315 45-49 20.05 29.395 27.189999999999998 23.365 50-54 20.19 28.689999999999998 27.284999999999997 23.835 55-59 20.445 28.48 27.134999999999998 23.94 60-64 20.23 28.465 27.400000000000002 23.905 65-69 20.745 28.965000000000003 26.985 23.305 70-74 20.294999999999998 29.195 27.24 23.27 75-79 20.265 28.194999999999997 27.71 23.830000000000002 80-84 21.060000000000002 28.02 27.355 23.565 85-89 20.599999999999998 28.76 27.29 23.35 90-94 20.46 28.95 26.72 23.87 95-99 20.555 28.435 27.18 23.830000000000002 100-104 21.075 28.275 26.695 23.955000000000002 105-109 20.97 28.055000000000003 27.134999999999998 23.84 110-114 20.567340404242547 28.59715829497699 26.98619171502902 23.849309585751453 115-119 20.830000000000002 28.975 26.290000000000003 23.905 120-124 21.525 28.9 26.424999999999997 23.150000000000002 125-129 21.075 28.225 26.625 24.075 130-134 20.96 28.275 26.665 24.099999999999998 135-139 20.78 27.785 26.82 24.615000000000002 140-144 20.97 28.244999999999997 26.090000000000003 24.695 145-149 20.97 27.595 26.619999999999997 24.815 150-151 21.0625 27.950000000000003 26.2125 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 2.0 22 3.0 23 2.5 24 2.0 25 3.5 26 5.5 27 6.0 28 12.0 29 13.5 30 14.0 31 24.0 32 32.0 33 45.5 34 55.5 35 60.5 36 80.5 37 106.5 38 125.5 39 147.0 40 183.0 41 203.5 42 213.0 43 258.5 44 275.5 45 269.5 46 288.0 47 274.5 48 241.5 49 224.0 50 192.0 51 145.5 52 119.5 53 95.5 54 67.5 55 49.5 56 42.0 57 33.5 58 23.0 59 17.0 60 10.5 61 6.0 62 5.0 63 6.0 64 4.5 65 3.0 66 2.0 67 0.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.4274578828262509 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025144581342720643 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.2125000000000004 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.4 0.0 0.0 0.0 0.0 110-111 3.9625 0.0 0.0 0.0 0.0 112-113 4.475 0.0 0.0 0.0 0.0 114-115 4.8875 0.0 0.0 0.0 0.0 116-117 5.2625 0.0 0.0 0.0 0.0 118-119 5.65 0.0 0.0 0.0 0.0 120-121 6.262499999999999 0.0 0.0 0.0 0.0 122-123 7.1875 0.0 0.0 0.0 0.0 124-125 7.737500000000001 0.0 0.0 0.0 0.0 126-127 8.175 0.0 0.0 0.0 0.0 128-129 8.95 0.0 0.0 0.0 0.0 130-131 9.5125 0.0 0.0 0.0 0.0 132-133 9.9625 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.3625 0.0 0.0 0.0 0.0 138-139 12.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169808 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07125 33.0 33.0 34.0 32.0 34.0 2 33.1475 34.0 33.0 34.0 33.0 34.0 3 33.134 34.0 33.0 34.0 33.0 34.0 4 33.02275 34.0 33.0 34.0 33.0 34.0 5 33.09525 34.0 33.0 34.0 33.0 34.0 6 37.21275 38.0 38.0 38.0 37.0 38.0 7 37.20825 38.0 38.0 38.0 37.0 38.0 8 37.2235 38.0 38.0 38.0 37.0 38.0 9 37.2545 38.0 38.0 38.0 37.0 38.0 10-14 37.24745 38.0 38.0 38.0 37.0 38.0 15-19 37.1154 38.0 38.0 38.0 36.8 38.0 20-24 37.16185 38.0 38.0 38.0 37.0 38.0 25-29 37.1392 38.0 38.0 38.0 37.0 38.0 30-34 37.03015 38.0 38.0 38.0 36.4 38.0 35-39 37.064949999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.12425 38.0 38.0 38.0 37.0 38.0 45-49 37.0646 38.0 38.0 38.0 37.0 38.0 50-54 37.0168 38.0 38.0 38.0 36.6 38.0 55-59 36.74114999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.59085 38.0 38.0 38.0 34.6 38.0 65-69 36.89465 38.0 38.0 38.0 36.0 38.0 70-74 36.857299999999995 38.0 38.0 38.0 36.0 38.0 75-79 35.73395 38.0 38.0 38.0 32.6 38.0 80-84 36.39755 38.0 38.0 38.0 34.4 38.0 85-89 36.386 38.0 37.8 38.0 34.2 38.0 90-94 36.4688 38.0 38.0 38.0 34.8 38.0 95-99 36.50865 38.0 38.0 38.0 35.0 38.0 100-104 36.343849999999996 38.0 38.0 38.0 34.2 38.0 105-109 34.6808 38.0 36.6 38.0 26.4 38.0 110-114 33.889649999999996 38.0 37.0 38.0 18.6 38.0 115-119 32.963100000000004 38.0 36.2 38.0 8.8 38.0 120-124 33.1903 38.0 36.0 38.0 14.2 38.0 125-129 33.68645 38.0 36.0 38.0 18.4 38.0 130-134 34.339299999999994 38.0 35.6 38.0 23.2 38.0 135-139 34.15105 38.0 35.0 38.0 24.2 38.0 140-144 34.3259 38.0 35.8 38.0 25.4 38.0 145-149 32.7081 38.0 33.2 38.0 15.2 38.0 150-151 29.689625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 2.0 5 0.0 6 2.0 7 2.0 8 0.0 9 1.0 10 4.0 11 2.0 12 5.0 13 2.0 14 1.0 15 3.0 16 8.0 17 4.0 18 8.0 19 14.0 20 7.0 21 7.0 22 12.0 23 17.0 24 25.0 25 17.0 26 20.0 27 22.0 28 43.0 29 52.0 30 82.0 31 86.0 32 110.0 33 127.0 34 134.0 35 224.0 36 536.0 37 2414.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.275 19.55 13.350000000000001 25.825 2 26.806701675418854 25.03125781445361 30.23255813953488 17.92948237059265 3 23.073073073073072 26.526526526526528 31.88188188188188 18.51851851851852 4 24.31077694235589 33.68421052631579 22.45614035087719 19.548872180451127 5 24.943707780835627 35.551663747810856 21.61621215911934 17.888416312234177 6 20.275000000000002 38.125 23.0 18.6 7 18.5 21.099999999999998 39.574999999999996 20.825 8 21.825 24.575 28.15 25.45 9 23.1 25.825 28.325 22.75 10-14 23.535 28.249999999999996 26.740000000000002 21.475 15-19 23.10577644411103 27.646911727931982 27.291822955738937 21.955488872218055 20-24 23.195 27.775 27.36 21.67 25-29 23.62 28.435 27.05 20.895 30-34 23.285 27.825 27.950000000000003 20.94 35-39 23.395 27.694999999999997 27.810000000000002 21.099999999999998 40-44 23.365 27.994999999999997 28.08 20.560000000000002 45-49 23.24732473247325 27.727772777277725 28.397839783978394 20.627062706270628 50-54 23.556489542679877 27.384168918242768 27.85950165115581 21.199839887921545 55-59 23.49469893978796 27.275455091018202 28.74574914982996 20.484096819363874 60-64 23.42117105855293 27.91639581979099 27.886394319715986 20.776038801940096 65-69 23.34 27.98 27.925 20.755000000000003 70-74 23.644284212107554 27.68514345801412 28.135796905512994 20.53477542436533 75-79 23.86049370070675 27.39936494929837 28.57216019666086 20.167981153334015 80-84 23.317935328379193 27.475396665997188 28.444466760393656 20.762201245229967 85-89 24.07 27.33 27.76 20.84 90-94 24.056202810140505 27.541377068853446 28.41142057102855 19.9909995499775 95-99 23.628544281642245 27.829174376156423 27.634145121768267 20.908136220433065 100-104 24.393416379008453 27.70523788083446 27.85532042623443 20.04602531392266 105-109 24.299737883538057 27.753507735005396 27.357763272858097 20.58899110859845 110-114 23.863273346821426 27.968267490150144 27.734000638909595 20.43445852411884 115-119 24.132457580733444 27.821565407772304 27.88177339901478 20.164203612479476 120-124 24.667921484269964 27.238504974455495 27.593439096531323 20.50013444474321 125-129 25.0810245687402 27.276529012022998 27.52221641400941 20.12023000522739 130-134 25.37044453344013 27.813376051261514 27.012414897877452 19.803764517420905 135-139 25.835 27.435 26.97 19.759999999999998 140-144 25.965 27.825 26.72 19.49 145-149 26.165 27.900000000000002 26.985 18.95 150-151 26.63563160543533 26.987921489682936 27.226975339708105 19.149471565173627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 4.0 27 8.0 28 8.5 29 9.0 30 14.5 31 19.0 32 21.5 33 29.5 34 44.0 35 54.5 36 73.5 37 96.0 38 119.5 39 160.0 40 192.5 41 220.0 42 248.5 43 262.0 44 281.0 45 287.0 46 280.0 47 276.0 48 239.0 49 202.5 50 182.5 51 162.0 52 132.0 53 89.5 54 67.0 55 50.5 56 34.0 57 24.5 58 21.0 59 22.5 60 14.5 61 8.0 62 7.5 63 7.5 64 7.5 65 5.0 66 2.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.025 3 0.1 4 0.25 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.06999999999999999 55-59 0.02 60-64 0.005 65-69 0.0 70-74 0.145 75-79 2.37 80-84 0.42 85-89 0.0 90-94 0.005 95-99 0.015 100-104 0.055 105-109 2.715 110-114 6.09 115-119 8.649999999999999 120-124 7.025 125-129 4.35 130-134 0.12 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6735308890005 99.225 2 0.30135610246107486 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025113008538422906 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.0499999999999998 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 1.8875 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.7750000000000004 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.7875 0.0 0.0 0.0 0.0 112-113 4.25 0.0 0.0 0.0 0.0 114-115 4.5375 0.0 0.0 0.0 0.0 116-117 4.8375 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.612500000000001 0.0 0.0 0.0 0.0 124-125 7.1 0.0 0.0 0.0 0.0 126-127 7.525 0.0 0.0 0.0 0.0 128-129 8.275 0.0 0.0 0.0 0.0 130-131 8.825 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 9.9125 0.0 0.0 0.0 0.0 136-137 10.65 0.0 0.0 0.0 0.0 138-139 11.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTCA 20 0.0065087583 28.457499 130-134 >>END_MODULE Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra Read 763410 spots for SRR7169808.sra Written 763410 spots for SRR7169808.sra Read 763408 spots for SRR7169808.sra Written 763408 spots for SRR7169808.sra SRR ids: ['SRR7169808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxm81553 SRR7169808.sra spots: 15268162 blocks: [[1, 763408], [763409, 1526816], [1526817, 2290224], [2290225, 3053632], [3053633, 3817040], [3817041, 4580448], [4580449, 5343856], [5343857, 6107264], [6107265, 6870672], [6870673, 7634080], [7634081, 8397488], [8397489, 9160896], [9160897, 9924304], [9924305, 10687712], [10687713, 11451120], [11451121, 12214528], [12214529, 12977936], [12977937, 13741344], [13741345, 14504752], [14504753, 15268162]] SRR7169808 file size 5152178 SRR7169808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169808 SRR7169808_1.fastq SRR7169808_2.fastq Input file: SRR7169808_1.fastq Paired file: SRR7169808_2.fastq trimmed: SRR7169808-trimmed-pair1.fastq, SRR7169808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:26:02 2025 >> started Tue Feb 11 19:26:19 2025 >> done (16.924s) 15268162 read pairs processed; of these: 19787 ( 0.13%) short read pairs filtered out after trimming by size control 28162 ( 0.18%) empty read pairs filtered out after trimming by size control 15220213 (99.69%) read pairs available; of these: 7335549 (48.20%) trimmed read pairs available after processing 7884664 (51.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 5 0.00% 21 2 0.00% 22 7 0.00% 23 7 0.00% 24 3 0.00% 25 2 0.00% 26 6 0.00% 27 6 0.00% 28 7 0.00% 29 9 0.00% 30 13 0.00% 31 21 0.00% 32 11 0.00% 33 28 0.00% 34 19 0.00% 35 23 0.00% 36 34 0.00% 37 36 0.00% 38 27 0.00% 39 54 0.00% 40 57 0.00% 41 65 0.00% 42 88 0.00% 43 98 0.00% 44 87 0.00% 45 119 0.00% 46 126 0.00% 47 163 0.00% 48 180 0.00% 49 222 0.00% 50 263 0.00% 51 273 0.00% 52 335 0.00% 53 351 0.00% 54 399 0.00% 55 439 0.00% 56 457 0.00% 57 523 0.00% 58 556 0.00% 59 662 0.00% 60 833 0.01% 61 974 0.01% 62 1152 0.01% 63 1310 0.01% 64 1320 0.01% 65 1477 0.01% 66 1606 0.01% 67 1691 0.01% 68 2002 0.01% 69 2199 0.01% 70 2677 0.02% 71 2979 0.02% 72 3510 0.02% 73 3819 0.03% 74 4306 0.03% 75 4618 0.03% 76 5360 0.04% 77 5961 0.04% 78 6125 0.04% 79 6386 0.04% 80 7138 0.05% 81 7986 0.05% 82 9184 0.06% 83 9977 0.07% 84 11689 0.08% 85 13189 0.09% 86 13633 0.09% 87 14256 0.09% 88 14804 0.10% 89 15712 0.10% 90 16585 0.11% 91 17877 0.12% 92 19069 0.13% 93 20737 0.14% 94 22280 0.15% 95 23066 0.15% 96 23835 0.16% 97 24563 0.16% 98 24735 0.16% 99 25760 0.17% 100 26870 0.18% 101 28327 0.19% 102 29589 0.19% 103 31222 0.21% 104 32447 0.21% 105 33964 0.22% 106 35035 0.23% 107 35378 0.23% 108 35615 0.23% 109 36622 0.24% 110 37519 0.25% 111 38984 0.26% 112 40184 0.26% 113 41439 0.27% 114 43555 0.29% 115 44648 0.29% 116 45730 0.30% 117 46353 0.30% 118 46840 0.31% 119 46876 0.31% 120 47657 0.31% 121 49165 0.32% 122 50504 0.33% 123 52107 0.34% 124 54547 0.36% 125 55779 0.37% 126 57778 0.38% 127 59300 0.39% 128 58938 0.39% 129 59836 0.39% 130 61703 0.41% 131 61656 0.41% 132 62823 0.41% 133 65346 0.43% 134 66546 0.44% 135 69906 0.46% 136 71697 0.47% 137 74196 0.49% 138 76484 0.50% 139 79384 0.52% 140 82948 0.54% 141 87890 0.58% 142 93035 0.61% 143 101049 0.66% 144 112549 0.74% 145 127812 0.84% 146 150515 0.99% 147 194124 1.28% 148 281886 1.85% 149 599794 3.94% 150 3109225 20.43% 151 7884664 51.80% 15220213 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=249.82 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=27.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=58.84 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=15.0 sequence=TGTTGGTGGTGG SRR7169808 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:27:01 Started mapping on | Feb 11 19:27:02 Finished on | Feb 11 19:28:27 Mapping speed, Million of reads per hour | 644.62 Number of input reads | 15220213 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14546384 Uniquely mapped reads % | 95.57% Average mapped length | 289.06 Number of splices: Total | 12976009 Number of splices: Annotated (sjdb) | 12757995 Number of splices: GT/AG | 12783342 Number of splices: GC/AG | 151782 Number of splices: AT/AC | 10043 Number of splices: Non-canonical | 30842 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283936 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 33787 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406226 406226 406226 N_multimapping 283936 283936 283936 N_noFeature 376653 14376130 461419 N_ambiguous 141240 796 55190 UnstrandedReadsAssigned:14028491 PositiveStrandReadsAssigned:169458 NegativeStrandReadsAssigned:14029775 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169808-trimmed-pair1.fastq SRR7169808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,220,213 reads, 13,974,514 reads pseudoaligned [quant] estimated average fragment length: 211.895 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7169808.ke.tsv 34699 SRR7169808.se.tsv 87100 total ==> SRR7169808.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.1 233 9.74472 Potri.005G024800.1.v4.1 1035 824.105 35 3.20983 Potri.004G059700.1.v4.1 961 750.11 3 0.302269 Potri.007G009000.2.v4.1 1416 1205.1 0 0 Potri.003G141000.2.v4.1 2943 2732.1 250 6.91575 Potri.016G087400.1.v4.1 270 94.5069 1201 960.453 Potri.015G069301.1.v4.1 564 355.52 0 0 Potri.010G195200.1.v4.1 1773 1562.1 19 0.919264 Potri.012G127500.1.v4.1 977 766.105 6719 662.847 ==> SRR7169808.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1180 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169808 completed mapping pipeline successfully