Starting /dee2/code/volunteer_pipeline.sh SRR7169813 current disk space = 3053276069888 free memory = 1367941648 SRR7169813 SRAfilesize ef17246e182704e2710074aad4ca3b9b SRR7169813.sra SRR7169813.sra file validated SRR7169813 is paired end SRR7169813 is conventional basespace SRR7169813 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.62025 30.0 18.0 33.0 18.0 34.0 2 30.50475 31.0 29.0 33.0 27.0 34.0 3 31.8055 33.0 31.0 33.0 29.0 33.0 4 32.7375 33.0 33.0 33.0 31.0 34.0 5 33.2445 33.0 33.0 34.0 33.0 34.0 6 37.1955 38.0 37.0 38.0 36.0 38.0 7 37.56625 38.0 38.0 38.0 37.0 38.0 8 37.64375 38.0 38.0 38.0 38.0 38.0 9 37.7075 38.0 38.0 38.0 38.0 38.0 10-14 37.751400000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.738899999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.71079999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.6836 38.0 38.0 38.0 38.0 38.0 30-34 37.6125 38.0 38.0 38.0 38.0 38.0 35-39 37.4827 38.0 38.0 38.0 37.8 38.0 40-44 37.49455 38.0 38.0 38.0 37.8 38.0 45-49 37.48205 38.0 38.0 38.0 37.6 38.0 50-54 37.21675 38.0 38.0 38.0 36.6 38.0 55-59 37.4336 38.0 38.0 38.0 37.0 38.0 60-64 37.387 38.0 38.0 38.0 37.0 38.0 65-69 37.03555 38.0 38.0 38.0 36.0 38.0 70-74 37.22815 38.0 38.0 38.0 36.6 38.0 75-79 37.18535 38.0 38.0 38.0 36.0 38.0 80-84 36.99889999999999 38.0 38.0 38.0 35.6 38.0 85-89 36.82469999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.8507 38.0 38.0 38.0 35.0 38.0 95-99 36.8289 38.0 38.0 38.0 35.4 38.0 100-104 36.670100000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.488350000000004 38.0 37.8 38.0 34.4 38.0 110-114 36.26649999999999 38.0 38.0 38.0 34.0 38.0 115-119 35.54845 38.0 36.6 38.0 28.8 38.0 120-124 36.2096 38.0 37.4 38.0 34.0 38.0 125-129 35.15815 38.0 35.4 38.0 27.4 38.0 130-134 35.05415000000001 38.0 35.4 38.0 27.0 38.0 135-139 35.4451 38.0 36.0 38.0 30.4 38.0 140-144 34.888099999999994 38.0 35.2 38.0 28.6 38.0 145-149 34.39235000000001 38.0 35.0 38.0 27.2 38.0 150-151 30.754624999999997 36.5 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 4.0 18 0.0 19 2.0 20 4.0 21 2.0 22 5.0 23 5.0 24 2.0 25 4.0 26 9.0 27 11.0 28 11.0 29 20.0 30 24.0 31 39.0 32 59.0 33 92.0 34 132.0 35 307.0 36 878.0 37 2380.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.18604651162791 12.487360970677452 7.659251769464105 35.66734074823054 2 24.825 15.775 34.150000000000006 25.25 3 20.549999999999997 22.425 25.275 31.75 4 23.075000000000003 31.45 21.525 23.95 5 22.525000000000002 34.150000000000006 23.549999999999997 19.775000000000002 6 18.3 37.475 25.2 19.025 7 15.625 25.974999999999998 41.099999999999994 17.299999999999997 8 18.2 25.775 30.925000000000004 25.1 9 17.424999999999997 24.525 33.95 24.099999999999998 10-14 20.78 29.270000000000003 26.69 23.26 15-19 20.345 28.535 27.779999999999998 23.34 20-24 20.565 29.235 27.474999999999998 22.725 25-29 21.099999999999998 28.59 27.305 23.005 30-34 20.365 29.275000000000002 26.995 23.365 35-39 20.215 29.125 27.334999999999997 23.325000000000003 40-44 20.7 28.49 27.400000000000002 23.41 45-49 20.18 28.455000000000002 27.79 23.575 50-54 20.61 28.549999999999997 27.595 23.244999999999997 55-59 20.32 28.735 27.810000000000002 23.135 60-64 20.635 28.244999999999997 27.465 23.655 65-69 20.419999999999998 28.849999999999998 27.229999999999997 23.5 70-74 20.235 28.67 27.83 23.265 75-79 21.205 28.735 26.985 23.075000000000003 80-84 20.635 28.83 27.205000000000002 23.330000000000002 85-89 20.515 29.17 26.924999999999997 23.39 90-94 20.65 28.744999999999997 27.83 22.775000000000002 95-99 21.005 28.754999999999995 26.740000000000002 23.5 100-104 21.11 28.78 26.685 23.425 105-109 20.661033051652584 28.8064403220161 27.376368818440923 23.156157807890395 110-114 21.314440759722643 28.328811174756307 27.3741332529394 22.98261481258165 115-119 20.765 28.910000000000004 26.805 23.52 120-124 21.25 28.71 26.32 23.72 125-129 21.275 28.645 26.745 23.335 130-134 21.125 28.21 27.200000000000003 23.465 135-139 20.45 29.470000000000002 26.195 23.885 140-144 20.765 28.749999999999996 26.185000000000002 24.3 145-149 20.549999999999997 29.315 26.090000000000003 24.044999999999998 150-151 20.2375 28.7 26.55 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 2.5 21 3.0 22 2.0 23 2.0 24 2.5 25 2.5 26 2.0 27 6.0 28 10.5 29 14.5 30 22.5 31 30.5 32 30.0 33 33.0 34 44.0 35 60.0 36 85.0 37 100.0 38 123.5 39 154.0 40 196.5 41 228.0 42 235.5 43 248.5 44 272.0 45 270.0 46 266.5 47 279.0 48 238.5 49 206.5 50 174.5 51 137.5 52 122.5 53 106.5 54 83.0 55 57.5 56 43.5 57 25.5 58 20.0 59 16.0 60 8.5 61 7.5 62 5.0 63 3.5 64 2.5 65 2.5 66 2.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.49 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.1124999999999998 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.7375 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.525 0.0 0.0 0.0 0.0 106-107 4.1 0.0 0.0 0.0 0.0 108-109 4.6375 0.0 0.0 0.0 0.0 110-111 5.1375 0.0 0.0 0.0 0.0 112-113 5.575 0.0 0.0 0.0 0.0 114-115 6.075 0.0 0.0 0.0 0.0 116-117 6.5625 0.0 0.0 0.0 0.0 118-119 7.175000000000001 0.0 0.0 0.0 0.0 120-121 7.8375 0.0 0.0 0.0 0.0 122-123 8.4125 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.6375 0.0 0.0 0.0 0.0 128-129 10.175 0.0 0.0 0.0 0.0 130-131 10.8625 0.0 0.0 0.0 0.0 132-133 11.45 0.0 0.0 0.0 0.0 134-135 12.05 0.0 0.0 0.0 0.0 136-137 12.85 0.0 0.0 0.0 0.0 138-139 13.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTG 10 0.006843168 144.91249 7 >>END_MODULE SRR7169813 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169813_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88025 33.0 33.0 34.0 32.0 34.0 2 33.07225 33.0 33.0 34.0 33.0 34.0 3 32.20125 33.0 33.0 34.0 30.0 34.0 4 32.513 33.0 33.0 34.0 32.0 34.0 5 33.06325 33.0 33.0 34.0 32.0 34.0 6 37.402 38.0 38.0 38.0 37.0 38.0 7 37.511 38.0 38.0 38.0 38.0 38.0 8 37.4575 38.0 38.0 38.0 38.0 38.0 9 37.4875 38.0 38.0 38.0 38.0 38.0 10-14 37.484249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.49835 38.0 38.0 38.0 38.0 38.0 20-24 36.92575 38.0 37.8 38.0 35.4 38.0 25-29 37.3745 38.0 38.0 38.0 37.8 38.0 30-34 37.386250000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.35445 38.0 38.0 38.0 38.0 38.0 40-44 37.33475 38.0 38.0 38.0 37.2 38.0 45-49 37.3692 38.0 38.0 38.0 37.8 38.0 50-54 37.3022 38.0 38.0 38.0 37.2 38.0 55-59 37.2255 38.0 38.0 38.0 37.0 38.0 60-64 37.08965 38.0 38.0 38.0 36.6 38.0 65-69 37.057 38.0 38.0 38.0 36.8 38.0 70-74 37.0339 38.0 38.0 38.0 36.4 38.0 75-79 36.6645 38.0 38.0 38.0 36.0 38.0 80-84 36.28705 38.0 37.4 38.0 33.6 38.0 85-89 36.777300000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.9365 38.0 38.0 38.0 36.0 38.0 95-99 36.830149999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.61425 38.0 38.0 38.0 35.2 38.0 105-109 35.31915 38.0 36.8 38.0 28.4 38.0 110-114 34.928599999999996 38.0 37.0 38.0 29.0 38.0 115-119 34.272000000000006 38.0 36.8 38.0 24.0 38.0 120-124 34.03245 38.0 36.0 38.0 22.8 38.0 125-129 34.196 38.0 36.0 38.0 23.6 38.0 130-134 34.8327 38.0 36.0 38.0 26.6 38.0 135-139 35.01775 38.0 35.8 38.0 29.4 38.0 140-144 34.73165 38.0 35.8 38.0 28.0 38.0 145-149 33.95655 38.0 33.8 38.0 24.6 38.0 150-151 29.388375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 2.0 6 0.0 7 1.0 8 2.0 9 2.0 10 2.0 11 0.0 12 2.0 13 2.0 14 0.0 15 1.0 16 2.0 17 4.0 18 1.0 19 1.0 20 6.0 21 5.0 22 6.0 23 6.0 24 10.0 25 20.0 26 15.0 27 24.0 28 27.0 29 43.0 30 65.0 31 52.0 32 88.0 33 114.0 34 171.0 35 254.0 36 622.0 37 2444.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 19.8 13.25 28.325 2 26.825 25.75 30.825000000000003 16.6 3 19.675 28.95 30.2 21.175 4 22.15 34.300000000000004 24.275 19.275000000000002 5 24.075 35.825 22.975 17.125 6 20.724999999999998 37.65 22.8 18.825 7 18.375 21.725 40.050000000000004 19.85 8 21.325 25.45 27.125 26.1 9 22.0 25.324999999999996 30.5 22.175 10-14 22.875 28.384999999999998 26.845000000000002 21.895 15-19 23.365 27.705000000000002 28.185 20.745 20-24 22.595000000000002 28.110000000000003 28.32 20.974999999999998 25-29 23.175 27.694999999999997 28.205000000000002 20.925 30-34 23.135 27.76 28.115000000000002 20.990000000000002 35-39 22.869999999999997 27.794999999999998 28.134999999999998 21.2 40-44 23.285 28.205000000000002 27.87 20.64 45-49 23.375 27.71 28.055000000000003 20.86 50-54 23.06 27.73 28.59 20.62 55-59 23.375 27.35 28.03 21.245 60-64 22.735 27.889999999999997 28.999999999999996 20.375 65-69 23.375 27.839999999999996 28.025 20.76 70-74 23.810000000000002 27.62 28.165000000000003 20.405 75-79 23.125505254648342 27.51111560226354 28.491309620048504 20.872069523039613 80-84 22.969441093687173 27.90510655408122 28.16143948532368 20.96401286690792 85-89 23.265 27.82 28.310000000000002 20.605 90-94 23.189999999999998 27.685 28.515 20.61 95-99 23.48 27.534999999999997 28.4 20.585 100-104 24.053229276101856 27.660213117214465 27.81529841412777 20.471259192555905 105-109 24.124376354381898 28.055233583631505 27.117875321271985 20.70251474071461 110-114 24.159925326695706 27.546152250570422 27.888404895249945 20.405517527483923 115-119 25.5104199724955 27.536231884057973 27.50978525335872 19.443562890087804 120-124 24.94889669269878 27.003511714450447 28.08323287384035 19.96435871901043 125-129 25.113796892167635 27.6304086224036 27.478679432846754 19.777115052582012 130-134 25.471173765853166 27.305340811479965 26.891011065635894 20.332474357030975 135-139 24.7 27.445000000000004 27.785 20.07 140-144 26.029999999999998 27.98 26.625 19.365 145-149 25.759999999999998 27.845 27.005000000000003 19.39 150-151 25.5375 27.450000000000003 27.125 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 4.5 27 7.0 28 7.0 29 10.0 30 14.5 31 15.5 32 22.0 33 38.5 34 51.0 35 59.5 36 81.0 37 101.5 38 129.5 39 177.5 40 211.5 41 240.0 42 264.0 43 279.5 44 278.0 45 262.0 46 262.5 47 264.5 48 250.5 49 207.5 50 169.0 51 148.0 52 125.5 53 94.5 54 63.5 55 43.0 56 29.5 57 22.0 58 15.0 59 11.5 60 8.0 61 9.0 62 7.5 63 3.5 64 2.0 65 1.0 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 1.04 80-84 0.52 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.7849999999999999 110-114 3.58 115-119 5.47 120-124 4.605 125-129 4.4350000000000005 130-134 1.045 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.0499999999999998 0.0 0.0 0.0 0.0 92-93 1.2 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.3125 0.0 0.0 0.0 0.0 100-101 2.4875 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.2874999999999996 0.0 0.0 0.0 0.0 106-107 3.775 0.0 0.0 0.0 0.0 108-109 4.225 0.0 0.0 0.0 0.0 110-111 4.6625 0.0 0.0 0.0 0.0 112-113 5.0875 0.0 0.0 0.0 0.0 114-115 5.5625 0.0 0.0 0.0 0.0 116-117 6.074999999999999 0.0 0.0 0.0 0.0 118-119 6.6625 0.0 0.0 0.0 0.0 120-121 7.3375 0.0 0.0 0.0 0.0 122-123 7.925 0.0 0.0 0.0 0.0 124-125 8.5375 0.0 0.0 0.0 0.0 126-127 9.0625 0.0 0.0 0.0 0.0 128-129 9.575 0.0 0.0 0.0 0.0 130-131 10.175 0.0 0.0 0.0 0.0 132-133 10.8125 0.0 0.0 0.0 0.0 134-135 11.399999999999999 0.0 0.0 0.0 0.0 136-137 12.2 0.0 0.0 0.0 0.0 138-139 12.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra Read 722093 spots for SRR7169813.sra Written 722093 spots for SRR7169813.sra Read 722086 spots for SRR7169813.sra Written 722086 spots for SRR7169813.sra SRR ids: ['SRR7169813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mdb2d800 SRR7169813.sra spots: 14441727 blocks: [[1, 722086], [722087, 1444172], [1444173, 2166258], [2166259, 2888344], [2888345, 3610430], [3610431, 4332516], [4332517, 5054602], [5054603, 5776688], [5776689, 6498774], [6498775, 7220860], [7220861, 7942946], [7942947, 8665032], [8665033, 9387118], [9387119, 10109204], [10109205, 10831290], [10831291, 11553376], [11553377, 12275462], [12275463, 12997548], [12997549, 13719634], [13719635, 14441727]] SRR7169813 file size 4872127 SRR7169813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169813 SRR7169813_1.fastq SRR7169813_2.fastq Input file: SRR7169813_1.fastq Paired file: SRR7169813_2.fastq trimmed: SRR7169813-trimmed-pair1.fastq, SRR7169813-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:59:15 2025 >> started Tue Feb 11 19:59:31 2025 >> done (16.436s) 14441727 read pairs processed; of these: 6707 ( 0.05%) short read pairs filtered out after trimming by size control 7762 ( 0.05%) empty read pairs filtered out after trimming by size control 14427258 (99.90%) read pairs available; of these: 7285996 (50.50%) trimmed read pairs available after processing 7141262 (49.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 8 0.00% 23 4 0.00% 24 4 0.00% 25 4 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 7 0.00% 30 6 0.00% 31 16 0.00% 32 15 0.00% 33 7 0.00% 34 14 0.00% 35 12 0.00% 36 19 0.00% 37 25 0.00% 38 30 0.00% 39 40 0.00% 40 48 0.00% 41 47 0.00% 42 59 0.00% 43 58 0.00% 44 70 0.00% 45 63 0.00% 46 91 0.00% 47 92 0.00% 48 110 0.00% 49 151 0.00% 50 171 0.00% 51 228 0.00% 52 231 0.00% 53 247 0.00% 54 262 0.00% 55 301 0.00% 56 339 0.00% 57 375 0.00% 58 398 0.00% 59 490 0.00% 60 594 0.00% 61 723 0.01% 62 836 0.01% 63 951 0.01% 64 996 0.01% 65 1113 0.01% 66 1220 0.01% 67 1345 0.01% 68 1482 0.01% 69 1698 0.01% 70 2077 0.01% 71 2484 0.02% 72 2765 0.02% 73 3208 0.02% 74 3537 0.02% 75 3711 0.03% 76 4213 0.03% 77 4508 0.03% 78 4922 0.03% 79 5343 0.04% 80 6053 0.04% 81 6935 0.05% 82 7912 0.05% 83 8698 0.06% 84 10086 0.07% 85 11130 0.08% 86 11451 0.08% 87 12193 0.08% 88 13118 0.09% 89 13791 0.10% 90 14713 0.10% 91 16197 0.11% 92 17407 0.12% 93 19437 0.13% 94 21145 0.15% 95 22050 0.15% 96 22977 0.16% 97 23322 0.16% 98 23913 0.17% 99 25016 0.17% 100 26099 0.18% 101 27287 0.19% 102 29492 0.20% 103 31257 0.22% 104 32979 0.23% 105 34675 0.24% 106 35394 0.25% 107 35837 0.25% 108 36155 0.25% 109 36756 0.25% 110 37865 0.26% 111 39234 0.27% 112 40945 0.28% 113 42287 0.29% 114 44335 0.31% 115 46322 0.32% 116 46632 0.32% 117 46949 0.33% 118 47561 0.33% 119 47567 0.33% 120 48202 0.33% 121 49850 0.35% 122 51196 0.35% 123 53208 0.37% 124 55177 0.38% 125 57262 0.40% 126 58106 0.40% 127 59291 0.41% 128 59770 0.41% 129 60833 0.42% 130 60790 0.42% 131 61977 0.43% 132 63739 0.44% 133 65777 0.46% 134 68268 0.47% 135 70741 0.49% 136 73891 0.51% 137 75524 0.52% 138 77427 0.54% 139 79954 0.55% 140 82357 0.57% 141 88866 0.62% 142 95090 0.66% 143 100883 0.70% 144 114559 0.79% 145 131991 0.91% 146 156511 1.08% 147 207969 1.44% 148 299854 2.08% 149 584216 4.05% 150 3047755 21.12% 151 7141262 49.50% 14427258 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=96.48 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.3 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=212.41 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=24.8 sequence=GAAGAAGAAGAAA SRR7169813 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:00:19 Started mapping on | Feb 11 20:00:19 Finished on | Feb 11 20:01:28 Mapping speed, Million of reads per hour | 752.73 Number of input reads | 14427258 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13861731 Uniquely mapped reads % | 96.08% Average mapped length | 288.75 Number of splices: Total | 12463052 Number of splices: Annotated (sjdb) | 12238854 Number of splices: GT/AG | 12281625 Number of splices: GC/AG | 143063 Number of splices: AT/AC | 10734 Number of splices: Non-canonical | 27630 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262051 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 24307 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 310602 310602 310602 N_multimapping 262051 262051 262051 N_noFeature 397309 13671987 500309 N_ambiguous 140660 819 53345 UnstrandedReadsAssigned:13323762 PositiveStrandReadsAssigned:188925 NegativeStrandReadsAssigned:13308077 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169813 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169813-trimmed-pair1.fastq SRR7169813-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,427,258 reads, 13,226,838 reads pseudoaligned [quant] estimated average fragment length: 210.399 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7169813.ke.tsv 34699 SRR7169813.se.tsv 87100 total ==> SRR7169813.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.6 229 10.4669 Potri.005G024800.1.v4.1 1035 825.601 33 3.30422 Potri.004G059700.1.v4.1 961 751.614 2 0.219969 Potri.007G009000.2.v4.1 1416 1206.6 0 0 Potri.003G141000.2.v4.1 2943 2733.6 210.028 6.35135 Potri.016G087400.1.v4.1 270 95.3026 1374 1191.81 Potri.015G069301.1.v4.1 564 356.825 0 0 Potri.010G195200.1.v4.1 1773 1563.6 9 0.475819 Potri.012G127500.1.v4.1 977 767.607 4656 501.417 ==> SRR7169813.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1297 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169813 completed mapping pipeline successfully