Starting /dee2/code/volunteer_pipeline.sh SRR7169811 current disk space = 3052945477632 free memory = 1574330948 SRR7169811 SRAfilesize 15b058a7d32aa3f65984aede11674cfb SRR7169811.sra SRR7169811.sra file validated SRR7169811 is paired end SRR7169811 is conventional basespace SRR7169811 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169811_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.10275 33.0 32.0 33.0 25.0 34.0 2 32.055 33.0 31.0 33.0 29.0 34.0 3 32.14425 33.0 33.0 33.0 31.0 34.0 4 31.89725 33.0 31.0 33.0 29.0 34.0 5 32.66875 33.0 33.0 34.0 32.0 34.0 6 36.873 38.0 37.0 38.0 35.0 38.0 7 37.20925 38.0 38.0 38.0 36.0 38.0 8 37.44625 38.0 38.0 38.0 37.0 38.0 9 37.5075 38.0 38.0 38.0 38.0 38.0 10-14 37.56955000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.577650000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.5766 38.0 38.0 38.0 38.0 38.0 25-29 37.59135 38.0 38.0 38.0 38.0 38.0 30-34 37.5728 38.0 38.0 38.0 38.0 38.0 35-39 37.52165 38.0 38.0 38.0 38.0 38.0 40-44 37.511799999999994 38.0 38.0 38.0 37.8 38.0 45-49 37.4569 38.0 38.0 38.0 37.4 38.0 50-54 37.427249999999994 38.0 38.0 38.0 37.4 38.0 55-59 37.36345 38.0 38.0 38.0 37.0 38.0 60-64 36.873000000000005 38.0 37.8 38.0 35.4 38.0 65-69 37.25170000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.27140000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.0735 38.0 38.0 38.0 36.8 38.0 80-84 36.94015 38.0 38.0 38.0 36.0 38.0 85-89 36.872699999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.71195 38.0 38.0 38.0 35.2 38.0 95-99 36.73485 38.0 38.0 38.0 35.4 38.0 100-104 36.83245 38.0 38.0 38.0 36.0 38.0 105-109 36.55215 38.0 38.0 38.0 34.8 38.0 110-114 36.39834999999999 38.0 38.0 38.0 34.4 38.0 115-119 36.45565 38.0 38.0 38.0 34.4 38.0 120-124 36.401500000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.286199999999994 38.0 38.0 38.0 34.0 38.0 130-134 35.8845 38.0 37.4 38.0 32.6 38.0 135-139 35.75295 38.0 37.0 38.0 32.6 38.0 140-144 35.53805 38.0 36.4 38.0 32.6 38.0 145-149 35.05545 38.0 36.0 38.0 30.4 38.0 150-151 31.412 35.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 3.0 19 24.0 20 5.0 21 3.0 22 1.0 23 6.0 24 5.0 25 6.0 26 7.0 27 9.0 28 10.0 29 24.0 30 23.0 31 48.0 32 55.0 33 85.0 34 122.0 35 203.0 36 511.0 37 2846.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.509794073329985 11.828227021597188 13.033651431441488 39.628327473631344 2 23.375 16.950000000000003 33.025 26.650000000000002 3 21.175 25.074999999999996 24.625 29.125 4 23.150000000000002 32.175 21.2 23.474999999999998 5 23.400000000000002 35.05 23.05 18.5 6 20.7 36.1 24.975 18.224999999999998 7 14.325 26.6 41.85 17.224999999999998 8 18.725 24.45 29.65 27.175 9 18.475 23.45 33.074999999999996 25.0 10-14 20.415 29.82 26.6 23.165 15-19 20.52 28.560000000000002 27.345000000000002 23.575 20-24 20.599999999999998 29.17 27.500000000000004 22.73 25-29 20.495 29.595 26.900000000000002 23.01 30-34 20.332033203320332 28.637863786378638 27.342734273427343 23.687368736873687 35-39 20.527052705270528 29.292929292929294 26.552655265526553 23.62736273627363 40-44 19.655 29.580000000000002 27.450000000000003 23.315 45-49 20.77 28.83 27.41 22.99 50-54 20.21 28.525 27.034999999999997 24.23 55-59 20.395 28.96 26.790000000000003 23.855 60-64 20.305 28.83 27.405 23.46 65-69 20.565 29.14 26.889999999999997 23.405 70-74 20.4 29.244999999999997 26.55 23.805 75-79 20.724999999999998 29.080000000000002 26.66 23.535 80-84 20.5 28.689999999999998 27.060000000000002 23.75 85-89 20.74 28.875 26.91 23.474999999999998 90-94 20.805 29.15 26.810000000000002 23.235 95-99 20.615 28.395 27.544999999999998 23.445 100-104 21.211363409022706 28.54856456937081 26.59297789336801 23.64709412823847 105-109 21.161950632149306 28.311258278145697 27.122215532811563 23.404575556893437 110-114 21.297041658281344 28.526866572751057 26.24270476957134 23.933386999396255 115-119 21.615000000000002 29.299999999999997 25.759999999999998 23.325000000000003 120-124 21.565 29.244999999999997 26.02 23.169999999999998 125-129 21.065 28.93 25.895000000000003 24.11 130-134 21.545 28.51 25.929999999999996 24.015 135-139 21.634999999999998 28.505000000000003 25.785000000000004 24.075 140-144 21.425 28.155 26.3 24.12 145-149 21.11 29.34 25.385 24.165 150-151 21.655413853463365 29.56989247311828 25.993998499624904 22.780695173793447 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 2.5 25 4.0 26 4.5 27 6.5 28 14.0 29 15.5 30 15.0 31 22.5 32 34.5 33 42.0 34 51.5 35 65.5 36 92.0 37 112.5 38 129.5 39 152.0 40 173.0 41 202.0 42 235.0 43 258.5 44 254.5 45 267.0 46 268.0 47 253.0 48 238.0 49 218.0 50 199.5 51 154.5 52 118.0 53 103.0 54 85.5 55 52.5 56 34.5 57 34.0 58 23.5 59 16.5 60 12.5 61 7.0 62 5.0 63 6.0 64 4.5 65 2.5 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.33999999999999997 110-114 0.62 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29060045604257 97.975 2 0.6587281479604763 1.3 3 0.02533569799847986 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02533569799847986 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 26 0.65 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.8500000000000001 0.0 0.0 0.0 0.0 84-85 1.05 0.0 0.0 0.0 0.0 86-87 1.325 0.0 0.0 0.0 0.0 88-89 1.6 0.0 0.0 0.0 0.0 90-91 1.85 0.0 0.0 0.0 0.0 92-93 2.0625 0.0 0.0 0.0 0.0 94-95 2.3875 0.0 0.0 0.0 0.0 96-97 2.7375 0.0 0.0 0.0 0.0 98-99 3.0875 0.0 0.0 0.0 0.0 100-101 3.5 0.0 0.0 0.0 0.0 102-103 3.8625 0.0 0.0 0.0 0.0 104-105 4.3375 0.0 0.0 0.0 0.0 106-107 4.65 0.0 0.0 0.0 0.0 108-109 5.0625 0.0 0.0 0.0 0.0 110-111 5.6875 0.0 0.0 0.0 0.0 112-113 6.2 0.0 0.0 0.0 0.0 114-115 6.7625 0.0 0.0 0.0 0.0 116-117 7.2875 0.0 0.0 0.0 0.0 118-119 7.9125 0.0 0.0 0.0 0.0 120-121 8.45 0.0 0.0 0.0 0.0 122-123 9.087499999999999 0.0 0.0 0.0 0.0 124-125 9.725000000000001 0.0 0.0 0.0 0.0 126-127 10.5625 0.0 0.0 0.0 0.0 128-129 11.1375 0.0 0.0 0.0 0.0 130-131 11.7375 0.0 0.0 0.0 0.0 132-133 12.35 0.0 0.0 0.0 0.0 134-135 13.0875 0.0 0.0 0.0 0.0 136-137 13.9 0.0 0.0 0.0 0.0 138-139 14.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 95 0.007339027 10.672236 140-144 GGAAGAG 95 0.007339027 10.672236 140-144 >>END_MODULE SRR7169811 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169811_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.911 33.0 33.0 34.0 32.0 34.0 2 33.0585 34.0 33.0 34.0 32.0 34.0 3 33.05725 34.0 33.0 34.0 33.0 34.0 4 32.9555 34.0 33.0 34.0 33.0 34.0 5 32.99575 34.0 33.0 34.0 33.0 34.0 6 37.16875 38.0 38.0 38.0 37.0 38.0 7 37.13025 38.0 38.0 38.0 37.0 38.0 8 37.10425 38.0 38.0 38.0 37.0 38.0 9 37.132 38.0 38.0 38.0 37.0 38.0 10-14 37.07225 38.0 38.0 38.0 37.0 38.0 15-19 37.0572 38.0 38.0 38.0 37.0 38.0 20-24 37.04625 38.0 38.0 38.0 37.0 38.0 25-29 36.9944 38.0 38.0 38.0 37.0 38.0 30-34 36.90239999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.541250000000005 38.0 38.0 38.0 35.0 38.0 40-44 36.8936 38.0 38.0 38.0 36.6 38.0 45-49 36.9429 38.0 38.0 38.0 37.0 38.0 50-54 36.837450000000004 38.0 38.0 38.0 36.6 38.0 55-59 36.74345 38.0 38.0 38.0 36.0 38.0 60-64 36.792899999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.81400000000001 38.0 38.0 38.0 36.2 38.0 70-74 36.37855 38.0 38.0 38.0 35.6 38.0 75-79 35.35275 38.0 38.0 38.0 32.4 38.0 80-84 35.81505 38.0 38.0 38.0 32.2 38.0 85-89 36.377300000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.3204 38.0 38.0 38.0 35.2 38.0 95-99 36.116600000000005 38.0 38.0 38.0 34.4 38.0 100-104 35.990050000000004 38.0 38.0 38.0 34.0 38.0 105-109 34.82665 38.0 37.8 38.0 28.8 38.0 110-114 33.653099999999995 38.0 36.8 38.0 15.0 38.0 115-119 32.74275 38.0 36.0 38.0 2.0 38.0 120-124 33.1007 38.0 36.0 38.0 12.0 38.0 125-129 33.10265 38.0 34.8 38.0 16.2 38.0 130-134 34.735400000000006 38.0 36.0 38.0 26.4 38.0 135-139 34.744749999999996 38.0 36.0 38.0 28.0 38.0 140-144 34.28315 38.0 36.0 38.0 25.6 38.0 145-149 33.3859 38.0 33.6 38.0 19.2 38.0 150-151 29.828375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 4.0 5 3.0 6 2.0 7 4.0 8 5.0 9 1.0 10 3.0 11 1.0 12 5.0 13 6.0 14 2.0 15 6.0 16 5.0 17 1.0 18 8.0 19 10.0 20 22.0 21 8.0 22 3.0 23 14.0 24 16.0 25 8.0 26 18.0 27 28.0 28 51.0 29 61.0 30 75.0 31 74.0 32 98.0 33 91.0 34 158.0 35 223.0 36 509.0 37 2457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 14.374999999999998 20.625 27.925 2 27.500000000000004 21.775 32.074999999999996 18.65 3 21.160580290145074 25.78789394697349 32.79139569784893 20.260130065032516 4 23.36168084042021 32.51625812906453 22.961480740370185 21.160580290145074 5 23.625 35.325 21.875 19.175 6 20.7 34.875 25.55 18.875 7 20.025000000000002 19.25 39.35 21.375 8 22.400000000000002 25.2 26.3 26.1 9 21.4 26.700000000000003 28.549999999999997 23.35 10-14 22.99 28.035 27.52 21.455 15-19 22.795 27.07 28.845 21.29 20-24 22.732273227322732 28.15781578157816 27.762776277627765 21.34713471347135 25-29 23.055 27.855 28.215 20.875 30-34 22.992299229922992 27.827782778277825 28.072807280728075 21.107110711071105 35-39 22.969187675070028 27.651060424169664 28.286314525810326 21.093437374949982 40-44 23.64709412823847 27.423226968090425 28.27848354506352 20.651195358607584 45-49 23.382338233823383 27.787778777877786 27.952795279527955 20.877087708770876 50-54 23.122312231223123 26.957695769576954 28.52785278527853 21.392139213921393 55-59 23.74737473747375 27.457745774577457 27.987798779877988 20.807080708070806 60-64 22.64 27.505000000000003 28.194999999999997 21.66 65-69 23.105 27.810000000000002 28.544999999999998 20.54 70-74 23.368548753980694 27.008037203659708 28.367790527220343 21.25562351513926 75-79 23.21493388644024 27.565465387606945 28.69587762509723 20.523723100855587 80-84 23.228645122136246 27.997774743336873 27.79042128154554 20.983158852981337 85-89 23.189999999999998 28.09 27.77 20.95 90-94 23.425 27.965 27.450000000000003 21.16 95-99 23.69 27.650000000000002 28.105000000000004 20.555 100-104 24.14673205885297 27.599839855870282 27.77499749774797 20.478430587528777 105-109 24.484004127966976 27.275541795665635 27.884416924664603 20.356037151702786 110-114 24.289447021809842 27.888871113955098 27.328960699621398 20.492721164613663 115-119 25.045163409426834 27.738544917063557 27.475775989489243 19.740515684020366 120-124 24.576044508639598 27.625314288771197 27.149200235382224 20.649440967206974 125-129 25.65423016290068 27.582764056752495 27.183394640042042 19.57961114030478 130-134 25.50866994086399 27.43309612107848 27.22261200761752 19.835621930440013 135-139 26.045 27.26 27.12 19.575 140-144 25.935000000000002 27.6 26.815 19.650000000000002 145-149 26.055 27.765 26.58 19.6 150-151 27.029058116232463 27.17935871743487 26.189879759519037 19.601703406813627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 3.5 25 3.0 26 3.0 27 4.5 28 3.5 29 10.0 30 16.0 31 19.0 32 24.5 33 34.5 34 47.0 35 52.0 36 69.0 37 99.5 38 131.0 39 171.5 40 196.0 41 234.5 42 276.5 43 272.5 44 263.0 45 275.5 46 281.5 47 265.0 48 245.5 49 212.0 50 165.0 51 137.0 52 125.5 53 102.0 54 72.0 55 41.0 56 27.5 57 30.5 58 23.5 59 17.5 60 12.5 61 4.5 62 3.5 63 6.0 64 4.0 65 2.5 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.01 35-39 0.04 40-44 0.03 45-49 0.01 50-54 0.01 55-59 0.01 60-64 0.0 65-69 0.0 70-74 1.085 75-79 3.5749999999999997 80-84 1.135 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.09 105-109 3.1 110-114 6.235 115-119 8.665000000000001 120-124 6.535 125-129 4.8500000000000005 130-134 0.22999999999999998 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69712266532055 98.75 2 0.2523977788995457 0.5 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025239777889954566 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 27 0.675 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88-89 1.5625 0.0 0.0 0.0 0.0 90-91 1.825 0.0 0.0 0.0 0.0 92-93 2.0250000000000004 0.0 0.0 0.0 0.0 94-95 2.3375 0.0 0.0 0.0 0.0 96-97 2.6875 0.0 0.0 0.0 0.0 98-99 3.0 0.0 0.0 0.0 0.0 100-101 3.3625 0.0 0.0 0.0 0.0 102-103 3.6875 0.0 0.0 0.0 0.0 104-105 4.15 0.0 0.0 0.0 0.0 106-107 4.475 0.0 0.0 0.0 0.0 108-109 4.8375 0.0 0.0 0.0 0.0 110-111 5.4375 0.0 0.0 0.0 0.0 112-113 5.8875 0.0 0.0 0.0 0.0 114-115 6.324999999999999 0.0 0.0 0.0 0.0 116-117 6.8 0.0 0.0 0.0 0.0 118-119 7.35 0.0 0.0 0.0 0.0 120-121 7.825 0.0 0.0 0.0 0.0 122-123 8.375 0.0 0.0 0.0 0.0 124-125 8.9625 0.0 0.0 0.0 0.0 126-127 9.712499999999999 0.0 0.0 0.0 0.0 128-129 10.225 0.0 0.0 0.0 0.0 130-131 10.8 0.0 0.0 0.0 0.0 132-133 11.3875 0.0 0.0 0.0 0.0 134-135 12.15 0.0 0.0 0.0 0.0 136-137 13.0 0.0 0.0 0.0 0.0 138-139 13.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629954 spots for SRR7169811.sra Written 629954 spots for SRR7169811.sra Read 629967 spots for SRR7169811.sra Written 629967 spots for SRR7169811.sra SRR ids: ['SRR7169811.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0bsmvqrx SRR7169811.sra spots: 12599093 blocks: [[1, 629954], [629955, 1259908], [1259909, 1889862], [1889863, 2519816], [2519817, 3149770], [3149771, 3779724], [3779725, 4409678], [4409679, 5039632], [5039633, 5669586], [5669587, 6299540], [6299541, 6929494], [6929495, 7559448], [7559449, 8189402], [8189403, 8819356], [8819357, 9449310], [9449311, 10079264], [10079265, 10709218], [10709219, 11339172], [11339173, 11969126], [11969127, 12599093]] SRR7169811 file size 4247718 SRR7169811 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169811 SRR7169811_1.fastq SRR7169811_2.fastq Input file: SRR7169811_1.fastq Paired file: SRR7169811_2.fastq trimmed: SRR7169811-trimmed-pair1.fastq, SRR7169811-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:59:49 2025 >> started Tue Feb 11 21:00:03 2025 >> done (14.078s) 12599093 read pairs processed; of these: 22287 ( 0.18%) short read pairs filtered out after trimming by size control 84230 ( 0.67%) empty read pairs filtered out after trimming by size control 12492576 (99.15%) read pairs available; of these: 6080842 (48.68%) trimmed read pairs available after processing 6411734 (51.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 7 0.00% 21 5 0.00% 22 9 0.00% 23 6 0.00% 24 7 0.00% 25 10 0.00% 26 9 0.00% 27 7 0.00% 28 14 0.00% 29 10 0.00% 30 18 0.00% 31 25 0.00% 32 27 0.00% 33 45 0.00% 34 32 0.00% 35 35 0.00% 36 38 0.00% 37 61 0.00% 38 53 0.00% 39 78 0.00% 40 124 0.00% 41 131 0.00% 42 178 0.00% 43 206 0.00% 44 183 0.00% 45 249 0.00% 46 256 0.00% 47 284 0.00% 48 341 0.00% 49 373 0.00% 50 394 0.00% 51 492 0.00% 52 563 0.00% 53 598 0.00% 54 638 0.01% 55 547 0.00% 56 640 0.01% 57 683 0.01% 58 857 0.01% 59 1028 0.01% 60 1129 0.01% 61 1411 0.01% 62 1666 0.01% 63 1778 0.01% 64 1793 0.01% 65 1893 0.02% 66 1946 0.02% 67 2071 0.02% 68 2426 0.02% 69 2790 0.02% 70 3319 0.03% 71 3917 0.03% 72 4647 0.04% 73 5103 0.04% 74 5546 0.04% 75 5982 0.05% 76 7531 0.06% 77 7642 0.06% 78 6746 0.05% 79 7453 0.06% 80 8377 0.07% 81 9508 0.08% 82 11032 0.09% 83 12069 0.10% 84 13700 0.11% 85 14517 0.12% 86 14528 0.12% 87 15085 0.12% 88 15640 0.13% 89 16314 0.13% 90 17729 0.14% 91 19498 0.16% 92 21092 0.17% 93 22766 0.18% 94 23945 0.19% 95 24932 0.20% 96 25323 0.20% 97 24670 0.20% 98 24970 0.20% 99 25497 0.20% 100 26710 0.21% 101 28184 0.23% 102 30564 0.24% 103 32256 0.26% 104 33704 0.27% 105 34383 0.28% 106 34826 0.28% 107 34335 0.27% 108 34527 0.28% 109 34537 0.28% 110 35414 0.28% 111 36840 0.29% 112 38414 0.31% 113 40572 0.32% 114 42449 0.34% 115 43599 0.35% 116 43540 0.35% 117 43292 0.35% 118 42927 0.34% 119 42441 0.34% 120 43085 0.34% 121 44414 0.36% 122 46141 0.37% 123 47958 0.38% 124 49812 0.40% 125 51905 0.42% 126 53263 0.43% 127 53229 0.43% 128 52931 0.42% 129 52284 0.42% 130 52906 0.42% 131 52803 0.42% 132 54905 0.44% 133 56904 0.46% 134 58862 0.47% 135 61122 0.49% 136 62740 0.50% 137 63840 0.51% 138 64853 0.52% 139 66391 0.53% 140 68820 0.55% 141 72345 0.58% 142 75705 0.61% 143 81665 0.65% 144 91557 0.73% 145 106278 0.85% 146 119621 0.96% 147 153613 1.23% 148 214434 1.72% 149 400129 3.20% 150 2425553 19.42% 151 6411734 51.32% 12492576 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=2.2 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTACTAGC criterion=fanout-score sequence-density=0.17 sequence-density-rank=8 fanout-score=55.17 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=14.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=1.9 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.07 sequence-density-rank=35 fanout-score=55.45 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=12.9 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169811 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:00:45 Started mapping on | Feb 11 21:00:45 Finished on | Feb 11 21:01:43 Mapping speed, Million of reads per hour | 775.40 Number of input reads | 12492576 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12039049 Uniquely mapped reads % | 96.37% Average mapped length | 286.90 Number of splices: Total | 10675795 Number of splices: Annotated (sjdb) | 10493704 Number of splices: GT/AG | 10524636 Number of splices: GC/AG | 115175 Number of splices: AT/AC | 9031 Number of splices: Non-canonical | 26953 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218887 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 23200 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 250818 250818 250818 N_multimapping 218887 218887 218887 N_noFeature 302660 11900269 359577 N_ambiguous 130469 863 47895 UnstrandedReadsAssigned:11605920 PositiveStrandReadsAssigned:137917 NegativeStrandReadsAssigned:11631577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169811 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169811-trimmed-pair1.fastq SRR7169811-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,492,576 reads, 11,593,612 reads pseudoaligned [quant] estimated average fragment length: 207.094 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR7169811.ke.tsv 34699 SRR7169811.se.tsv 87100 total ==> SRR7169811.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.91 216 11.9541 Potri.005G024800.1.v4.1 1035 828.906 21 2.54047 Potri.004G059700.1.v4.1 961 754.906 1 0.132833 Potri.007G009000.2.v4.1 1416 1209.91 0 0 Potri.003G141000.2.v4.1 2943 2736.91 122.069 4.47245 Potri.016G087400.1.v4.1 270 99.8113 976 980.551 Potri.015G069301.1.v4.1 564 360.042 0 0 Potri.010G195200.1.v4.1 1773 1566.91 12 0.767959 Potri.012G127500.1.v4.1 977 770.906 1629 211.894 ==> SRR7169811.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1105 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169811 completed mapping pipeline successfully