Starting /dee2/code/volunteer_pipeline.sh SRR7169814 current disk space = 3053167890432 free memory = 1476442220 SRR7169814 SRAfilesize 7263205a5c7c6f5a2724380cac2896ea SRR7169814.sra SRR7169814.sra file validated SRR7169814 is paired end SRR7169814 is conventional basespace SRR7169814 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0095 28.0 18.0 32.0 18.0 33.0 2 30.2605 32.0 30.0 33.0 25.0 33.0 3 31.93525 33.0 31.0 33.0 29.0 33.0 4 32.1535 33.0 33.0 33.0 31.0 34.0 5 32.8515 33.0 33.0 34.0 32.0 34.0 6 36.87675 38.0 37.0 38.0 35.0 38.0 7 37.35825 38.0 38.0 38.0 37.0 38.0 8 37.383 38.0 38.0 38.0 37.0 38.0 9 37.52575 38.0 38.0 38.0 38.0 38.0 10-14 37.5629 38.0 38.0 38.0 38.0 38.0 15-19 37.555 38.0 38.0 38.0 38.0 38.0 20-24 37.5463 38.0 38.0 38.0 38.0 38.0 25-29 37.58545 38.0 38.0 38.0 38.0 38.0 30-34 37.550599999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.53275 38.0 38.0 38.0 38.0 38.0 40-44 37.4743 38.0 38.0 38.0 37.4 38.0 45-49 37.48215 38.0 38.0 38.0 38.0 38.0 50-54 37.40315 38.0 38.0 38.0 37.0 38.0 55-59 37.284400000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.1666 38.0 38.0 38.0 36.4 38.0 65-69 37.24225 38.0 38.0 38.0 36.8 38.0 70-74 37.2947 38.0 38.0 38.0 37.0 38.0 75-79 37.1302 38.0 38.0 38.0 36.4 38.0 80-84 37.100649999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.9893 38.0 38.0 38.0 35.8 38.0 90-94 36.9833 38.0 38.0 38.0 35.8 38.0 95-99 36.9744 38.0 38.0 38.0 36.0 38.0 100-104 36.799 38.0 38.0 38.0 35.2 38.0 105-109 36.5826 38.0 38.0 38.0 34.6 38.0 110-114 36.41225 38.0 38.0 38.0 34.0 38.0 115-119 36.362849999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.333549999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.2363 38.0 38.0 38.0 34.0 38.0 130-134 35.99485 38.0 37.2 38.0 33.0 38.0 135-139 35.60935 38.0 36.2 38.0 31.8 38.0 140-144 35.263349999999996 38.0 36.0 38.0 31.0 38.0 145-149 35.110699999999994 38.0 36.0 38.0 31.0 38.0 150-151 31.689249999999998 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 3.0 18 0.0 19 4.0 20 2.0 21 5.0 22 5.0 23 7.0 24 5.0 25 6.0 26 12.0 27 17.0 28 20.0 29 19.0 30 22.0 31 41.0 32 66.0 33 71.0 34 97.0 35 244.0 36 597.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.98073555166375 11.133350012509382 9.231923942957218 38.65399049286965 2 22.3 15.049999999999999 34.475 28.175 3 20.775 21.099999999999998 26.125 32.0 4 22.575 28.825 23.35 25.25 5 22.425 33.900000000000006 24.025 19.650000000000002 6 19.5 35.875 25.2 19.425 7 13.625000000000002 25.35 43.125 17.9 8 18.1476846057572 25.15644555694618 31.264080100125156 25.431789737171464 9 18.325 24.9 32.85 23.925 10-14 20.155 30.080000000000002 26.935 22.830000000000002 15-19 20.275000000000002 28.9 27.43 23.395 20-24 20.075000000000003 29.349999999999998 27.36 23.215 25-29 20.03 28.63 27.715 23.625 30-34 20.395 28.705000000000002 27.275 23.625 35-39 20.195 29.549999999999997 26.86 23.395 40-44 19.735 28.92 27.74 23.605 45-49 20.36 28.660000000000004 27.334999999999997 23.645 50-54 19.82599129956498 28.87644382219111 27.366368318415923 23.931196559827992 55-59 20.445 29.255 26.87 23.43 60-64 20.04 28.9 27.655 23.405 65-69 19.994999999999997 29.160000000000004 26.96 23.885 70-74 20.18 28.685 27.595 23.54 75-79 20.06 28.605000000000004 27.265 24.07 80-84 20.22 29.104999999999997 27.295 23.380000000000003 85-89 20.71 28.665000000000003 26.935 23.69 90-94 20.8010400520026 29.001450072503626 26.996349817490874 23.201160058002902 95-99 20.125 29.815 26.88 23.18 100-104 20.901045052252613 28.911445572278616 26.72633631681584 23.461173058652932 105-109 20.83082480433474 28.908288179811358 26.735902067027894 23.52498494882601 110-114 21.052895966243028 29.20580700256191 26.854875169538357 22.886421861656704 115-119 20.838125718857828 28.954343151472724 26.618992848927338 23.58853828074211 120-124 20.9 28.860000000000003 26.805 23.435 125-129 21.332133213321335 28.722872287228725 26.552655265526553 23.392339233923394 130-134 21.229245849169835 28.755751150230047 26.690338067613524 23.324664932986597 135-139 21.024204840968196 28.385677135427084 26.74534906981396 23.84476895379076 140-144 21.11844737895158 28.371348539415763 26.895758303321326 23.614445778311325 145-149 20.630000000000003 28.555000000000003 26.93 23.885 150-151 21.374906085649886 27.38542449286251 26.496368645128975 24.74330077635863 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 1.5 22 1.5 23 3.0 24 4.5 25 6.0 26 5.0 27 6.5 28 7.0 29 12.5 30 21.5 31 28.0 32 34.5 33 38.0 34 45.5 35 63.0 36 85.5 37 103.0 38 134.5 39 151.5 40 168.0 41 212.0 42 248.5 43 255.5 44 257.0 45 271.5 46 278.5 47 277.5 48 271.5 49 234.0 50 170.5 51 143.5 52 123.5 53 92.5 54 74.5 55 51.5 56 32.0 57 23.5 58 14.0 59 11.0 60 8.0 61 5.5 62 5.5 63 3.5 64 3.5 65 1.5 66 1.5 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.125 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.005 105-109 0.33999999999999997 110-114 0.46499999999999997 115-119 0.015 120-124 0.0 125-129 0.01 130-134 0.02 135-139 0.02 140-144 0.04 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09159727479182 98.175 2 0.8831693161746152 1.7500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.4875 0.0 0.0 0.0 0.0 96-97 1.7000000000000002 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.65 0.0 0.0 0.0 0.0 104-105 3.0 0.0 0.0 0.0 0.0 106-107 3.2375 0.0 0.0 0.0 0.0 108-109 3.4124999999999996 0.0 0.0 0.0 0.0 110-111 3.925 0.0 0.0 0.0 0.0 112-113 4.387499999999999 0.0 0.0 0.0 0.0 114-115 4.800000000000001 0.0 0.0 0.0 0.0 116-117 5.2875 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.3625 0.0 0.0 0.0 0.0 122-123 6.975 0.0 0.0 0.0 0.0 124-125 7.612500000000001 0.0 0.0 0.0 0.0 126-127 8.2375 0.0 0.0 0.0 0.0 128-129 8.8125 0.0 0.0 0.0 0.0 130-131 9.325 0.0 0.0 0.0 0.0 132-133 9.875 0.0 0.0 0.0 0.0 134-135 10.6625 0.0 0.0 0.0 0.0 136-137 11.25 0.0 0.0 0.0 0.0 138-139 12.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 60 2.2865267E-4 16.902084 35-39 >>END_MODULE SRR7169814 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169814_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.863 33.0 33.0 34.0 32.0 34.0 2 32.9875 34.0 33.0 34.0 32.0 34.0 3 33.08225 34.0 33.0 34.0 32.0 34.0 4 33.09875 34.0 33.0 34.0 33.0 34.0 5 32.979 34.0 33.0 34.0 32.0 34.0 6 37.23175 38.0 38.0 38.0 37.0 38.0 7 37.211 38.0 38.0 38.0 37.0 38.0 8 37.1715 38.0 38.0 38.0 37.0 38.0 9 37.21 38.0 38.0 38.0 37.0 38.0 10-14 37.1154 38.0 38.0 38.0 36.8 38.0 15-19 37.1138 38.0 38.0 38.0 37.0 38.0 20-24 37.06399999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.0496 38.0 38.0 38.0 36.6 38.0 30-34 36.91955 38.0 38.0 38.0 36.2 38.0 35-39 36.86925 38.0 38.0 38.0 35.8 38.0 40-44 36.83565 38.0 38.0 38.0 35.8 38.0 45-49 36.839749999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.53385 38.0 38.0 38.0 34.6 38.0 55-59 36.37455 38.0 37.8 38.0 34.0 38.0 60-64 36.68339999999999 38.0 38.0 38.0 35.2 38.0 65-69 36.9281 38.0 38.0 38.0 36.0 38.0 70-74 36.5827 38.0 38.0 38.0 35.2 38.0 75-79 35.794 38.0 38.0 38.0 33.4 38.0 80-84 36.267250000000004 38.0 38.0 38.0 33.4 38.0 85-89 36.49925 38.0 38.0 38.0 34.6 38.0 90-94 36.4983 38.0 38.0 38.0 35.0 38.0 95-99 36.362350000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.0049 38.0 37.8 38.0 33.6 38.0 105-109 35.27265 38.0 37.4 38.0 30.2 38.0 110-114 33.71275 38.0 35.4 38.0 19.8 38.0 115-119 33.5453 38.0 36.0 38.0 15.0 38.0 120-124 33.73245 38.0 36.0 38.0 19.8 38.0 125-129 33.98295 38.0 36.0 38.0 21.0 38.0 130-134 34.56555 38.0 35.4 38.0 26.0 38.0 135-139 34.12935 38.0 35.0 38.0 23.0 38.0 140-144 33.25835 38.0 33.8 38.0 20.0 38.0 145-149 33.1686 38.0 33.0 38.0 19.4 38.0 150-151 28.638875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 2.0 5 2.0 6 2.0 7 0.0 8 2.0 9 0.0 10 1.0 11 2.0 12 0.0 13 2.0 14 2.0 15 1.0 16 7.0 17 6.0 18 8.0 19 8.0 20 7.0 21 8.0 22 16.0 23 23.0 24 14.0 25 22.0 26 19.0 27 26.0 28 52.0 29 66.0 30 65.0 31 91.0 32 86.0 33 136.0 34 172.0 35 277.0 36 577.0 37 2289.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.4 19.7 15.825 28.075 2 26.1 25.75 31.275 16.875 3 20.925 28.449999999999996 30.675 19.950000000000003 4 23.305826456614152 34.55863965991498 23.605901475368842 18.529632408102024 5 23.92991239048811 36.09511889862328 22.5531914893617 17.421777221526906 6 20.345345345345343 37.61261261261261 23.6986986986987 18.343343343343342 7 18.9 21.349999999999998 40.300000000000004 19.45 8 21.530382595648913 23.85596399099775 28.132033008252062 26.481620405101275 9 21.475 24.875 29.849999999999998 23.799999999999997 10-14 23.308496274441165 28.73431014652198 26.483972595889384 21.473220983147474 15-19 23.398718975180145 27.75220176140913 28.202562049639713 20.646517213771016 20-24 22.805085594153567 27.7705476023626 27.94073480828912 21.483631995194713 25-29 22.631973980485366 28.331248436327243 28.36627470602952 20.67050287715787 30-34 22.61600840967112 28.462732141963258 27.721880162186512 21.199379286179106 35-39 22.89247096515819 27.943532238686426 28.003604325190228 21.16039247096516 40-44 23.45641949364555 28.064645251676172 28.299809866906834 20.17912538777144 45-49 23.509088177857894 27.459816734264685 28.27600020029042 20.755094887587 50-54 22.629601803155523 27.70348109191084 28.800400701227147 20.866516403706488 55-59 23.399458972046887 27.25177837891995 28.67448151487827 20.674281134154896 60-64 23.096561045201984 27.937127696851377 28.647945136907442 20.318366121039194 65-69 23.074613421408195 27.788620327278185 28.684381724465798 20.45238452684782 70-74 23.35479975850272 28.09418394043067 27.84765546387603 20.703360837190584 75-79 23.385072486040674 27.764971056810616 28.20552225808104 20.64443419906767 80-84 23.39354903638102 27.95249836461531 28.27454335027424 20.379409248729434 85-89 23.510265398097147 27.611417125688533 28.683024536805206 20.19529293940911 90-94 23.94373247897477 27.38285943131758 28.359030837004408 20.314377252703245 95-99 23.626896310018523 27.947729434736896 27.82756721574125 20.59780703950333 100-104 23.965948923385078 27.250876314471707 28.427641462193293 20.355533299949926 105-109 24.22185937340545 26.778242677824267 28.365139299928565 20.634758648841718 110-114 24.187365436118256 27.963031035025992 27.984036128761225 19.865567400094523 115-119 25.102836689994124 27.20230781558844 28.05705432982531 19.637801164592126 120-124 25.023656818420775 27.031857848806645 27.95184523183682 19.99264010093576 125-129 24.739001714018592 27.66322131615852 27.29444761855295 20.303329351269934 130-134 24.97737556561086 27.551533433886377 27.7526395173454 19.718451483157367 135-139 25.045045045045043 28.06806806806807 27.562562562562565 19.324324324324323 140-144 25.36177457313104 27.650092634319762 27.44980221320915 19.538330579340045 145-149 26.340291335035293 27.546678680482557 27.306402362717126 18.806627621765028 150-151 26.123419702090374 26.57403930404306 28.02603579922393 19.276505194642635 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 3.0 26 4.5 27 5.0 28 7.0 29 12.0 30 15.5 31 20.5 32 28.0 33 32.0 34 47.5 35 77.0 36 90.5 37 106.0 38 136.0 39 161.0 40 194.5 41 236.5 42 276.0 43 277.5 44 273.5 45 278.5 46 276.5 47 269.5 48 240.0 49 207.0 50 165.5 51 136.5 52 117.0 53 89.5 54 61.0 55 35.5 56 24.0 57 20.5 58 17.0 59 13.0 60 9.0 61 5.0 62 5.5 63 4.5 64 1.5 65 3.0 66 2.0 67 1.0 68 2.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.125 6 0.1 7 0.0 8 0.025 9 0.0 10-14 0.015 15-19 0.08 20-24 0.11 25-29 0.075 30-34 0.11499999999999999 35-39 0.12 40-44 0.06999999999999999 45-49 0.145 50-54 0.17500000000000002 55-59 0.19 60-64 0.11499999999999999 65-69 0.08499999999999999 70-74 0.62 75-79 2.395 80-84 0.635 85-89 0.15 90-94 0.12 95-99 0.135 100-104 0.15 105-109 2.01 110-114 4.784999999999999 115-119 6.404999999999999 120-124 4.89 125-129 3.7350000000000003 130-134 0.5499999999999999 135-139 0.1 140-144 0.145 145-149 0.11499999999999999 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.4875 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.3125 0.0 0.0 0.0 0.0 110-111 3.8 0.0 0.0 0.0 0.0 112-113 4.25 0.0 0.0 0.0 0.0 114-115 4.6375 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.7125 0.0 0.0 0.0 0.0 120-121 6.2125 0.0 0.0 0.0 0.0 122-123 6.8 0.0 0.0 0.0 0.0 124-125 7.375 0.0 0.0 0.0 0.0 126-127 7.9624999999999995 0.0 0.0 0.0 0.0 128-129 8.5375 0.0 0.0 0.0 0.0 130-131 9.0 0.0 0.0 0.0 0.0 132-133 9.525 0.0 0.0 0.0 0.0 134-135 10.2875 0.0 0.0 0.0 0.0 136-137 10.875 0.0 0.0 0.0 0.0 138-139 11.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra Read 597715 spots for SRR7169814.sra Written 597715 spots for SRR7169814.sra Read 597703 spots for SRR7169814.sra Written 597703 spots for SRR7169814.sra SRR ids: ['SRR7169814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i65akt4y SRR7169814.sra spots: 11954072 blocks: [[1, 597703], [597704, 1195406], [1195407, 1793109], [1793110, 2390812], [2390813, 2988515], [2988516, 3586218], [3586219, 4183921], [4183922, 4781624], [4781625, 5379327], [5379328, 5977030], [5977031, 6574733], [6574734, 7172436], [7172437, 7770139], [7770140, 8367842], [8367843, 8965545], [8965546, 9563248], [9563249, 10160951], [10160952, 10758654], [10758655, 11356357], [11356358, 11954072]] SRR7169814 file size 4029142 SRR7169814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169814 SRR7169814_1.fastq SRR7169814_2.fastq Input file: SRR7169814_1.fastq Paired file: SRR7169814_2.fastq trimmed: SRR7169814-trimmed-pair1.fastq, SRR7169814-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:16:31 2025 >> started Tue Feb 11 20:16:49 2025 >> done (17.555s) 11954072 read pairs processed; of these: 13127 ( 0.11%) short read pairs filtered out after trimming by size control 11775 ( 0.10%) empty read pairs filtered out after trimming by size control 11929170 (99.79%) read pairs available; of these: 5606686 (47.00%) trimmed read pairs available after processing 6322484 (53.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 8 0.00% 32 9 0.00% 33 8 0.00% 34 12 0.00% 35 14 0.00% 36 22 0.00% 37 16 0.00% 38 28 0.00% 39 25 0.00% 40 34 0.00% 41 41 0.00% 42 43 0.00% 43 57 0.00% 44 46 0.00% 45 62 0.00% 46 67 0.00% 47 85 0.00% 48 101 0.00% 49 127 0.00% 50 150 0.00% 51 156 0.00% 52 171 0.00% 53 188 0.00% 54 232 0.00% 55 241 0.00% 56 280 0.00% 57 318 0.00% 58 324 0.00% 59 414 0.00% 60 490 0.00% 61 564 0.00% 62 656 0.01% 63 755 0.01% 64 818 0.01% 65 829 0.01% 66 943 0.01% 67 1141 0.01% 68 1211 0.01% 69 1362 0.01% 70 1556 0.01% 71 1817 0.02% 72 2248 0.02% 73 2460 0.02% 74 2666 0.02% 75 2923 0.02% 76 3252 0.03% 77 3504 0.03% 78 3787 0.03% 79 4296 0.04% 80 4581 0.04% 81 5224 0.04% 82 5950 0.05% 83 6949 0.06% 84 7877 0.07% 85 8766 0.07% 86 9219 0.08% 87 9591 0.08% 88 10161 0.09% 89 10550 0.09% 90 11186 0.09% 91 11951 0.10% 92 12993 0.11% 93 14249 0.12% 94 15414 0.13% 95 16166 0.14% 96 17048 0.14% 97 17088 0.14% 98 17899 0.15% 99 18313 0.15% 100 19161 0.16% 101 19779 0.17% 102 21401 0.18% 103 22341 0.19% 104 23483 0.20% 105 24916 0.21% 106 25790 0.22% 107 25743 0.22% 108 26400 0.22% 109 26772 0.22% 110 27153 0.23% 111 28582 0.24% 112 29360 0.25% 113 30640 0.26% 114 31590 0.26% 115 33256 0.28% 116 33541 0.28% 117 34363 0.29% 118 34450 0.29% 119 34685 0.29% 120 35504 0.30% 121 36179 0.30% 122 37365 0.31% 123 38835 0.33% 124 39985 0.34% 125 41161 0.35% 126 43392 0.36% 127 44063 0.37% 128 44249 0.37% 129 45278 0.38% 130 46054 0.39% 131 46689 0.39% 132 47571 0.40% 133 49770 0.42% 134 50828 0.43% 135 52968 0.44% 136 54548 0.46% 137 57214 0.48% 138 59407 0.50% 139 62356 0.52% 140 65868 0.55% 141 69018 0.58% 142 73186 0.61% 143 79722 0.67% 144 90063 0.75% 145 103061 0.86% 146 122444 1.03% 147 159087 1.33% 148 228094 1.91% 149 430341 3.61% 150 2427200 20.35% 151 6322484 53.00% 11929170 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=70.92 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=16.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.17 fanout-score-rank=8 prefix-density=0.28 prefix-fanout=4.3 sequence=CAGTTTGTTGACTGGTGCCC criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=46.68 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7169814 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:17:29 Started mapping on | Feb 11 20:17:29 Finished on | Feb 11 20:18:27 Mapping speed, Million of reads per hour | 740.43 Number of input reads | 11929170 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11514485 Uniquely mapped reads % | 96.52% Average mapped length | 289.98 Number of splices: Total | 10475582 Number of splices: Annotated (sjdb) | 10293070 Number of splices: GT/AG | 10322711 Number of splices: GC/AG | 118377 Number of splices: AT/AC | 8623 Number of splices: Non-canonical | 25871 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196063 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 7842 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 228217 228217 228217 N_multimapping 196063 196063 196063 N_noFeature 317438 11384062 378541 N_ambiguous 115047 497 45418 UnstrandedReadsAssigned:11082000 PositiveStrandReadsAssigned:129926 NegativeStrandReadsAssigned:11090526 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169814 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169814-trimmed-pair1.fastq SRR7169814-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,929,170 reads, 11,002,120 reads pseudoaligned [quant] estimated average fragment length: 215.108 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7169814.ke.tsv 34699 SRR7169814.se.tsv 87100 total ==> SRR7169814.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.89 185 10.6268 Potri.005G024800.1.v4.1 1035 820.892 27 3.40816 Potri.004G059700.1.v4.1 961 746.897 1 0.138734 Potri.007G009000.2.v4.1 1416 1201.89 0 0 Potri.003G141000.2.v4.1 2943 2728.89 269.076 10.2172 Potri.016G087400.1.v4.1 270 92.2664 971 1090.48 Potri.015G069301.1.v4.1 564 352.135 0 0 Potri.010G195200.1.v4.1 1773 1558.89 13 0.864111 Potri.012G127500.1.v4.1 977 762.897 3098 420.782 ==> SRR7169814.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1061 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1182 Potri.001G452600.v4.1 2 SRR7169814 completed mapping pipeline successfully