Starting /dee2/code/volunteer_pipeline.sh SRR7169810 current disk space = 3053035741184 free memory = 1505415556 SRR7169810 SRAfilesize 494448d17e802dd23cb046d4e4cd611d SRR7169810.sra SRR7169810.sra file validated SRR7169810 is paired end SRR7169810 is conventional basespace SRR7169810 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169810_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.2815 31.0 18.0 33.0 18.0 34.0 2 30.47075 31.0 29.0 33.0 27.0 33.0 3 32.02825 33.0 31.0 33.0 29.0 34.0 4 32.71875 33.0 33.0 33.0 31.0 34.0 5 33.2265 33.0 33.0 34.0 33.0 34.0 6 37.1655 38.0 37.0 38.0 36.0 38.0 7 37.57175 38.0 38.0 38.0 37.0 38.0 8 37.67075 38.0 38.0 38.0 38.0 38.0 9 37.67525 38.0 38.0 38.0 38.0 38.0 10-14 37.729150000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.73285 38.0 38.0 38.0 38.0 38.0 20-24 37.71405 38.0 38.0 38.0 38.0 38.0 25-29 37.6371 38.0 38.0 38.0 37.8 38.0 30-34 37.6113 38.0 38.0 38.0 38.0 38.0 35-39 37.49294999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.42885 38.0 38.0 38.0 37.4 38.0 45-49 37.4583 38.0 38.0 38.0 37.2 38.0 50-54 37.5088 38.0 38.0 38.0 37.4 38.0 55-59 37.4131 38.0 38.0 38.0 37.0 38.0 60-64 37.3937 38.0 38.0 38.0 37.0 38.0 65-69 37.0729 38.0 38.0 38.0 36.0 38.0 70-74 37.239250000000006 38.0 38.0 38.0 36.2 38.0 75-79 36.6919 38.0 37.6 38.0 34.0 38.0 80-84 37.082750000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.032349999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.89775 38.0 38.0 38.0 35.6 38.0 95-99 36.86325 38.0 38.0 38.0 35.8 38.0 100-104 36.83989999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.65275 38.0 38.0 38.0 34.6 38.0 110-114 36.0719 38.0 37.4 38.0 31.8 38.0 115-119 35.27905 38.0 35.8 38.0 28.8 38.0 120-124 36.1407 38.0 37.0 38.0 33.2 38.0 125-129 35.9979 38.0 36.6 38.0 33.0 38.0 130-134 35.541 38.0 36.0 38.0 30.8 38.0 135-139 35.22115 38.0 35.8 38.0 29.8 38.0 140-144 34.533550000000005 38.0 34.6 38.0 25.8 38.0 145-149 34.5851 38.0 35.0 38.0 27.6 38.0 150-151 30.356625 36.0 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 3.0 19 3.0 20 2.0 21 0.0 22 1.0 23 1.0 24 10.0 25 6.0 26 12.0 27 13.0 28 12.0 29 19.0 30 36.0 31 42.0 32 45.0 33 83.0 34 139.0 35 303.0 36 893.0 37 2371.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.846309403437814 11.47623862487361 9.782608695652174 35.8948432760364 2 22.55 15.625 33.625 28.199999999999996 3 19.975 20.4 26.424999999999997 33.2 4 21.65 28.475 22.975 26.900000000000002 5 22.15 33.525 24.525 19.8 6 19.400000000000002 34.5 24.775 21.325 7 15.024999999999999 25.900000000000002 40.975 18.099999999999998 8 17.424999999999997 25.4 32.074999999999996 25.1 9 16.825000000000003 23.549999999999997 33.825 25.8 10-14 19.77 29.854999999999997 26.705000000000002 23.669999999999998 15-19 19.585 28.845 27.99 23.580000000000002 20-24 19.99 28.92 27.655 23.435 25-29 20.435 29.270000000000003 26.724999999999998 23.57 30-34 19.985 28.87 27.560000000000002 23.585 35-39 20.04 28.335 27.355 24.27 40-44 20.055 28.875 27.705000000000002 23.365 45-49 20.075000000000003 28.435 27.894999999999996 23.595 50-54 20.0 28.89 27.975 23.135 55-59 20.07 28.854999999999997 27.395000000000003 23.68 60-64 20.0 28.68 27.425 23.895 65-69 19.75 29.005 27.43 23.815 70-74 19.735 28.785 27.79 23.69 75-79 20.01 29.115000000000002 26.945000000000004 23.93 80-84 20.005 29.025000000000002 27.455000000000002 23.515 85-89 20.45 28.105000000000004 27.675 23.77 90-94 20.560000000000002 28.595 26.99 23.855 95-99 20.665 28.744999999999997 26.919999999999998 23.669999999999998 100-104 20.605 28.244999999999997 27.189999999999998 23.96 105-109 21.37 27.889999999999997 27.169999999999998 23.57 110-114 20.64 29.110000000000003 26.384999999999998 23.865 115-119 21.195 28.694999999999997 26.93 23.18 120-124 20.762076207620762 28.332833283328334 26.53765376537654 24.367436743674368 125-129 20.89 28.720000000000002 26.595000000000002 23.794999999999998 130-134 21.13 27.965 26.669999999999998 24.235 135-139 20.735 28.285 26.479999999999997 24.5 140-144 20.895 28.189999999999998 26.3 24.615000000000002 145-149 20.845 28.89 26.179999999999996 24.085 150-151 21.0125 27.55 26.0125 25.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 1.5 23 1.5 24 2.0 25 3.0 26 4.0 27 9.5 28 11.0 29 9.5 30 16.0 31 22.5 32 33.5 33 48.5 34 61.0 35 70.5 36 82.0 37 104.5 38 124.5 39 159.5 40 201.0 41 226.5 42 241.0 43 250.5 44 260.5 45 271.5 46 269.0 47 256.0 48 237.0 49 200.0 50 154.5 51 141.0 52 125.0 53 99.5 54 79.5 55 57.5 56 43.5 57 28.5 58 22.5 59 15.5 60 12.0 61 10.5 62 9.0 63 4.5 64 5.0 65 5.5 66 2.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.15 0.0 0.0 0.0 0.0 100-101 2.4875 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 3.0875000000000004 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 3.9499999999999997 0.0 0.0 0.0 0.0 110-111 4.449999999999999 0.0 0.0 0.0 0.0 112-113 4.9125 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 5.95 0.0 0.0 0.0 0.0 118-119 6.3375 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.6875 0.0 0.0 0.0 0.0 124-125 8.4125 0.0 0.0 0.0 0.0 126-127 9.0125 0.0 0.0 0.0 0.0 128-129 9.787500000000001 0.0 0.0 0.0 0.0 130-131 10.4 0.0 0.0 0.0 0.0 132-133 11.2 0.0 0.0 0.0 0.0 134-135 11.9 0.0 0.0 0.0 0.0 136-137 12.55 0.0 0.0 0.0 0.0 138-139 13.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGAA 10 0.006577216 146.82278 1 GCCCAGC 10 0.006832588 144.9875 6 >>END_MODULE SRR7169810 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169810_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06225 33.0 33.0 34.0 32.0 34.0 2 33.1795 34.0 33.0 34.0 33.0 34.0 3 33.19025 34.0 33.0 34.0 33.0 34.0 4 33.12975 34.0 33.0 34.0 33.0 34.0 5 33.192 34.0 33.0 34.0 33.0 34.0 6 37.32125 38.0 38.0 38.0 37.0 38.0 7 37.42125 38.0 38.0 38.0 38.0 38.0 8 37.4565 38.0 38.0 38.0 38.0 38.0 9 37.35875 38.0 38.0 38.0 37.0 38.0 10-14 37.359300000000005 38.0 38.0 38.0 37.6 38.0 15-19 36.79185 38.0 37.8 38.0 35.2 38.0 20-24 37.1995 38.0 38.0 38.0 37.0 38.0 25-29 35.948249999999994 38.0 37.0 38.0 31.2 38.0 30-34 37.1857 38.0 38.0 38.0 36.8 38.0 35-39 37.3061 38.0 38.0 38.0 37.2 38.0 40-44 37.255599999999994 38.0 38.0 38.0 37.2 38.0 45-49 37.12675 38.0 38.0 38.0 36.8 38.0 50-54 37.16545000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.07045 38.0 38.0 38.0 36.6 38.0 60-64 37.0535 38.0 38.0 38.0 36.8 38.0 65-69 35.5382 38.0 36.4 38.0 28.4 38.0 70-74 36.001099999999994 38.0 37.2 38.0 32.2 38.0 75-79 36.7153 38.0 38.0 38.0 36.0 38.0 80-84 36.43704999999999 38.0 37.6 38.0 34.0 38.0 85-89 36.7666 38.0 38.0 38.0 35.6 38.0 90-94 36.7644 38.0 38.0 38.0 36.0 38.0 95-99 36.7307 38.0 38.0 38.0 35.6 38.0 100-104 36.36665 38.0 38.0 38.0 34.6 38.0 105-109 35.41895 38.0 37.0 38.0 29.6 38.0 110-114 35.19715 38.0 37.0 38.0 29.2 38.0 115-119 33.94015 38.0 35.8 38.0 22.0 38.0 120-124 33.87505 38.0 35.6 38.0 18.8 38.0 125-129 34.06755 38.0 35.4 38.0 22.4 38.0 130-134 34.99745 38.0 35.6 38.0 28.6 38.0 135-139 34.9016 38.0 35.6 38.0 28.6 38.0 140-144 34.55385 38.0 34.8 38.0 27.4 38.0 145-149 33.6826 38.0 33.8 38.0 21.8 38.0 150-151 29.481875000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 2.0 5 1.0 6 2.0 7 2.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 3.0 17 3.0 18 4.0 19 7.0 20 8.0 21 7.0 22 6.0 23 9.0 24 8.0 25 11.0 26 13.0 27 18.0 28 22.0 29 45.0 30 68.0 31 53.0 32 122.0 33 126.0 34 192.0 35 318.0 36 726.0 37 2207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.60915228807202 20.005001250312578 15.353838459614904 28.032008002000502 2 25.75 25.674999999999997 31.724999999999998 16.85 3 21.45 28.325 29.849999999999998 20.375 4 25.3 33.7 22.45 18.55 5 24.075 35.699999999999996 22.2 18.025 6 21.375 36.525 24.075 18.025 7 20.225 21.7 37.775 20.3 8 21.975 24.325 27.625 26.075 9 21.675 24.925 30.175 23.225 10-14 23.595 28.389999999999997 26.11 21.905 15-19 23.655 27.685 27.62 21.04 20-24 23.45 27.55 28.33 20.669999999999998 25-29 23.625 28.749999999999996 26.87 20.755000000000003 30-34 22.905 27.445000000000004 28.54 21.11 35-39 23.595 27.595 27.865000000000002 20.945 40-44 23.54 27.900000000000002 27.97 20.59 45-49 23.580000000000002 27.49 27.435 21.495 50-54 23.78 28.12 27.485 20.615 55-59 24.27 27.32 28.244999999999997 20.165 60-64 23.064999999999998 27.700000000000003 28.535 20.7 65-69 23.630000000000003 27.750000000000004 27.939999999999998 20.68 70-74 23.825 27.779999999999998 28.015 20.380000000000003 75-79 23.536199889619187 28.021674777984046 27.91631127389494 20.525814058501833 80-84 23.53 28.205000000000002 27.755000000000003 20.51 85-89 23.75 28.349999999999998 27.839999999999996 20.06 90-94 23.685000000000002 27.284999999999997 28.415000000000003 20.615 95-99 24.275 27.765 27.93 20.03 100-104 24.203885439615462 27.463448828359706 27.974163829361103 20.35850190266373 105-109 24.695765865432968 27.597304636427637 27.64759127024037 20.059338227899023 110-114 24.512804815835118 27.94102642587491 27.38496071829405 20.161208039995916 115-119 25.023661794089808 27.573877379324852 27.6948154380061 19.70764538857924 120-124 25.377028648958934 27.986223451442882 27.109533997808278 19.527213901789906 125-129 25.63668972585191 27.619779656674353 27.281578273123237 19.4619523443505 130-134 25.864917638812397 27.802533420117157 26.75612076303009 19.576428178040352 135-139 25.8 27.755000000000003 27.034999999999997 19.41 140-144 25.745 27.68 26.88 19.695 145-149 26.05 28.015 26.919999999999998 19.015 150-151 27.437499999999996 26.700000000000003 26.737499999999997 19.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 4.5 28 6.0 29 6.5 30 10.0 31 14.0 32 23.0 33 32.0 34 40.0 35 54.0 36 68.0 37 89.5 38 112.0 39 154.0 40 198.0 41 240.5 42 278.5 43 295.0 44 297.0 45 281.5 46 269.5 47 267.5 48 245.5 49 211.5 50 182.5 51 141.5 52 110.5 53 97.5 54 71.5 55 41.0 56 40.5 57 36.0 58 21.5 59 14.0 60 8.5 61 6.5 62 6.5 63 4.0 64 3.0 65 2.0 66 0.5 67 1.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.345 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.13999999999999999 105-109 0.5700000000000001 110-114 1.9900000000000002 115-119 4.91 120-124 4.185 125-129 2.4250000000000003 130-134 0.135 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.4625 0.0 0.0 0.0 0.0 102-103 2.6875 0.0 0.0 0.0 0.0 104-105 3.05 0.0 0.0 0.0 0.0 106-107 3.5125 0.0 0.0 0.0 0.0 108-109 3.925 0.0 0.0 0.0 0.0 110-111 4.4125 0.0 0.0 0.0 0.0 112-113 4.825 0.0 0.0 0.0 0.0 114-115 5.2625 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.112500000000001 0.0 0.0 0.0 0.0 120-121 6.7875 0.0 0.0 0.0 0.0 122-123 7.3375 0.0 0.0 0.0 0.0 124-125 8.0375 0.0 0.0 0.0 0.0 126-127 8.65 0.0 0.0 0.0 0.0 128-129 9.4 0.0 0.0 0.0 0.0 130-131 9.9875 0.0 0.0 0.0 0.0 132-133 10.712499999999999 0.0 0.0 0.0 0.0 134-135 11.45 0.0 0.0 0.0 0.0 136-137 12.100000000000001 0.0 0.0 0.0 0.0 138-139 12.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGCGG 10 0.0069303843 144.3 145 TTTTTTT 30 0.0014850771 24.05 40-44 >>END_MODULE Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883969 spots for SRR7169810.sra Written 883969 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra Read 883967 spots for SRR7169810.sra Written 883967 spots for SRR7169810.sra SRR ids: ['SRR7169810.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_21pk1816 SRR7169810.sra spots: 17679342 blocks: [[1, 883967], [883968, 1767934], [1767935, 2651901], [2651902, 3535868], [3535869, 4419835], [4419836, 5303802], [5303803, 6187769], [6187770, 7071736], [7071737, 7955703], [7955704, 8839670], [8839671, 9723637], [9723638, 10607604], [10607605, 11491571], [11491572, 12375538], [12375539, 13259505], [13259506, 14143472], [14143473, 15027439], [15027440, 15911406], [15911407, 16795373], [16795374, 17679342]] SRR7169810 file size 5969248 SRR7169810 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169810 SRR7169810_1.fastq SRR7169810_2.fastq Input file: SRR7169810_1.fastq Paired file: SRR7169810_2.fastq trimmed: SRR7169810-trimmed-pair1.fastq, SRR7169810-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:28:05 2025 >> started Tue Feb 11 20:28:25 2025 >> done (19.887s) 17679342 read pairs processed; of these: 18037 ( 0.10%) short read pairs filtered out after trimming by size control 24111 ( 0.14%) empty read pairs filtered out after trimming by size control 17637194 (99.76%) read pairs available; of these: 8714409 (49.41%) trimmed read pairs available after processing 8922785 (50.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 7 0.00% 22 6 0.00% 23 3 0.00% 24 6 0.00% 25 5 0.00% 26 8 0.00% 27 6 0.00% 28 8 0.00% 29 7 0.00% 30 14 0.00% 31 10 0.00% 32 13 0.00% 33 17 0.00% 34 16 0.00% 35 29 0.00% 36 21 0.00% 37 31 0.00% 38 31 0.00% 39 45 0.00% 40 44 0.00% 41 67 0.00% 42 57 0.00% 43 72 0.00% 44 55 0.00% 45 78 0.00% 46 93 0.00% 47 112 0.00% 48 152 0.00% 49 181 0.00% 50 188 0.00% 51 245 0.00% 52 254 0.00% 53 273 0.00% 54 354 0.00% 55 307 0.00% 56 381 0.00% 57 430 0.00% 58 507 0.00% 59 608 0.00% 60 676 0.00% 61 795 0.00% 62 925 0.01% 63 1128 0.01% 64 1199 0.01% 65 1319 0.01% 66 1439 0.01% 67 1558 0.01% 68 1792 0.01% 69 1993 0.01% 70 2501 0.01% 71 2837 0.02% 72 3224 0.02% 73 3623 0.02% 74 4174 0.02% 75 4521 0.03% 76 5343 0.03% 77 5863 0.03% 78 6072 0.03% 79 6623 0.04% 80 7300 0.04% 81 8243 0.05% 82 9155 0.05% 83 10443 0.06% 84 12289 0.07% 85 13813 0.08% 86 14599 0.08% 87 15602 0.09% 88 16421 0.09% 89 17107 0.10% 90 18203 0.10% 91 19982 0.11% 92 21621 0.12% 93 23388 0.13% 94 25022 0.14% 95 26329 0.15% 96 27343 0.16% 97 28548 0.16% 98 29057 0.16% 99 30013 0.17% 100 31778 0.18% 101 32749 0.19% 102 34790 0.20% 103 36650 0.21% 104 38352 0.22% 105 40407 0.23% 106 41804 0.24% 107 42277 0.24% 108 43645 0.25% 109 44420 0.25% 110 44877 0.25% 111 46754 0.27% 112 48473 0.27% 113 50709 0.29% 114 52677 0.30% 115 55201 0.31% 116 55986 0.32% 117 57400 0.33% 118 57404 0.33% 119 57905 0.33% 120 59218 0.34% 121 60030 0.34% 122 61777 0.35% 123 64350 0.36% 124 67055 0.38% 125 68763 0.39% 126 70291 0.40% 127 72979 0.41% 128 73280 0.42% 129 74000 0.42% 130 75006 0.43% 131 76405 0.43% 132 78248 0.44% 133 80472 0.46% 134 82923 0.47% 135 85887 0.49% 136 88151 0.50% 137 91501 0.52% 138 94120 0.53% 139 97653 0.55% 140 101374 0.57% 141 106879 0.61% 142 113875 0.65% 143 122990 0.70% 144 138202 0.78% 145 158820 0.90% 146 187690 1.06% 147 240219 1.36% 148 349850 1.98% 149 671489 3.81% 150 3649817 20.69% 151 8922785 50.59% 17637194 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=43 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=343.04 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=29.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=44 prefix-density=0.27 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=5 fanout-score=312.64 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=28.9 sequence=AAGAAGAAGAAG SRR7169810 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:29:08 Started mapping on | Feb 11 20:29:08 Finished on | Feb 11 20:30:42 Mapping speed, Million of reads per hour | 675.47 Number of input reads | 17637194 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16764283 Uniquely mapped reads % | 95.05% Average mapped length | 289.07 Number of splices: Total | 15377629 Number of splices: Annotated (sjdb) | 15116074 Number of splices: GT/AG | 15133740 Number of splices: GC/AG | 193063 Number of splices: AT/AC | 13729 Number of splices: Non-canonical | 37097 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344487 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 37689 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 544353 544353 544353 N_multimapping 344487 344487 344487 N_noFeature 401024 16586773 491695 N_ambiguous 149493 781 62130 UnstrandedReadsAssigned:16213766 PositiveStrandReadsAssigned:176729 NegativeStrandReadsAssigned:16210458 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169810 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169810-trimmed-pair1.fastq SRR7169810-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,637,194 reads, 16,145,358 reads pseudoaligned [quant] estimated average fragment length: 209.156 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7169810.ke.tsv 34699 SRR7169810.se.tsv 87100 total ==> SRR7169810.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.84 331 11.3611 Potri.005G024800.1.v4.1 1035 826.844 86 6.46115 Potri.004G059700.1.v4.1 961 752.855 4 0.330053 Potri.007G009000.2.v4.1 1416 1207.84 0 0 Potri.003G141000.2.v4.1 2943 2734.84 427.048 9.70015 Potri.016G087400.1.v4.1 270 94.7914 1541 1009.88 Potri.015G069301.1.v4.1 564 357.878 0 0 Potri.010G195200.1.v4.1 1773 1564.84 88 3.49338 Potri.012G127500.1.v4.1 977 768.849 11539 932.312 ==> SRR7169810.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1496 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 413 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7169810 completed mapping pipeline successfully