Starting /dee2/code/volunteer_pipeline.sh SRR7169809 current disk space = 3052916727808 free memory = 1573407416 SRR7169809 SRAfilesize 16bb39e1e79973d6cc1ef6c5b5e40bdd SRR7169809.sra SRR7169809.sra file validated SRR7169809 is paired end SRR7169809 is conventional basespace SRR7169809 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.955 32.0 25.0 33.0 18.0 33.0 2 30.56475 31.0 29.0 33.0 27.0 33.0 3 32.35025 33.0 33.0 33.0 31.0 34.0 4 32.79225 33.0 33.0 34.0 31.0 34.0 5 33.19275 33.0 33.0 34.0 33.0 34.0 6 37.25275 38.0 37.0 38.0 36.0 38.0 7 37.57125 38.0 38.0 38.0 37.0 38.0 8 37.67075 38.0 38.0 38.0 38.0 38.0 9 37.66875 38.0 38.0 38.0 38.0 38.0 10-14 37.73530000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.725100000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.72135 38.0 38.0 38.0 38.0 38.0 25-29 37.717299999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.6894 38.0 38.0 38.0 38.0 38.0 35-39 37.686749999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.6088 38.0 38.0 38.0 38.0 38.0 45-49 37.605799999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.4934 38.0 38.0 38.0 37.8 38.0 55-59 37.57125 38.0 38.0 38.0 38.0 38.0 60-64 37.3827 38.0 38.0 38.0 37.8 38.0 65-69 37.399899999999995 38.0 38.0 38.0 37.6 38.0 70-74 37.38895 38.0 38.0 38.0 37.2 38.0 75-79 37.3164 38.0 38.0 38.0 37.0 38.0 80-84 37.299350000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.207800000000006 38.0 38.0 38.0 37.0 38.0 90-94 37.15045 38.0 38.0 38.0 36.8 38.0 95-99 37.1306 38.0 38.0 38.0 36.8 38.0 100-104 36.99345000000001 38.0 38.0 38.0 36.2 38.0 105-109 36.3381 38.0 38.0 38.0 35.2 38.0 110-114 36.3694 38.0 38.0 38.0 35.0 38.0 115-119 36.7907 38.0 38.0 38.0 35.4 38.0 120-124 36.757549999999995 38.0 38.0 38.0 35.0 38.0 125-129 36.60530000000001 38.0 38.0 38.0 34.8 38.0 130-134 36.35985000000001 38.0 38.0 38.0 34.0 38.0 135-139 36.1053 38.0 38.0 38.0 33.4 38.0 140-144 35.7151 38.0 36.4 38.0 32.4 38.0 145-149 35.484500000000004 38.0 36.4 38.0 32.0 38.0 150-151 32.482 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 3.0 15 0.0 16 1.0 17 1.0 18 2.0 19 8.0 20 6.0 21 0.0 22 2.0 23 2.0 24 1.0 25 5.0 26 8.0 27 15.0 28 7.0 29 15.0 30 24.0 31 24.0 32 36.0 33 67.0 34 106.0 35 194.0 36 430.0 37 3041.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.83835341365462 10.617469879518072 10.291164658634539 38.25301204819277 2 22.05 15.25 33.0 29.7 3 21.3 20.875 24.95 32.875 4 22.52252252252252 28.178178178178175 23.04804804804805 26.25125125125125 5 22.625 31.85 24.075 21.45 6 19.400000000000002 37.125 24.3 19.175 7 14.75 26.700000000000003 40.075 18.475 8 18.65 26.375 29.45 25.525 9 17.424999999999997 25.224999999999998 34.375 22.975 10-14 20.115 30.985000000000003 26.21 22.689999999999998 15-19 19.689999999999998 29.81 27.155 23.345 20-24 20.105 29.720000000000002 26.775 23.400000000000002 25-29 20.165 29.865000000000002 26.505000000000003 23.465 30-34 19.56 29.349999999999998 27.295 23.794999999999998 35-39 19.755 29.26 27.075 23.91 40-44 19.595000000000002 29.395 27.29 23.72 45-49 19.915 29.28 26.825 23.98 50-54 19.63 29.415000000000003 27.089999999999996 23.865 55-59 20.165 29.205 27.215 23.415 60-64 20.6886182528943 29.10840475116524 27.279105898862326 22.923871097078134 65-69 20.325 29.21 26.919999999999998 23.544999999999998 70-74 19.814999999999998 29.42 27.29 23.474999999999998 75-79 20.285 28.965000000000003 27.37 23.380000000000003 80-84 20.635 28.82 26.75 23.794999999999998 85-89 20.4 28.935 27.465 23.200000000000003 90-94 20.7 28.689999999999998 27.11 23.5 95-99 20.605 28.88 27.18 23.335 100-104 20.535311513207358 29.412059545887427 26.404691494160694 23.647937446744525 105-109 20.50839717895378 29.57024709523568 26.739053224415244 23.182302501395302 110-114 20.926460899092795 29.045664183264915 26.3899447569814 23.63793016066089 115-119 20.775 29.220000000000002 26.479999999999997 23.525 120-124 20.51 29.404999999999998 25.795 24.29 125-129 21.16 29.049999999999997 25.814999999999998 23.974999999999998 130-134 21.46 28.4 26.22 23.919999999999998 135-139 21.745 28.549999999999997 25.919999999999998 23.785 140-144 20.419999999999998 28.655 26.33 24.595 145-149 21.88 28.595 25.474999999999998 24.05 150-151 20.849999999999998 28.6125 25.687500000000004 24.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 2.0 25 2.5 26 3.5 27 5.0 28 7.0 29 12.0 30 15.5 31 26.0 32 39.0 33 47.5 34 61.5 35 86.0 36 103.0 37 118.0 38 144.0 39 156.0 40 176.0 41 208.0 42 227.0 43 251.5 44 272.0 45 275.5 46 270.0 47 248.5 48 215.5 49 187.0 50 176.0 51 147.0 52 115.5 53 106.0 54 78.5 55 53.0 56 39.0 57 26.5 58 21.0 59 19.5 60 16.0 61 8.5 62 7.0 63 6.5 64 4.5 65 3.0 66 1.5 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.1 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.23500000000000001 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.245 105-109 1.455 110-114 1.345 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54716981132076 98.925 2 0.37735849056603776 0.75 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 6 0.15 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.3624999999999998 0.0 0.0 0.0 0.0 92-93 1.5625 0.0 0.0 0.0 0.0 94-95 1.8375 0.0 0.0 0.0 0.0 96-97 2.1625 0.0 0.0 0.0 0.0 98-99 2.5625 0.0 0.0 0.0 0.0 100-101 2.8125 0.0 0.0 0.0 0.0 102-103 3.1125 0.0 0.0 0.0 0.0 104-105 3.5125 0.0 0.0 0.0 0.0 106-107 4.0375 0.0 0.0 0.0 0.0 108-109 4.5 0.0 0.0 0.0 0.0 110-111 5.0875 0.0 0.0 0.0 0.0 112-113 5.45 0.0 0.0 0.0 0.0 114-115 6.05 0.0 0.0 0.0 0.0 116-117 6.8125 0.0 0.0 0.0 0.0 118-119 7.4125 0.0 0.0 0.0 0.0 120-121 8.025 0.0 0.0 0.0 0.0 122-123 8.7375 0.0 0.0 0.0 0.0 124-125 9.462499999999999 0.0 0.0 0.0 0.0 126-127 10.25 0.0 0.0 0.0 0.0 128-129 11.0375 0.0 0.0 0.0 0.0 130-131 11.925 0.0 0.0 0.0 0.0 132-133 12.5375 0.0 0.0 0.0 0.0 134-135 13.3125 0.0 0.0 0.0 0.0 136-137 14.0 0.0 0.0 0.0 0.0 138-139 14.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATT 10 0.0068537686 144.8375 2 TCGGAAG 75 0.0013208049 38.623333 145 >>END_MODULE SRR7169809 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12275 34.0 33.0 34.0 33.0 34.0 2 33.14625 34.0 33.0 34.0 33.0 34.0 3 33.1615 34.0 33.0 34.0 33.0 34.0 4 33.13425 34.0 33.0 34.0 33.0 34.0 5 33.09175 34.0 33.0 34.0 33.0 34.0 6 37.39225 38.0 38.0 38.0 38.0 38.0 7 37.36925 38.0 38.0 38.0 38.0 38.0 8 37.39175 38.0 38.0 38.0 38.0 38.0 9 37.423 38.0 38.0 38.0 38.0 38.0 10-14 37.395599999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.33375 38.0 38.0 38.0 38.0 38.0 20-24 37.28295 38.0 38.0 38.0 38.0 38.0 25-29 37.2464 38.0 38.0 38.0 37.6 38.0 30-34 37.2189 38.0 38.0 38.0 38.0 38.0 35-39 37.18735 38.0 38.0 38.0 37.6 38.0 40-44 37.18425 38.0 38.0 38.0 37.8 38.0 45-49 37.09215 38.0 38.0 38.0 37.0 38.0 50-54 37.07340000000001 38.0 38.0 38.0 36.8 38.0 55-59 36.8021 38.0 38.0 38.0 35.4 38.0 60-64 36.202749999999995 38.0 37.6 38.0 32.6 38.0 65-69 37.100699999999996 38.0 38.0 38.0 37.0 38.0 70-74 36.753 38.0 38.0 38.0 36.8 38.0 75-79 35.59895 38.0 38.0 38.0 34.4 38.0 80-84 36.35 38.0 38.0 38.0 35.2 38.0 85-89 36.87645 38.0 38.0 38.0 37.0 38.0 90-94 36.87050000000001 38.0 38.0 38.0 36.4 38.0 95-99 36.7719 38.0 38.0 38.0 36.0 38.0 100-104 36.4291 38.0 38.0 38.0 35.4 38.0 105-109 34.862100000000005 38.0 38.0 38.0 30.0 38.0 110-114 33.85620000000001 38.0 37.6 38.0 17.6 38.0 115-119 33.18325 38.0 37.0 38.0 6.6 38.0 120-124 33.2481 38.0 36.0 38.0 14.2 38.0 125-129 33.787850000000006 38.0 36.2 38.0 19.6 38.0 130-134 34.6842 38.0 36.0 38.0 25.2 38.0 135-139 35.05975 38.0 36.0 38.0 30.6 38.0 140-144 34.02535 38.0 35.0 38.0 22.2 38.0 145-149 34.11625 38.0 35.4 38.0 26.0 38.0 150-151 29.963875 35.5 28.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 2.0 5 0.0 6 2.0 7 2.0 8 2.0 9 3.0 10 2.0 11 2.0 12 2.0 13 2.0 14 3.0 15 3.0 16 4.0 17 2.0 18 5.0 19 7.0 20 7.0 21 9.0 22 19.0 23 25.0 24 18.0 25 11.0 26 15.0 27 34.0 28 44.0 29 49.0 30 60.0 31 56.0 32 75.0 33 108.0 34 135.0 35 204.0 36 436.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.38738738738739 18.36836836836837 16.466466466466468 27.77777777777778 2 26.997245179063363 25.068870523415974 30.979213623841723 16.954670673678937 3 22.041531148361273 27.87090317738304 30.172629472104077 19.914936202151615 4 24.374374374374376 34.33433433433433 22.4974974974975 18.793793793793796 5 24.424424424424423 36.011011011011014 21.896896896896898 17.667667667667665 6 20.05 37.225 24.875 17.849999999999998 7 19.35483870967742 21.680420105026258 38.25956489122281 20.705176294073517 8 22.900000000000002 25.275 26.974999999999998 24.85 9 21.975 26.700000000000003 28.975 22.35 10-14 23.73 28.255000000000003 26.474999999999998 21.54 15-19 22.91 27.41 28.199999999999996 21.48 20-24 23.27349102365355 27.664149622443368 27.774166124918736 21.288193228984348 25-29 22.99534790655795 28.167675453954278 27.727477364814167 21.109499274673603 30-34 23.821910955477737 27.79889944972486 27.46873436718359 20.910455227613806 35-39 23.083466773418735 27.93234587670136 27.68714971977582 21.297037630104082 40-44 23.596517562293606 27.724407084959473 27.68938256779746 20.989692784949465 45-49 23.94577559901956 27.26727027162223 28.032614676604474 20.75433945275374 50-54 24.032403240324033 27.607760776077605 28.047804780478046 20.312031203120313 55-59 23.893141227675223 27.69022962629446 28.350592826054328 20.066036319975986 60-64 23.571178558927947 27.87139356967848 28.036401820091005 20.521026051302567 65-69 23.675918979744935 27.251812953238307 28.79219804951238 20.280070017504375 70-74 23.29886506935687 27.50567465321564 28.4640605296343 20.73139974779319 75-79 23.458458978891546 27.4669855464282 28.56920037433711 20.50535510034314 80-84 23.818429965121567 27.179901936005663 28.1352676540464 20.866400444826365 85-89 23.663931144915935 27.90732586068855 28.19755804643715 20.231184947958365 90-94 23.62826989446306 27.679687890761766 28.534987245535937 20.157054969239233 95-99 24.18 27.395000000000003 28.33 20.095 100-104 24.489078583981925 27.54205372834547 27.40145618880241 20.567411498870197 105-109 24.457573064254717 27.3017200815601 28.41532911590945 19.825377738275733 110-114 24.452003023431594 27.286470143613002 28.209696577043513 20.05183025591189 115-119 24.55678138207366 27.383500740984683 28.376969098194195 19.68274877874746 120-124 24.90394501866984 27.387845662644082 27.793711780940527 19.91449753774555 125-129 25.371865703357415 27.826179345516362 27.11963450913727 19.682320441988953 130-134 26.182662695006815 27.490281213712326 27.061140001009743 19.265916090271116 135-139 26.066303315165758 27.886394319715986 26.601330066503326 19.44597229861493 140-144 26.20548219287715 27.806122448979593 27.07082833133253 18.917567026810726 145-149 26.55163790947737 27.831957989497376 26.65666416604151 18.959739934983748 150-151 26.66075050709939 27.522819472616632 26.96501014198783 18.851419878296145 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 3.0 27 4.5 28 6.0 29 9.5 30 12.5 31 12.5 32 19.5 33 28.5 34 45.5 35 69.0 36 79.5 37 100.0 38 140.5 39 177.5 40 196.5 41 222.0 42 264.5 43 288.5 44 273.5 45 274.0 46 272.5 47 256.5 48 245.0 49 220.0 50 174.0 51 126.5 52 111.5 53 99.5 54 67.5 55 51.0 56 44.0 57 30.0 58 21.0 59 9.5 60 12.5 61 11.5 62 4.5 63 2.5 64 1.5 65 2.5 66 2.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.17500000000000002 3 0.075 4 0.1 5 0.1 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.045 30-34 0.05 35-39 0.08 40-44 0.06999999999999999 45-49 0.045 50-54 0.01 55-59 0.055 60-64 0.005 65-69 0.025 70-74 0.8750000000000001 75-79 3.83 80-84 1.085 85-89 0.08 90-94 0.034999999999999996 95-99 0.0 100-104 0.42500000000000004 105-109 4.365 110-114 7.39 115-119 8.905000000000001 120-124 7.605 125-129 5.88 130-134 0.9650000000000001 135-139 0.005 140-144 0.04 145-149 0.025 150-151 1.4000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.4273504273504274 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5125000000000002 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.125 0.0 0.0 0.0 0.0 98-99 2.5375 0.0 0.0 0.0 0.0 100-101 2.7875 0.0 0.0 0.0 0.0 102-103 3.0875 0.0 0.0 0.0 0.0 104-105 3.475 0.0 0.0 0.0 0.0 106-107 3.9375 0.0 0.0 0.0 0.0 108-109 4.362500000000001 0.0 0.0 0.0 0.0 110-111 4.9125 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.699999999999999 0.0 0.0 0.0 0.0 116-117 6.375 0.0 0.0 0.0 0.0 118-119 6.925 0.0 0.0 0.0 0.0 120-121 7.5125 0.0 0.0 0.0 0.0 122-123 8.1625 0.0 0.0 0.0 0.0 124-125 8.8125 0.0 0.0 0.0 0.0 126-127 9.5125 0.0 0.0 0.0 0.0 128-129 10.2375 0.0 0.0 0.0 0.0 130-131 11.025 0.0 0.0 0.0 0.0 132-133 11.6375 0.0 0.0 0.0 0.0 134-135 12.3875 0.0 0.0 0.0 0.0 136-137 13.0875 0.0 0.0 0.0 0.0 138-139 13.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 75 0.001346372 38.460762 145 >>END_MODULE Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633632 spots for SRR7169809.sra Written 633632 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra Read 633617 spots for SRR7169809.sra Written 633617 spots for SRR7169809.sra SRR ids: ['SRR7169809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ftoanhw SRR7169809.sra spots: 12672355 blocks: [[1, 633617], [633618, 1267234], [1267235, 1900851], [1900852, 2534468], [2534469, 3168085], [3168086, 3801702], [3801703, 4435319], [4435320, 5068936], [5068937, 5702553], [5702554, 6336170], [6336171, 6969787], [6969788, 7603404], [7603405, 8237021], [8237022, 8870638], [8870639, 9504255], [9504256, 10137872], [10137873, 10771489], [10771490, 11405106], [11405107, 12038723], [12038724, 12672355]] SRR7169809 file size 4272544 SRR7169809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169809 SRR7169809_1.fastq SRR7169809_2.fastq Input file: SRR7169809_1.fastq Paired file: SRR7169809_2.fastq trimmed: SRR7169809-trimmed-pair1.fastq, SRR7169809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:49:12 2025 >> started Tue Feb 11 20:49:27 2025 >> done (14.151s) 12672355 read pairs processed; of these: 13299 ( 0.10%) short read pairs filtered out after trimming by size control 32756 ( 0.26%) empty read pairs filtered out after trimming by size control 12626300 (99.64%) read pairs available; of these: 5925971 (46.93%) trimmed read pairs available after processing 6700329 (53.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 7 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 9 0.00% 25 8 0.00% 26 5 0.00% 27 5 0.00% 28 7 0.00% 29 4 0.00% 30 12 0.00% 31 18 0.00% 32 21 0.00% 33 21 0.00% 34 23 0.00% 35 25 0.00% 36 27 0.00% 37 34 0.00% 38 35 0.00% 39 42 0.00% 40 53 0.00% 41 61 0.00% 42 69 0.00% 43 78 0.00% 44 64 0.00% 45 84 0.00% 46 118 0.00% 47 132 0.00% 48 139 0.00% 49 161 0.00% 50 176 0.00% 51 211 0.00% 52 235 0.00% 53 280 0.00% 54 315 0.00% 55 358 0.00% 56 350 0.00% 57 450 0.00% 58 509 0.00% 59 614 0.00% 60 635 0.01% 61 766 0.01% 62 906 0.01% 63 1033 0.01% 64 1106 0.01% 65 1179 0.01% 66 1329 0.01% 67 1466 0.01% 68 1583 0.01% 69 1891 0.01% 70 2159 0.02% 71 2502 0.02% 72 2904 0.02% 73 3266 0.03% 74 3803 0.03% 75 4147 0.03% 76 5009 0.04% 77 5851 0.05% 78 5649 0.04% 79 5907 0.05% 80 6223 0.05% 81 7074 0.06% 82 8000 0.06% 83 8856 0.07% 84 10433 0.08% 85 11758 0.09% 86 12260 0.10% 87 12932 0.10% 88 13829 0.11% 89 14615 0.12% 90 15667 0.12% 91 16529 0.13% 92 17419 0.14% 93 19324 0.15% 94 20695 0.16% 95 21777 0.17% 96 22779 0.18% 97 23687 0.19% 98 24484 0.19% 99 25090 0.20% 100 26009 0.21% 101 26954 0.21% 102 28664 0.23% 103 30161 0.24% 104 31309 0.25% 105 33042 0.26% 106 34260 0.27% 107 34535 0.27% 108 35017 0.28% 109 35963 0.28% 110 36681 0.29% 111 37487 0.30% 112 39274 0.31% 113 41296 0.33% 114 42300 0.34% 115 43904 0.35% 116 44428 0.35% 117 45400 0.36% 118 45858 0.36% 119 45558 0.36% 120 46837 0.37% 121 46531 0.37% 122 47964 0.38% 123 49451 0.39% 124 51386 0.41% 125 52500 0.42% 126 54326 0.43% 127 55616 0.44% 128 55519 0.44% 129 56142 0.44% 130 56551 0.45% 131 57106 0.45% 132 57778 0.46% 133 59565 0.47% 134 60915 0.48% 135 62751 0.50% 136 64382 0.51% 137 66061 0.52% 138 67736 0.54% 139 69694 0.55% 140 71794 0.57% 141 74733 0.59% 142 78733 0.62% 143 81963 0.65% 144 90940 0.72% 145 98376 0.78% 146 113088 0.90% 147 140715 1.11% 148 196793 1.56% 149 390470 3.09% 150 2340155 18.53% 151 6700329 53.07% 12626300 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=43.92 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.5 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=43.69 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=11.7 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAGCGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCCTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAAGGGAGTCGTGCACATTGATGTTATCATGCTGGCGCACAACCCCGGTGGGAAAGAGAGGACCGAAAAGGAATTTGAGGGCTTAGCAAAGGGAGCTGGCTTTCAAGGTTTTGAAGTAATGTGCTGTGCATTCAACACACATGTCATTGAATTCCGCAAGAACTAAGGCTCAAGTCCAAGCTCCAAGTGACTTGGGGTT SRR7169809 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:50:10 Started mapping on | Feb 11 20:50:10 Finished on | Feb 11 20:52:04 Mapping speed, Million of reads per hour | 398.73 Number of input reads | 12626300 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12008290 Uniquely mapped reads % | 95.11% Average mapped length | 287.90 Number of splices: Total | 10090101 Number of splices: Annotated (sjdb) | 9917150 Number of splices: GT/AG | 9946721 Number of splices: GC/AG | 111444 Number of splices: AT/AC | 7873 Number of splices: Non-canonical | 24063 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209781 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 21467 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 419421 419421 419421 N_multimapping 209781 209781 209781 N_noFeature 281464 11850736 341247 N_ambiguous 143330 625 45133 UnstrandedReadsAssigned:11583496 PositiveStrandReadsAssigned:156929 NegativeStrandReadsAssigned:11621910 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169809-trimmed-pair1.fastq SRR7169809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,626,300 reads, 11,551,725 reads pseudoaligned [quant] estimated average fragment length: 204.211 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7169809.ke.tsv 34699 SRR7169809.se.tsv 87100 total ==> SRR7169809.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.79 192 9.00292 Potri.005G024800.1.v4.1 1035 831.789 30 3.06914 Potri.004G059700.1.v4.1 961 757.789 0 0 Potri.007G009000.2.v4.1 1416 1212.79 0 0 Potri.003G141000.2.v4.1 2943 2739.79 234 7.26787 Potri.016G087400.1.v4.1 270 98.2113 1165.05 1009.47 Potri.015G069301.1.v4.1 564 362.83 0 0 Potri.010G195200.1.v4.1 1773 1569.79 23 1.24679 Potri.012G127500.1.v4.1 977 773.789 4296 472.443 ==> SRR7169809.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1049 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169809 completed mapping pipeline successfully