Starting /dee2/code/volunteer_pipeline.sh SRR7169812 current disk space = 3052973604864 free memory = 1507823172 SRR7169812 SRAfilesize 38688600326e3817da0d732e47a229ac SRR7169812.sra SRR7169812.sra file validated SRR7169812 is paired end SRR7169812 is conventional basespace SRR7169812 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.732 27.0 18.0 33.0 18.0 33.0 2 28.71175 30.0 27.0 31.0 18.0 33.0 3 31.609 33.0 31.0 33.0 29.0 33.0 4 32.42725 33.0 33.0 33.0 31.0 34.0 5 32.855 33.0 33.0 33.0 32.0 34.0 6 36.86725 38.0 37.0 38.0 35.0 38.0 7 37.39175 38.0 38.0 38.0 37.0 38.0 8 36.6755 38.0 38.0 38.0 34.0 38.0 9 37.42375 38.0 38.0 38.0 37.0 38.0 10-14 37.576499999999996 38.0 38.0 38.0 37.6 38.0 15-19 36.763200000000005 38.0 37.8 38.0 34.2 38.0 20-24 37.5827 38.0 38.0 38.0 37.8 38.0 25-29 37.562200000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.430800000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.32035 38.0 38.0 38.0 37.0 38.0 40-44 37.1025 38.0 38.0 38.0 36.4 38.0 45-49 36.775099999999995 38.0 38.0 38.0 35.2 38.0 50-54 37.296800000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.273450000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.2407 38.0 38.0 38.0 36.4 38.0 65-69 37.1997 38.0 38.0 38.0 36.0 38.0 70-74 37.1526 38.0 38.0 38.0 36.2 38.0 75-79 37.0674 38.0 38.0 38.0 36.0 38.0 80-84 36.96585 38.0 38.0 38.0 35.6 38.0 85-89 36.834849999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.70845 38.0 38.0 38.0 35.0 38.0 95-99 36.62165 38.0 38.0 38.0 34.6 38.0 100-104 36.593450000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.3971 38.0 37.8 38.0 34.0 38.0 110-114 35.7736 38.0 36.4 38.0 31.6 38.0 115-119 35.94435 38.0 37.0 38.0 32.6 38.0 120-124 36.006949999999996 38.0 37.0 38.0 33.0 38.0 125-129 35.5301 38.0 36.0 38.0 31.0 38.0 130-134 34.929700000000004 38.0 35.6 38.0 27.4 38.0 135-139 34.857749999999996 38.0 35.0 38.0 27.6 38.0 140-144 34.7177 38.0 35.0 38.0 27.2 38.0 145-149 34.14465 38.0 35.0 38.0 26.0 38.0 150-151 30.509625 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 2.0 17 1.0 18 2.0 19 6.0 20 5.0 21 3.0 22 4.0 23 4.0 24 5.0 25 10.0 26 16.0 27 9.0 28 10.0 29 23.0 30 44.0 31 55.0 32 57.0 33 119.0 34 172.0 35 311.0 36 951.0 37 2184.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.070800903841324 11.624403715792116 8.71202611097163 33.59276926939493 2 21.925 15.425 34.8 27.85 3 20.532797185222417 20.356873586328224 26.639859261120886 32.47046996732848 4 23.325000000000003 30.675 22.0 24.0 5 21.425 32.75 23.9 21.925 6 18.825 36.85 24.325 20.0 7 13.975000000000001 25.424999999999997 42.825 17.775 8 17.974999999999998 24.05 32.225 25.75 9 17.849999999999998 24.55 32.375 25.224999999999998 10-14 20.175 29.830000000000002 26.590000000000003 23.405 15-19 20.424999999999997 29.26 27.88 22.435 20-24 20.36 29.12 27.05 23.47 25-29 20.24 29.220000000000002 27.575 22.965 30-34 20.22 28.095 28.58 23.105 35-39 20.51 29.544999999999998 26.93 23.015 40-44 20.53 28.499999999999996 27.07 23.9 45-49 20.43 28.57 27.075 23.925 50-54 20.330000000000002 29.020000000000003 27.584999999999997 23.064999999999998 55-59 20.51 29.15 26.584999999999997 23.755000000000003 60-64 20.465 29.080000000000002 27.334999999999997 23.119999999999997 65-69 20.53 28.744999999999997 27.55 23.175 70-74 20.315 29.2 27.12 23.365 75-79 20.47 28.63 26.865 24.035 80-84 20.65 28.48 26.895000000000003 23.974999999999998 85-89 19.765 29.125 27.655 23.455000000000002 90-94 21.055 28.485 26.935 23.525 95-99 20.794999999999998 28.49 27.61 23.105 100-104 21.025 29.134999999999998 26.665 23.175 105-109 21.3710282712034 27.970978233675257 27.215411558669 23.44258193645234 110-114 20.565 29.42 26.340000000000003 23.674999999999997 115-119 20.880000000000003 28.67 26.479999999999997 23.97 120-124 20.46 29.17 26.83 23.54 125-129 21.465 28.375 26.325 23.835 130-134 21.005 28.155 26.729999999999997 24.11 135-139 21.565 28.449999999999996 26.484999999999996 23.5 140-144 20.474999999999998 27.925 27.32 24.279999999999998 145-149 21.055 27.24 27.365000000000002 24.34 150-151 21.349999999999998 27.775 26.5 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 3.0 24 3.5 25 2.0 26 3.5 27 5.5 28 9.0 29 13.5 30 17.0 31 29.0 32 37.0 33 41.0 34 62.0 35 77.0 36 94.0 37 108.0 38 116.5 39 150.0 40 177.5 41 190.5 42 218.5 43 248.5 44 273.5 45 274.5 46 288.5 47 277.0 48 228.5 49 205.5 50 177.0 51 150.0 52 131.5 53 111.0 54 81.0 55 54.5 56 37.5 57 28.5 58 17.5 59 9.0 60 9.0 61 10.0 62 7.0 63 3.0 64 2.5 65 4.5 66 3.0 67 1.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.525 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.075 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.8875 0.0 0.0 0.0 0.0 98-99 2.2875 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.275 0.0 0.0 0.0 0.0 104-105 3.775 0.0 0.0 0.0 0.0 106-107 4.137499999999999 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 5.0 0.0 0.0 0.0 0.0 112-113 5.375 0.0 0.0 0.0 0.0 114-115 5.775 0.0 0.0 0.0 0.0 116-117 6.3375 0.0 0.0 0.0 0.0 118-119 6.7625 0.0 0.0 0.0 0.0 120-121 7.575 0.0 0.0 0.0 0.0 122-123 8.3375 0.0 0.0 0.0 0.0 124-125 8.7625 0.0 0.0 0.0 0.0 126-127 9.325 0.0 0.0 0.0 0.0 128-129 10.0875 0.0 0.0 0.0 0.0 130-131 10.8625 0.0 0.0 0.0 0.0 132-133 11.4375 0.0 0.0 0.0 0.0 134-135 12.149999999999999 0.0 0.0 0.0 0.0 136-137 12.8875 0.0 0.0 0.0 0.0 138-139 13.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169812 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169812_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96025 33.0 33.0 34.0 32.0 34.0 2 33.03475 34.0 33.0 34.0 32.0 34.0 3 33.07325 34.0 33.0 34.0 32.0 34.0 4 33.03175 34.0 33.0 34.0 33.0 34.0 5 33.0245 34.0 33.0 34.0 33.0 34.0 6 37.27 38.0 38.0 38.0 37.0 38.0 7 37.26325 38.0 38.0 38.0 37.0 38.0 8 37.25825 38.0 38.0 38.0 37.0 38.0 9 37.23175 38.0 38.0 38.0 37.0 38.0 10-14 36.8838 38.0 38.0 38.0 35.6 38.0 15-19 37.11364999999999 38.0 38.0 38.0 37.0 38.0 20-24 36.98915 38.0 38.0 38.0 36.6 38.0 25-29 37.07270000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.6193 38.0 37.8 38.0 34.6 38.0 35-39 37.017950000000006 38.0 38.0 38.0 36.4 38.0 40-44 36.37335 38.0 37.4 38.0 33.2 38.0 45-49 37.085699999999996 38.0 38.0 38.0 36.8 38.0 50-54 36.728899999999996 38.0 37.8 38.0 35.2 38.0 55-59 36.71485 38.0 38.0 38.0 35.2 38.0 60-64 36.85745 38.0 38.0 38.0 36.0 38.0 65-69 36.5659 38.0 38.0 38.0 34.8 38.0 70-74 36.5668 38.0 38.0 38.0 35.4 38.0 75-79 36.51925 38.0 38.0 38.0 34.4 38.0 80-84 36.41785 38.0 37.8 38.0 34.4 38.0 85-89 36.6847 38.0 38.0 38.0 35.2 38.0 90-94 36.3904 38.0 38.0 38.0 34.0 38.0 95-99 36.463550000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.04025 38.0 37.8 38.0 33.4 38.0 105-109 34.62365 38.0 36.4 38.0 26.0 38.0 110-114 33.85025 38.0 36.0 38.0 20.2 38.0 115-119 33.2553 38.0 35.6 38.0 14.8 38.0 120-124 32.7389 38.0 34.0 38.0 13.8 38.0 125-129 33.80025 38.0 34.8 38.0 20.8 38.0 130-134 33.91945 38.0 34.4 38.0 22.6 38.0 135-139 34.0768 38.0 35.0 38.0 23.4 38.0 140-144 33.8871 38.0 34.2 38.0 23.2 38.0 145-149 33.29835 38.0 33.4 38.0 19.4 38.0 150-151 28.904875000000004 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 3.0 5 1.0 6 2.0 7 0.0 8 2.0 9 0.0 10 4.0 11 1.0 12 1.0 13 2.0 14 4.0 15 9.0 16 2.0 17 5.0 18 6.0 19 3.0 20 7.0 21 11.0 22 8.0 23 13.0 24 19.0 25 25.0 26 20.0 27 14.0 28 31.0 29 49.0 30 71.0 31 83.0 32 125.0 33 139.0 34 201.0 35 330.0 36 722.0 37 2077.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.875 18.35 13.275 26.5 2 27.474999999999998 24.525 31.125000000000004 16.875 3 20.40510127531883 27.93198299574894 32.03300825206302 19.629907476869217 4 23.525 33.875 23.175 19.425 5 24.7 34.849999999999994 21.475 18.975 6 19.25 37.25 23.3 20.200000000000003 7 20.05 20.4 39.525 20.025000000000002 8 20.0 25.45 28.1 26.450000000000003 9 20.8 25.45 29.549999999999997 24.2 10-14 23.29 28.52 26.555 21.634999999999998 15-19 23.09 27.584999999999997 27.425 21.9 20-24 23.244999999999997 28.74 27.41 20.605 25-29 23.380000000000003 27.875 28.15 20.595 30-34 22.835 27.83 28.060000000000002 21.275 35-39 23.064999999999998 28.12 27.83 20.985 40-44 23.51 28.28 27.37 20.84 45-49 22.869999999999997 27.794999999999998 27.915 21.42 50-54 23.3 27.47 28.115000000000002 21.115000000000002 55-59 23.665 27.950000000000003 27.894999999999996 20.49 60-64 23.195 27.735 28.294999999999998 20.775 65-69 23.02 27.11 28.99 20.880000000000003 70-74 23.112805336810954 28.0282891106987 28.01324171139088 20.845663841099462 75-79 23.28993490235353 27.165748622934398 28.39759639459189 21.14672008012018 80-84 23.16310708748062 27.999799929975495 27.694693142599906 21.14239983994398 85-89 23.36 27.41 28.665000000000003 20.565 90-94 23.505000000000003 28.050000000000004 27.845 20.599999999999998 95-99 23.485 27.43 28.305000000000003 20.78 100-104 23.980179188147556 28.009409880374392 27.38375294058762 20.626657990890436 105-109 24.039449352784057 27.249845900965685 28.066570782823096 20.644133963427162 110-114 24.701320477887233 27.630475791238734 27.326556277509955 20.341647453364075 115-119 24.82254248225425 27.457517745751776 27.855452785545275 19.8644869864487 120-124 25.02118195297606 27.488879474687565 27.64774412200805 19.84219445032832 125-129 24.601833358938904 27.99201106160701 27.387719567777946 20.01843601167614 130-134 25.600961538461537 27.87459935897436 26.627604166666668 19.896834935897438 135-139 25.22 28.115000000000002 27.515 19.15 140-144 25.615 27.634999999999998 27.339999999999996 19.41 145-149 26.06 27.650000000000002 26.895000000000003 19.395 150-151 26.974999999999998 26.55 26.137500000000003 20.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.5 26 2.5 27 6.0 28 8.5 29 12.0 30 17.5 31 15.5 32 17.0 33 25.0 34 42.5 35 63.0 36 77.0 37 99.5 38 128.0 39 159.0 40 191.5 41 223.5 42 240.0 43 267.0 44 286.5 45 288.5 46 296.0 47 274.5 48 245.0 49 204.5 50 172.0 51 161.5 52 133.5 53 101.5 54 72.5 55 44.0 56 34.0 57 26.0 58 16.5 59 11.5 60 7.5 61 6.0 62 3.0 63 3.5 64 5.0 65 4.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.315 75-79 0.15 80-84 0.034999999999999996 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.105 105-109 2.6599999999999997 110-114 4.58 115-119 7.02 120-124 5.58 125-129 2.365 130-134 0.16 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.30135610246107486 0.6 3 0.07533902561526871 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.8 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.7125000000000004 0.0 0.0 0.0 0.0 102-103 3.0625 0.0 0.0 0.0 0.0 104-105 3.55 0.0 0.0 0.0 0.0 106-107 3.875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 4.574999999999999 0.0 0.0 0.0 0.0 112-113 4.9375 0.0 0.0 0.0 0.0 114-115 5.324999999999999 0.0 0.0 0.0 0.0 116-117 5.737500000000001 0.0 0.0 0.0 0.0 118-119 6.15 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.6 0.0 0.0 0.0 0.0 124-125 8.0 0.0 0.0 0.0 0.0 126-127 8.5 0.0 0.0 0.0 0.0 128-129 9.225000000000001 0.0 0.0 0.0 0.0 130-131 9.9625 0.0 0.0 0.0 0.0 132-133 10.525 0.0 0.0 0.0 0.0 134-135 11.225000000000001 0.0 0.0 0.0 0.0 136-137 11.975 0.0 0.0 0.0 0.0 138-139 12.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATGC 10 0.007107461 143.0875 8 CAGCCTA 10 0.007107461 143.0875 9 >>END_MODULE Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955041 spots for SRR7169812.sra Written 955041 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra Read 955030 spots for SRR7169812.sra Written 955030 spots for SRR7169812.sra SRR ids: ['SRR7169812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_en2vw9t0 SRR7169812.sra spots: 19100611 blocks: [[1, 955030], [955031, 1910060], [1910061, 2865090], [2865091, 3820120], [3820121, 4775150], [4775151, 5730180], [5730181, 6685210], [6685211, 7640240], [7640241, 8595270], [8595271, 9550300], [9550301, 10505330], [10505331, 11460360], [11460361, 12415390], [12415391, 13370420], [13370421, 14325450], [14325451, 15280480], [15280481, 16235510], [16235511, 17190540], [17190541, 18145570], [18145571, 19100611]] SRR7169812 file size 6450869 SRR7169812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169812 SRR7169812_1.fastq SRR7169812_2.fastq Input file: SRR7169812_1.fastq Paired file: SRR7169812_2.fastq trimmed: SRR7169812-trimmed-pair1.fastq, SRR7169812-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:40:08 2025 >> started Tue Feb 11 20:40:28 2025 >> done (19.711s) 19100611 read pairs processed; of these: 18414 ( 0.10%) short read pairs filtered out after trimming by size control 22260 ( 0.12%) empty read pairs filtered out after trimming by size control 19059937 (99.79%) read pairs available; of these: 9771941 (51.27%) trimmed read pairs available after processing 9287996 (48.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 7 0.00% 26 14 0.00% 27 9 0.00% 28 8 0.00% 29 13 0.00% 30 14 0.00% 31 17 0.00% 32 16 0.00% 33 12 0.00% 34 13 0.00% 35 18 0.00% 36 26 0.00% 37 30 0.00% 38 36 0.00% 39 55 0.00% 40 62 0.00% 41 79 0.00% 42 73 0.00% 43 85 0.00% 44 99 0.00% 45 114 0.00% 46 118 0.00% 47 134 0.00% 48 166 0.00% 49 187 0.00% 50 210 0.00% 51 270 0.00% 52 319 0.00% 53 333 0.00% 54 402 0.00% 55 435 0.00% 56 481 0.00% 57 517 0.00% 58 587 0.00% 59 645 0.00% 60 794 0.00% 61 960 0.01% 62 1081 0.01% 63 1258 0.01% 64 1417 0.01% 65 1499 0.01% 66 1604 0.01% 67 1873 0.01% 68 2058 0.01% 69 2370 0.01% 70 2799 0.01% 71 3235 0.02% 72 3645 0.02% 73 4126 0.02% 74 4708 0.02% 75 5188 0.03% 76 5871 0.03% 77 6274 0.03% 78 6665 0.03% 79 7401 0.04% 80 8153 0.04% 81 9246 0.05% 82 10570 0.06% 83 11704 0.06% 84 13460 0.07% 85 14925 0.08% 86 15450 0.08% 87 16962 0.09% 88 18091 0.09% 89 19086 0.10% 90 20213 0.11% 91 21328 0.11% 92 23012 0.12% 93 24874 0.13% 94 26506 0.14% 95 28234 0.15% 96 29304 0.15% 97 29666 0.16% 98 30941 0.16% 99 32406 0.17% 100 33481 0.18% 101 35126 0.18% 102 37344 0.20% 103 38872 0.20% 104 40745 0.21% 105 42355 0.22% 106 44013 0.23% 107 44461 0.23% 108 45777 0.24% 109 46228 0.24% 110 47615 0.25% 111 48821 0.26% 112 50738 0.27% 113 52868 0.28% 114 55017 0.29% 115 56647 0.30% 116 57914 0.30% 117 58751 0.31% 118 59379 0.31% 119 59650 0.31% 120 61365 0.32% 121 63195 0.33% 122 64643 0.34% 123 66483 0.35% 124 69875 0.37% 125 71978 0.38% 126 74064 0.39% 127 75027 0.39% 128 76587 0.40% 129 77330 0.41% 130 78512 0.41% 131 80546 0.42% 132 82743 0.43% 133 85809 0.45% 134 88487 0.46% 135 91594 0.48% 136 94961 0.50% 137 98389 0.52% 138 101935 0.53% 139 106388 0.56% 140 111867 0.59% 141 119566 0.63% 142 128957 0.68% 143 142690 0.75% 144 161623 0.85% 145 189706 1.00% 146 233371 1.22% 147 307526 1.61% 148 436763 2.29% 149 844542 4.43% 150 4055033 21.28% 151 9287996 48.73% 19059937 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.14 sequence-density-rank=8 fanout-score=73.31 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=15.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=42 prefix-density=0.24 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=49.19 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7169812 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:41:09 Started mapping on | Feb 11 20:41:09 Finished on | Feb 11 20:42:35 Mapping speed, Million of reads per hour | 797.86 Number of input reads | 19059937 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18321758 Uniquely mapped reads % | 96.13% Average mapped length | 289.03 Number of splices: Total | 16188331 Number of splices: Annotated (sjdb) | 15915815 Number of splices: GT/AG | 15964407 Number of splices: GC/AG | 177114 Number of splices: AT/AC | 12964 Number of splices: Non-canonical | 33846 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309122 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 68763 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446038 446038 446038 N_multimapping 309122 309122 309122 N_noFeature 474424 18080144 589536 N_ambiguous 194763 1144 67372 UnstrandedReadsAssigned:17652571 PositiveStrandReadsAssigned:240470 NegativeStrandReadsAssigned:17664850 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169812 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169812-trimmed-pair1.fastq SRR7169812-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,059,937 reads, 17,567,159 reads pseudoaligned [quant] estimated average fragment length: 212.865 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7169812.ke.tsv 34699 SRR7169812.se.tsv 87100 total ==> SRR7169812.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.13 231 7.82053 Potri.005G024800.1.v4.1 1035 823.135 53 3.93712 Potri.004G059700.1.v4.1 961 749.151 1 0.0816216 Potri.007G009000.2.v4.1 1416 1204.13 0 0 Potri.003G141000.2.v4.1 2943 2731.13 315.067 7.05397 Potri.016G087400.1.v4.1 270 94.3463 1557 1009.11 Potri.015G069301.1.v4.1 564 354.444 0 0 Potri.010G195200.1.v4.1 1773 1561.13 23 0.900869 Potri.012G127500.1.v4.1 977 765.14 5200 415.563 ==> SRR7169812.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1708 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169812 completed mapping pipeline successfully