Starting /dee2/code/volunteer_pipeline.sh SRR7169815 current disk space = 3052894662656 free memory = 1485984024 SRR7169815 SRAfilesize 4caf62216b0fbe678a3773e8396e83ee SRR7169815.sra SRR7169815.sra file validated SRR7169815 is paired end SRR7169815 is conventional basespace SRR7169815 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.61625 32.0 31.0 33.0 25.0 34.0 2 29.0425 31.0 28.0 33.0 18.0 33.0 3 31.02725 33.0 31.0 33.0 28.0 33.0 4 32.22025 33.0 33.0 33.0 31.0 33.0 5 32.7705 33.0 33.0 33.0 32.0 34.0 6 36.7775 38.0 37.0 38.0 35.0 38.0 7 37.03475 38.0 38.0 38.0 35.0 38.0 8 37.42325 38.0 38.0 38.0 37.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.6268 38.0 38.0 38.0 38.0 38.0 15-19 37.68945 38.0 38.0 38.0 38.0 38.0 20-24 37.7118 38.0 38.0 38.0 38.0 38.0 25-29 37.7103 38.0 38.0 38.0 38.0 38.0 30-34 37.66105 38.0 38.0 38.0 38.0 38.0 35-39 37.6374 38.0 38.0 38.0 38.0 38.0 40-44 37.574799999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.57275 38.0 38.0 38.0 38.0 38.0 50-54 37.4996 38.0 38.0 38.0 37.8 38.0 55-59 37.5587 38.0 38.0 38.0 38.0 38.0 60-64 37.45 38.0 38.0 38.0 38.0 38.0 65-69 37.44385 38.0 38.0 38.0 37.4 38.0 70-74 37.39495 38.0 38.0 38.0 37.2 38.0 75-79 37.258599999999994 38.0 38.0 38.0 37.0 38.0 80-84 37.136 38.0 38.0 38.0 37.0 38.0 85-89 37.06335 38.0 38.0 38.0 36.8 38.0 90-94 36.978899999999996 38.0 38.0 38.0 36.4 38.0 95-99 36.974450000000004 38.0 38.0 38.0 36.4 38.0 100-104 36.907349999999994 38.0 38.0 38.0 36.0 38.0 105-109 36.4447 38.0 38.0 38.0 35.4 38.0 110-114 36.3726 38.0 38.0 38.0 35.0 38.0 115-119 36.61385 38.0 38.0 38.0 35.0 38.0 120-124 36.540949999999995 38.0 38.0 38.0 35.0 38.0 125-129 36.36135 38.0 38.0 38.0 34.2 38.0 130-134 36.161699999999996 38.0 38.0 38.0 34.0 38.0 135-139 35.9798 38.0 37.8 38.0 33.4 38.0 140-144 35.55885 38.0 36.2 38.0 32.2 38.0 145-149 35.2611 38.0 36.0 38.0 31.4 38.0 150-151 32.079625 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 5.0 19 20.0 20 1.0 21 2.0 22 3.0 23 5.0 24 4.0 25 2.0 26 3.0 27 16.0 28 8.0 29 20.0 30 23.0 31 33.0 32 31.0 33 44.0 34 114.0 35 194.0 36 489.0 37 2974.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.822734101151728 10.340510766149222 13.99599399098648 43.84076114171257 2 21.425 14.000000000000002 33.875 30.7 3 21.4 17.075000000000003 25.05 36.475 4 22.4974974974975 25.875875875875877 22.24724724724725 29.37937937937938 5 23.1 32.800000000000004 24.0 20.1 6 19.950000000000003 36.425000000000004 23.1 20.525 7 14.475 26.775 41.025 17.724999999999998 8 18.475 27.400000000000002 30.65 23.474999999999998 9 17.349999999999998 25.324999999999996 33.5 23.825 10-14 19.54 30.904999999999998 27.04 22.515 15-19 19.15 29.304999999999996 28.244999999999997 23.3 20-24 19.509999999999998 29.39 27.88 23.22 25-29 19.8 29.7 26.834999999999997 23.665 30-34 20.15201520152015 29.067906790679064 27.04770477047705 23.73237323732373 35-39 19.96 28.895 27.515 23.630000000000003 40-44 19.950000000000003 29.07 27.555000000000003 23.425 45-49 19.485 28.01 28.1 24.404999999999998 50-54 20.075000000000003 28.27 27.529999999999998 24.125 55-59 19.755 28.860000000000003 27.245 24.14 60-64 20.078128912705964 28.847598537587015 27.320078128912705 23.75419442079431 65-69 19.8 29.354999999999997 26.605 24.240000000000002 70-74 20.455000000000002 29.354999999999997 27.05 23.14 75-79 19.91 28.689999999999998 26.985 24.415 80-84 19.965 29.044999999999998 27.16 23.830000000000002 85-89 20.39 29.020000000000003 26.740000000000002 23.849999999999998 90-94 20.244999999999997 28.78 27.33 23.645 95-99 19.97 28.595 27.375 24.060000000000002 100-104 20.333466853595034 29.11576206689365 26.45203284598438 24.098738233526937 105-109 20.111139176559735 28.896185905531702 27.309926749179088 23.68274816872948 110-114 20.452593827347577 29.05995857958277 26.84750214678992 23.63994544627974 115-119 20.745 28.28 27.49 23.485 120-124 20.72 28.875 26.55 23.855 125-129 21.15 27.845 26.740000000000002 24.265 130-134 21.224999999999998 27.79 26.895000000000003 24.09 135-139 21.4 28.294999999999998 26.57 23.735 140-144 21.055 28.544999999999998 25.974999999999998 24.425 145-149 21.51 28.299999999999997 26.195 23.995 150-151 20.5625 28.525 25.7 25.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.0 24 1.5 25 5.5 26 6.5 27 7.5 28 10.5 29 14.5 30 14.5 31 16.0 32 27.5 33 39.0 34 56.0 35 76.0 36 92.5 37 102.0 38 119.5 39 153.5 40 196.5 41 222.0 42 245.0 43 272.5 44 277.5 45 271.0 46 270.5 47 258.0 48 231.5 49 206.0 50 180.5 51 151.5 52 120.0 53 96.0 54 74.5 55 53.5 56 36.5 57 29.5 58 18.0 59 10.5 60 7.5 61 6.0 62 6.0 63 3.5 64 2.0 65 2.0 66 3.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.1 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.165 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.13999999999999999 105-109 1.0250000000000001 110-114 1.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5199595755432 98.475 2 0.42950985346134407 0.8500000000000001 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025265285497726126 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 24 0.6 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8875 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.7125 0.0 0.0 0.0 0.0 108-109 3.025 0.0 0.0 0.0 0.0 110-111 3.4749999999999996 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.4375 0.0 0.0 0.0 0.0 116-117 4.975 0.0 0.0 0.0 0.0 118-119 5.6 0.0 0.0 0.0 0.0 120-121 6.175000000000001 0.0 0.0 0.0 0.0 122-123 6.762499999999999 0.0 0.0 0.0 0.0 124-125 7.5 0.0 0.0 0.0 0.0 126-127 8.2875 0.0 0.0 0.0 0.0 128-129 8.962499999999999 0.0 0.0 0.0 0.0 130-131 9.5875 0.0 0.0 0.0 0.0 132-133 10.525 0.0 0.0 0.0 0.0 134-135 11.275 0.0 0.0 0.0 0.0 136-137 11.95 0.0 0.0 0.0 0.0 138-139 12.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATGT 10 0.0068537686 144.8375 3 TCCATCA 10 0.0068537686 144.8375 4 AATGTCA 10 0.0068537686 144.8375 5 >>END_MODULE SRR7169815 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169815_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08825 34.0 33.0 34.0 33.0 34.0 2 33.1505 34.0 33.0 34.0 33.0 34.0 3 33.18775 34.0 33.0 34.0 33.0 34.0 4 33.09875 34.0 33.0 34.0 33.0 34.0 5 33.1145 34.0 33.0 34.0 33.0 34.0 6 37.32375 38.0 38.0 38.0 38.0 38.0 7 37.2665 38.0 38.0 38.0 38.0 38.0 8 37.35175 38.0 38.0 38.0 38.0 38.0 9 37.4225 38.0 38.0 38.0 38.0 38.0 10-14 37.33695 38.0 38.0 38.0 38.0 38.0 15-19 37.3099 38.0 38.0 38.0 38.0 38.0 20-24 37.20075 38.0 38.0 38.0 38.0 38.0 25-29 37.17605 38.0 38.0 38.0 37.8 38.0 30-34 37.1762 38.0 38.0 38.0 37.8 38.0 35-39 37.144 38.0 38.0 38.0 37.8 38.0 40-44 37.11685 38.0 38.0 38.0 37.8 38.0 45-49 37.101549999999996 38.0 38.0 38.0 37.4 38.0 50-54 37.0053 38.0 38.0 38.0 36.8 38.0 55-59 36.810750000000006 38.0 38.0 38.0 36.2 38.0 60-64 36.21075 38.0 37.8 38.0 33.0 38.0 65-69 37.07 38.0 38.0 38.0 37.0 38.0 70-74 36.826800000000006 38.0 38.0 38.0 36.8 38.0 75-79 35.834050000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.2932 38.0 38.0 38.0 35.2 38.0 85-89 36.76500000000001 38.0 38.0 38.0 36.6 38.0 90-94 36.72375 38.0 38.0 38.0 36.4 38.0 95-99 36.66335 38.0 38.0 38.0 36.0 38.0 100-104 36.391149999999996 38.0 38.0 38.0 35.4 38.0 105-109 34.882349999999995 38.0 38.0 38.0 29.8 38.0 110-114 33.95335 38.0 37.8 38.0 16.0 38.0 115-119 33.23785 38.0 37.0 38.0 6.6 38.0 120-124 33.2924 38.0 36.2 38.0 14.2 38.0 125-129 33.8795 38.0 36.2 38.0 19.8 38.0 130-134 34.800200000000004 38.0 36.8 38.0 26.6 38.0 135-139 35.1684 38.0 36.6 38.0 31.6 38.0 140-144 34.27329999999999 38.0 35.0 38.0 24.0 38.0 145-149 34.367200000000004 38.0 35.8 38.0 27.6 38.0 150-151 30.380375 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 9.0 4 4.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 5.0 13 3.0 14 1.0 15 1.0 16 3.0 17 4.0 18 5.0 19 16.0 20 14.0 21 5.0 22 10.0 23 23.0 24 15.0 25 13.0 26 7.0 27 26.0 28 37.0 29 48.0 30 67.0 31 55.0 32 76.0 33 105.0 34 127.0 35 188.0 36 413.0 37 2700.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.805805805805807 18.543543543543546 21.47147147147147 29.179179179179176 2 26.591478696741856 23.43358395989975 30.927318295739347 19.047619047619047 3 22.50562640660165 25.35633908477119 31.807951987997 20.330082520630157 4 23.473473473473476 32.13213213213213 24.574574574574577 19.81981981981982 5 26.670002501876404 34.17563172379284 22.366775081310983 16.787590693019766 6 21.075 37.0 24.025 17.9 7 19.6 21.25 39.35 19.8 8 22.5 25.0 28.349999999999998 24.15 9 23.025000000000002 25.95 27.474999999999998 23.549999999999997 10-14 23.64 28.860000000000003 26.11 21.39 15-19 23.66 27.615000000000002 27.765 20.96 20-24 23.86738673867387 28.107810781078108 27.65776577657766 20.367036703670365 25-29 23.565604522034917 28.257715972187487 27.262268020609277 20.914411485168323 30-34 23.204281712685074 28.311324529811927 27.696078431372552 20.78831532613045 35-39 23.453763010408327 27.92233787029624 27.717173738991193 20.906725380304245 40-44 23.77045079301546 27.83309150948116 27.9031370390754 20.493320658427976 45-49 23.04191257377213 27.943383014904473 28.19845953786136 20.81624487346204 50-54 23.53617680884044 27.616380819040952 27.731386569328464 21.11605580279014 55-59 23.963179748861872 27.10991045074791 28.370603832107662 20.556305968282558 60-64 23.52 27.485 28.26 20.735 65-69 23.607360736073606 28.072807280728075 28.16281628162816 20.15701570157016 70-74 23.760185092043056 27.904637360426516 27.81913288401569 20.516044663514737 75-79 23.341777387168484 27.86020782712092 27.87054748487825 20.92746730083234 80-84 24.363563038765943 28.300650299944547 27.448706961738168 19.887079699551343 85-89 23.51028168309401 28.223345174363335 27.317756541752136 20.948616600790515 90-94 23.49469893978796 27.700540108021602 28.390678135627123 20.41408281656331 95-99 24.474999999999998 27.139999999999997 28.125 20.26 100-104 24.183760469431768 27.348412658608755 28.130798936757106 20.337027935202368 105-109 23.967114163804766 27.593922364449995 27.994588406702047 20.44437506504319 110-114 24.480034395657547 27.88735422152953 27.683130004836887 19.94948137797603 115-119 24.680502457673402 27.59148006553796 27.74440196613872 19.98361551064992 120-124 24.31471807851796 28.132909688189994 27.928267542678658 19.62410469061339 125-129 25.916922101257793 28.10485149561357 27.010886798435685 18.967339604692953 130-134 25.75154841633516 27.8261745304396 27.226949997482247 19.19532705574299 135-139 26.075 27.665 27.339999999999996 18.92 140-144 26.4905962384954 27.576030412164865 27.075830332132856 18.857543017206883 145-149 27.244086612991946 27.754163124468672 26.63399509926489 18.36775516327449 150-151 27.095959595959595 27.613636363636363 26.717171717171716 18.57323232323232 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 2.0 27 1.0 28 3.0 29 6.0 30 7.5 31 10.5 32 21.5 33 27.5 34 37.0 35 57.5 36 74.5 37 96.5 38 122.0 39 175.5 40 211.5 41 220.0 42 244.0 43 272.0 44 298.0 45 314.0 46 309.5 47 276.0 48 241.5 49 209.0 50 177.0 51 152.5 52 122.0 53 86.5 54 64.0 55 48.5 56 31.0 57 21.0 58 15.0 59 8.5 60 6.0 61 5.0 62 5.0 63 5.5 64 2.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.25 3 0.025 4 0.1 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.045 30-34 0.04 35-39 0.08 40-44 0.065 45-49 0.03 50-54 0.005 55-59 0.055 60-64 0.0 65-69 0.01 70-74 0.59 75-79 3.2849999999999997 80-84 0.815 85-89 0.065 90-94 0.02 95-99 0.0 100-104 0.305 105-109 3.91 110-114 6.965000000000001 115-119 8.450000000000001 120-124 7.155 125-129 5.390000000000001 130-134 0.705 135-139 0.0 140-144 0.04 145-149 0.015 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5457986373959 98.625 2 0.42896795357052736 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025233409033560434 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 21 0.525 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.3499999999999996 0.0 0.0 0.0 0.0 112-113 3.6625 0.0 0.0 0.0 0.0 114-115 4.15 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.2375 0.0 0.0 0.0 0.0 120-121 5.7375 0.0 0.0 0.0 0.0 122-123 6.2875 0.0 0.0 0.0 0.0 124-125 6.949999999999999 0.0 0.0 0.0 0.0 126-127 7.725 0.0 0.0 0.0 0.0 128-129 8.35 0.0 0.0 0.0 0.0 130-131 8.95 0.0 0.0 0.0 0.0 132-133 9.875 0.0 0.0 0.0 0.0 134-135 10.575 0.0 0.0 0.0 0.0 136-137 11.2 0.0 0.0 0.0 0.0 138-139 12.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGAAG 10 0.007170955 142.6625 6 CAGATTG 10 0.007170955 142.6625 9 >>END_MODULE Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614500 spots for SRR7169815.sra Written 614500 spots for SRR7169815.sra Read 614507 spots for SRR7169815.sra Written 614507 spots for SRR7169815.sra SRR ids: ['SRR7169815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s1u0j5d6 SRR7169815.sra spots: 12290007 blocks: [[1, 614500], [614501, 1229000], [1229001, 1843500], [1843501, 2458000], [2458001, 3072500], [3072501, 3687000], [3687001, 4301500], [4301501, 4916000], [4916001, 5530500], [5530501, 6145000], [6145001, 6759500], [6759501, 7374000], [7374001, 7988500], [7988501, 8603000], [8603001, 9217500], [9217501, 9832000], [9832001, 10446500], [10446501, 11061000], [11061001, 11675500], [11675501, 12290007]] SRR7169815 file size 4142979 SRR7169815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169815 SRR7169815_1.fastq SRR7169815_2.fastq Input file: SRR7169815_1.fastq Paired file: SRR7169815_2.fastq trimmed: SRR7169815-trimmed-pair1.fastq, SRR7169815-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:42:07 2025 >> started Tue Feb 11 20:42:21 2025 >> done (14.255s) 12290007 read pairs processed; of these: 17590 ( 0.14%) short read pairs filtered out after trimming by size control 78242 ( 0.64%) empty read pairs filtered out after trimming by size control 12194175 (99.22%) read pairs available; of these: 5625999 (46.14%) trimmed read pairs available after processing 6568176 (53.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 13 0.00% 21 10 0.00% 22 10 0.00% 23 7 0.00% 24 10 0.00% 25 10 0.00% 26 10 0.00% 27 15 0.00% 28 8 0.00% 29 8 0.00% 30 17 0.00% 31 7 0.00% 32 16 0.00% 33 14 0.00% 34 19 0.00% 35 20 0.00% 36 19 0.00% 37 22 0.00% 38 41 0.00% 39 36 0.00% 40 49 0.00% 41 60 0.00% 42 55 0.00% 43 66 0.00% 44 67 0.00% 45 87 0.00% 46 112 0.00% 47 141 0.00% 48 144 0.00% 49 155 0.00% 50 188 0.00% 51 248 0.00% 52 293 0.00% 53 305 0.00% 54 284 0.00% 55 304 0.00% 56 334 0.00% 57 370 0.00% 58 503 0.00% 59 514 0.00% 60 681 0.01% 61 657 0.01% 62 696 0.01% 63 763 0.01% 64 763 0.01% 65 791 0.01% 66 932 0.01% 67 908 0.01% 68 1164 0.01% 69 1320 0.01% 70 1442 0.01% 71 1700 0.01% 72 1980 0.02% 73 2132 0.02% 74 2484 0.02% 75 2807 0.02% 76 3524 0.03% 77 4008 0.03% 78 3716 0.03% 79 4000 0.03% 80 4279 0.04% 81 4699 0.04% 82 5233 0.04% 83 6030 0.05% 84 7137 0.06% 85 8329 0.07% 86 8897 0.07% 87 9720 0.08% 88 10430 0.09% 89 11058 0.09% 90 11573 0.09% 91 12225 0.10% 92 13262 0.11% 93 14047 0.12% 94 15074 0.12% 95 16459 0.13% 96 17735 0.15% 97 18433 0.15% 98 19136 0.16% 99 20073 0.16% 100 20962 0.17% 101 21473 0.18% 102 22662 0.19% 103 24105 0.20% 104 25300 0.21% 105 26667 0.22% 106 27811 0.23% 107 28822 0.24% 108 29781 0.24% 109 30747 0.25% 110 31338 0.26% 111 31901 0.26% 112 33155 0.27% 113 34251 0.28% 114 35429 0.29% 115 36939 0.30% 116 38052 0.31% 117 39391 0.32% 118 40058 0.33% 119 40488 0.33% 120 41305 0.34% 121 41981 0.34% 122 42944 0.35% 123 43853 0.36% 124 44692 0.37% 125 46147 0.38% 126 47412 0.39% 127 48954 0.40% 128 49689 0.41% 129 50835 0.42% 130 51458 0.42% 131 52110 0.43% 132 52947 0.43% 133 53884 0.44% 134 55025 0.45% 135 55798 0.46% 136 58087 0.48% 137 59635 0.49% 138 62085 0.51% 139 64529 0.53% 140 66581 0.55% 141 70045 0.57% 142 73939 0.61% 143 78249 0.64% 144 85410 0.70% 145 92770 0.76% 146 107607 0.88% 147 136470 1.12% 148 195618 1.60% 149 399576 3.28% 150 2402125 19.70% 151 6568176 53.86% 12194175 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=42 prefix-density=0.30 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=206.03 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.7 sequence=ATAGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.92 fanout-score-rank=12 prefix-density=0.34 prefix-fanout=4.2 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=16 fanout-score=44.90 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.9 sequence=TGTTGGTGGTGG SRR7169815 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:43:08 Started mapping on | Feb 11 20:43:08 Finished on | Feb 11 20:44:39 Mapping speed, Million of reads per hour | 482.41 Number of input reads | 12194175 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11694935 Uniquely mapped reads % | 95.91% Average mapped length | 289.84 Number of splices: Total | 10237650 Number of splices: Annotated (sjdb) | 10060200 Number of splices: GT/AG | 10093077 Number of splices: GC/AG | 112904 Number of splices: AT/AC | 9106 Number of splices: Non-canonical | 22563 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201436 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 14562 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 310125 310125 310125 N_multimapping 201436 201436 201436 N_noFeature 257390 11544599 304287 N_ambiguous 150849 582 47169 UnstrandedReadsAssigned:11286696 PositiveStrandReadsAssigned:149754 NegativeStrandReadsAssigned:11343479 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169815 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169815-trimmed-pair1.fastq SRR7169815-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,194,175 reads, 11,303,503 reads pseudoaligned [quant] estimated average fragment length: 209.179 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7169815.ke.tsv 34699 SRR7169815.se.tsv 87100 total ==> SRR7169815.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.82 185 9.0966 Potri.005G024800.1.v4.1 1035 826.821 19 2.04496 Potri.004G059700.1.v4.1 961 752.826 0 0 Potri.007G009000.2.v4.1 1416 1207.82 0 0 Potri.003G141000.2.v4.1 2943 2734.82 203.069 6.60781 Potri.016G087400.1.v4.1 270 94.5382 1227.89 1155.83 Potri.015G069301.1.v4.1 564 357.786 0 0 Potri.010G195200.1.v4.1 1773 1564.82 8 0.454955 Potri.012G127500.1.v4.1 977 768.821 2987 345.743 ==> SRR7169815.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 998 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169815 completed mapping pipeline successfully