Starting /dee2/code/volunteer_pipeline.sh SRR7169816 current disk space = 3053070299136 free memory = 1127428336 SRR7169816 SRAfilesize ebc98d2c40c4d0048e92e3b4c6cff71f SRR7169816.sra SRR7169816.sra file validated SRR7169816 is paired end SRR7169816 is conventional basespace SRR7169816 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.115 31.0 18.0 33.0 18.0 33.0 2 25.6595 27.0 18.0 31.0 18.0 33.0 3 30.106 31.0 29.0 33.0 27.0 33.0 4 31.85925 33.0 31.0 33.0 29.0 33.0 5 32.484 33.0 33.0 33.0 32.0 33.0 6 36.79375 38.0 37.0 38.0 34.0 38.0 7 37.39175 38.0 38.0 38.0 36.0 38.0 8 37.6335 38.0 38.0 38.0 38.0 38.0 9 37.6325 38.0 38.0 38.0 38.0 38.0 10-14 37.68945 38.0 38.0 38.0 38.0 38.0 15-19 37.74875 38.0 38.0 38.0 38.0 38.0 20-24 37.7373 38.0 38.0 38.0 38.0 38.0 25-29 37.70655000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.68885 38.0 38.0 38.0 38.0 38.0 35-39 37.6765 38.0 38.0 38.0 38.0 38.0 40-44 37.595549999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.602999999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.48630000000001 38.0 38.0 38.0 37.6 38.0 55-59 37.5749 38.0 38.0 38.0 38.0 38.0 60-64 37.478100000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.47345 38.0 38.0 38.0 37.4 38.0 70-74 37.435449999999996 38.0 38.0 38.0 37.2 38.0 75-79 37.33935 38.0 38.0 38.0 37.2 38.0 80-84 37.312599999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.2563 38.0 38.0 38.0 37.0 38.0 90-94 37.11245 38.0 38.0 38.0 36.2 38.0 95-99 37.17155 38.0 38.0 38.0 36.2 38.0 100-104 37.049749999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.6397 38.0 38.0 38.0 35.6 38.0 110-114 36.57335 38.0 38.0 38.0 35.0 38.0 115-119 36.79174999999999 38.0 38.0 38.0 35.0 38.0 120-124 36.8051 38.0 38.0 38.0 35.2 38.0 125-129 36.63475 38.0 38.0 38.0 34.8 38.0 130-134 36.388999999999996 38.0 38.0 38.0 34.0 38.0 135-139 36.1449 38.0 38.0 38.0 33.8 38.0 140-144 35.794599999999996 38.0 36.4 38.0 32.6 38.0 145-149 35.554 38.0 36.2 38.0 32.2 38.0 150-151 32.294125 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 3.0 19 5.0 20 1.0 21 3.0 22 4.0 23 2.0 24 2.0 25 3.0 26 1.0 27 12.0 28 11.0 29 23.0 30 20.0 31 33.0 32 40.0 33 66.0 34 111.0 35 209.0 36 512.0 37 2937.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.599799398194584 13.716148445336007 9.528585757271815 35.15546639919759 2 22.125 15.575 35.875 26.424999999999997 3 20.3 22.400000000000002 25.474999999999998 31.825 4 20.340255191393545 30.022516887665752 23.767825869402053 25.869402051538653 5 21.725 34.150000000000006 24.5 19.625 6 19.6 35.05 25.424999999999997 19.925 7 14.975 25.15 42.575 17.299999999999997 8 18.15 25.124999999999996 30.175 26.55 9 16.625 24.75 33.725 24.9 10-14 20.025000000000002 30.255 26.245 23.474999999999998 15-19 19.67 28.88 27.455000000000002 23.995 20-24 19.895 29.93 26.965 23.21 25-29 19.650000000000002 29.69 27.389999999999997 23.27 30-34 19.940997049852495 29.186459322966147 27.301365068253414 23.571178558927947 35-39 20.36 28.610000000000003 27.485 23.544999999999998 40-44 20.0 28.694999999999997 27.305 24.0 45-49 19.625 28.705000000000002 27.694999999999997 23.974999999999998 50-54 20.3 28.62 27.66 23.419999999999998 55-59 19.6 29.12 27.205000000000002 24.075 60-64 20.191296509589865 29.23531473784366 27.41248935850568 23.160899394060795 65-69 20.82 28.54 27.544999999999998 23.095 70-74 20.455000000000002 28.599999999999998 27.365000000000002 23.580000000000002 75-79 20.625 28.58 27.450000000000003 23.345 80-84 20.8 28.634999999999998 26.740000000000002 23.825 85-89 19.715 28.345 27.800000000000004 24.14 90-94 20.225 28.78 26.889999999999997 24.104999999999997 95-99 20.145 28.544999999999998 27.445000000000004 23.865 100-104 20.340510766149226 28.222333500250375 27.516274411617424 23.920881321982975 105-109 20.37560581583199 28.498586429725364 27.07491922455573 24.050888529886915 110-114 20.430812692327095 28.199566160520607 27.59925339252384 23.770367754628463 115-119 21.224999999999998 28.13 26.775 23.87 120-124 20.53 28.910000000000004 26.31 24.25 125-129 20.815 28.68 26.515 23.990000000000002 130-134 21.15 28.610000000000003 26.029999999999998 24.21 135-139 21.08 28.21 26.205000000000002 24.505 140-144 21.58 27.834999999999997 26.200000000000003 24.385 145-149 21.240000000000002 27.889999999999997 26.91 23.96 150-151 20.8125 28.1625 26.325 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.5 23 3.0 24 2.5 25 2.0 26 5.5 27 8.5 28 9.0 29 10.0 30 15.5 31 28.5 32 38.0 33 44.0 34 54.0 35 66.5 36 85.5 37 106.0 38 130.5 39 154.5 40 177.5 41 214.0 42 253.0 43 268.5 44 266.0 45 278.0 46 282.5 47 247.0 48 227.5 49 209.0 50 176.0 51 158.0 52 125.5 53 96.0 54 66.5 55 45.5 56 38.5 57 30.0 58 22.0 59 11.0 60 6.5 61 7.0 62 6.5 63 5.0 64 4.0 65 2.5 66 1.0 67 1.5 68 2.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.155 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.15 105-109 0.96 110-114 0.885 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.7625000000000002 0.0 0.0 0.0 0.0 104-105 2.225 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.3375000000000004 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.1 0.0 0.0 0.0 0.0 120-121 5.675000000000001 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.6 0.0 0.0 0.0 0.0 126-127 7.25 0.0 0.0 0.0 0.0 128-129 7.9625 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.4 0.0 0.0 0.0 0.0 134-135 10.0125 0.0 0.0 0.0 0.0 136-137 10.55 0.0 0.0 0.0 0.0 138-139 11.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATC 10 0.006830828 145.0 2 >>END_MODULE SRR7169816 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169816_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11625 34.0 33.0 34.0 33.0 34.0 2 33.1515 34.0 33.0 34.0 33.0 34.0 3 33.22 34.0 33.0 34.0 33.0 34.0 4 33.118 34.0 33.0 34.0 33.0 34.0 5 33.1915 34.0 33.0 34.0 33.0 34.0 6 37.394 38.0 38.0 38.0 38.0 38.0 7 37.39575 38.0 38.0 38.0 38.0 38.0 8 37.41725 38.0 38.0 38.0 38.0 38.0 9 37.4315 38.0 38.0 38.0 38.0 38.0 10-14 37.41805 38.0 38.0 38.0 38.0 38.0 15-19 37.41195 38.0 38.0 38.0 38.0 38.0 20-24 37.344300000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.2884 38.0 38.0 38.0 37.6 38.0 30-34 37.27335000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.24775000000001 38.0 38.0 38.0 37.4 38.0 40-44 37.2188 38.0 38.0 38.0 37.2 38.0 45-49 37.1592 38.0 38.0 38.0 37.0 38.0 50-54 36.997749999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.836149999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.1323 38.0 37.4 38.0 32.2 38.0 65-69 37.123 38.0 38.0 38.0 37.0 38.0 70-74 36.85095 38.0 38.0 38.0 36.6 38.0 75-79 35.95485 38.0 38.0 38.0 34.8 38.0 80-84 36.5447 38.0 38.0 38.0 35.4 38.0 85-89 36.94800000000001 38.0 38.0 38.0 36.2 38.0 90-94 36.9123 38.0 38.0 38.0 36.0 38.0 95-99 36.8697 38.0 38.0 38.0 36.0 38.0 100-104 36.550799999999995 38.0 38.0 38.0 35.4 38.0 105-109 35.2301 38.0 38.0 38.0 31.4 38.0 110-114 34.296749999999996 38.0 37.6 38.0 23.2 38.0 115-119 33.54365 38.0 37.0 38.0 14.4 38.0 120-124 33.52705 38.0 35.8 38.0 16.6 38.0 125-129 34.12075 38.0 36.2 38.0 23.0 38.0 130-134 35.02055 38.0 36.4 38.0 27.8 38.0 135-139 35.2218 38.0 36.2 38.0 31.2 38.0 140-144 34.193 38.0 35.0 38.0 22.4 38.0 145-149 34.2162 38.0 35.8 38.0 27.0 38.0 150-151 30.261625000000002 35.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 4.0 5 2.0 6 2.0 7 2.0 8 3.0 9 1.0 10 3.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 1.0 17 4.0 18 5.0 19 3.0 20 4.0 21 9.0 22 11.0 23 22.0 24 14.0 25 11.0 26 18.0 27 25.0 28 27.0 29 57.0 30 69.0 31 67.0 32 78.0 33 110.0 34 150.0 35 229.0 36 445.0 37 2612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.706279709782336 18.964223167375533 14.16062046534901 25.168876657493122 2 27.167919799498748 25.03759398496241 29.74937343358396 18.045112781954884 3 19.88991743807856 28.84663497623217 31.923942957217914 19.339504628471353 4 23.46760070052539 34.00050037528146 23.592694520890667 18.939204403302476 5 24.26820115086315 36.55241431073305 20.640480360270203 18.5389041781336 6 20.630157539384847 37.70942735683921 22.980745186296573 18.67966991747937 7 19.23461730865433 20.135067533766886 39.26963481740871 21.360680340170084 8 22.925 24.8 26.625 25.650000000000002 9 21.375 25.674999999999997 28.925 24.025 10-14 24.205 28.305000000000003 26.31 21.18 15-19 23.455000000000002 27.98 27.435 21.13 20-24 23.10693207962389 27.858357507252173 27.76332899869961 21.27138141442433 25-29 23.739495798319325 28.056222488995598 27.39095638255302 20.813325330132052 30-34 23.89194597298649 27.408704352176088 27.423711855927962 21.275637818909455 35-39 23.600060051043386 28.279037181604366 27.568433168192964 20.552469599159284 40-44 23.764011208967172 28.407726180944753 27.19675740592474 20.631505204163332 45-49 23.9555711212288 27.863111022164404 27.587932155901335 20.593385700705458 50-54 23.619447779111642 27.876150460184075 27.791116446578634 20.713285314125653 55-59 24.18830356696183 27.365050777927863 27.71524338386112 20.731402271249184 60-64 23.482348234823483 27.032703270327037 28.54785478547855 20.937093709370938 65-69 23.668283899364777 27.734707147501624 28.104836692842493 20.492172260291103 70-74 23.685268979386624 27.667169431875315 27.78783308195073 20.85972850678733 75-79 23.608326908249808 27.46337702390131 27.956823438704703 20.971472629144177 80-84 23.659702995217717 27.883211678832115 27.631512710797885 20.825572615152275 85-89 23.710411767648974 27.682993946064943 27.758042727773052 20.848551558513034 90-94 23.724234540724435 27.7666599959976 27.851711026615973 20.657394436661995 95-99 23.465866466616657 27.446861715428856 28.217054263565895 20.8702175543886 100-104 24.052156469408224 27.61283851554664 28.48545636910732 19.849548645937816 105-109 24.070814784139145 27.90143907236774 27.78755564758257 20.24019049591055 110-114 25.03336714537398 27.969675938284126 27.152848219529126 19.84410869681277 115-119 24.681312720368865 27.53458096013019 27.393544887442367 20.390561432058586 120-124 24.50571764454419 28.059207010794058 27.882868440739557 19.552206903922198 125-129 25.307409353652126 27.69837099316868 27.141355754072517 19.852863899106673 130-134 25.421426055452123 27.74115634277663 27.318472299099277 19.518945302671966 135-139 25.722572257225725 27.652765276527653 27.06770677067707 19.556955695569556 140-144 26.049117191016858 27.55964587605662 26.859400790276595 19.53183614264993 145-149 25.63140785196299 27.67691922980745 27.521880470117527 19.169792448112027 150-151 27.028391167192428 27.936908517350155 26.85173501577287 18.182965299684543 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 3.5 27 4.0 28 4.0 29 4.5 30 6.5 31 13.0 32 22.0 33 29.5 34 41.5 35 59.5 36 76.0 37 94.0 38 119.0 39 150.0 40 181.0 41 212.5 42 254.5 43 275.0 44 282.5 45 297.0 46 289.0 47 275.5 48 240.5 49 221.5 50 199.0 51 150.5 52 128.5 53 95.5 54 69.5 55 61.0 56 40.0 57 21.5 58 17.0 59 16.5 60 12.0 61 6.0 62 5.0 63 3.5 64 2.5 65 2.5 66 1.0 67 0.5 68 0.5 69 1.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.25 3 0.075 4 0.075 5 0.075 6 0.025 7 0.05 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.04 30-34 0.05 35-39 0.08499999999999999 40-44 0.08 45-49 0.065 50-54 0.04 55-59 0.055 60-64 0.01 65-69 0.034999999999999996 70-74 0.5499999999999999 75-79 2.725 80-84 0.675 85-89 0.065 90-94 0.06 95-99 0.025 100-104 0.3 105-109 3.4099999999999997 110-114 6.345000000000001 115-119 7.825 120-124 6.43 125-129 4.8500000000000005 130-134 0.635 135-139 0.01 140-144 0.034999999999999996 145-149 0.025 150-151 0.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.07500000000000001 0.0 0.0 0.025 0.0 78-79 0.1125 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.2125 0.0 0.0 0.025 0.0 84-85 0.375 0.0 0.0 0.025 0.0 86-87 0.4375 0.0 0.0 0.025 0.0 88-89 0.5375000000000001 0.0 0.0 0.025 0.0 90-91 0.6875 0.0 0.0 0.025 0.0 92-93 0.75 0.0 0.0 0.025 0.0 94-95 0.8374999999999999 0.0 0.0 0.025 0.0 96-97 1.025 0.0 0.0 0.025 0.0 98-99 1.275 0.0 0.0 0.025 0.0 100-101 1.4625 0.0 0.0 0.025 0.0 102-103 1.725 0.0 0.0 0.025 0.0 104-105 2.125 0.0 0.0 0.025 0.0 106-107 2.4625 0.0 0.0 0.025 0.0 108-109 2.75 0.0 0.0 0.025 0.0 110-111 3.1375 0.0 0.0 0.025 0.0 112-113 3.5250000000000004 0.0 0.0 0.025 0.0 114-115 3.9000000000000004 0.0 0.0 0.025 0.0 116-117 4.4 0.0 0.0 0.025 0.0 118-119 4.699999999999999 0.0 0.0 0.025 0.0 120-121 5.2 0.0 0.0 0.025 0.0 122-123 5.625 0.0 0.0 0.025 0.0 124-125 6.0 0.0 0.0 0.025 0.0 126-127 6.65 0.0 0.0 0.025 0.0 128-129 7.4 0.0 0.0 0.025 0.0 130-131 8.0375 0.0 0.0 0.025 0.0 132-133 8.8125 0.0 0.0 0.025 0.0 134-135 9.4375 0.0 0.0 0.025 0.0 136-137 10.025 0.0 0.0 0.025 0.0 138-139 10.65 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603623 spots for SRR7169816.sra Written 603623 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra Read 603604 spots for SRR7169816.sra Written 603604 spots for SRR7169816.sra SRR ids: ['SRR7169816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_282zuxx2 SRR7169816.sra spots: 12072099 blocks: [[1, 603604], [603605, 1207208], [1207209, 1810812], [1810813, 2414416], [2414417, 3018020], [3018021, 3621624], [3621625, 4225228], [4225229, 4828832], [4828833, 5432436], [5432437, 6036040], [6036041, 6639644], [6639645, 7243248], [7243249, 7846852], [7846853, 8450456], [8450457, 9054060], [9054061, 9657664], [9657665, 10261268], [10261269, 10864872], [10864873, 11468476], [11468477, 12072099]] SRR7169816 file size 4069137 SRR7169816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169816 SRR7169816_1.fastq SRR7169816_2.fastq Input file: SRR7169816_1.fastq Paired file: SRR7169816_2.fastq trimmed: SRR7169816-trimmed-pair1.fastq, SRR7169816-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:23:52 2025 >> started Tue Feb 11 20:24:07 2025 >> done (14.900s) 12072099 read pairs processed; of these: 11348 ( 0.09%) short read pairs filtered out after trimming by size control 18695 ( 0.15%) empty read pairs filtered out after trimming by size control 12042056 (99.75%) read pairs available; of these: 5511433 (45.77%) trimmed read pairs available after processing 6530623 (54.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 10 0.00% 24 6 0.00% 25 4 0.00% 26 6 0.00% 27 8 0.00% 28 7 0.00% 29 5 0.00% 30 8 0.00% 31 6 0.00% 32 12 0.00% 33 11 0.00% 34 15 0.00% 35 15 0.00% 36 19 0.00% 37 12 0.00% 38 25 0.00% 39 11 0.00% 40 38 0.00% 41 29 0.00% 42 42 0.00% 43 33 0.00% 44 44 0.00% 45 53 0.00% 46 67 0.00% 47 65 0.00% 48 73 0.00% 49 90 0.00% 50 103 0.00% 51 111 0.00% 52 124 0.00% 53 171 0.00% 54 153 0.00% 55 170 0.00% 56 180 0.00% 57 222 0.00% 58 276 0.00% 59 284 0.00% 60 353 0.00% 61 418 0.00% 62 490 0.00% 63 542 0.00% 64 634 0.01% 65 702 0.01% 66 712 0.01% 67 801 0.01% 68 913 0.01% 69 1134 0.01% 70 1226 0.01% 71 1412 0.01% 72 1682 0.01% 73 1973 0.02% 74 2204 0.02% 75 2385 0.02% 76 2655 0.02% 77 2987 0.02% 78 3104 0.03% 79 3506 0.03% 80 3802 0.03% 81 4234 0.04% 82 5075 0.04% 83 5718 0.05% 84 6763 0.06% 85 7449 0.06% 86 7800 0.06% 87 8477 0.07% 88 8946 0.07% 89 9718 0.08% 90 10304 0.09% 91 11286 0.09% 92 12286 0.10% 93 13105 0.11% 94 14098 0.12% 95 15207 0.13% 96 15996 0.13% 97 16604 0.14% 98 16717 0.14% 99 17467 0.15% 100 18585 0.15% 101 19140 0.16% 102 20695 0.17% 103 22394 0.19% 104 23413 0.19% 105 24804 0.21% 106 25292 0.21% 107 25817 0.21% 108 26313 0.22% 109 26624 0.22% 110 27448 0.23% 111 28494 0.24% 112 29988 0.25% 113 31198 0.26% 114 32902 0.27% 115 34403 0.29% 116 34899 0.29% 117 35435 0.29% 118 35608 0.30% 119 35815 0.30% 120 36572 0.30% 121 37317 0.31% 122 38617 0.32% 123 40436 0.34% 124 42047 0.35% 125 43688 0.36% 126 44618 0.37% 127 45763 0.38% 128 45860 0.38% 129 45814 0.38% 130 47010 0.39% 131 47363 0.39% 132 48601 0.40% 133 50357 0.42% 134 51929 0.43% 135 54084 0.45% 136 56242 0.47% 137 57471 0.48% 138 59090 0.49% 139 60868 0.51% 140 62651 0.52% 141 66578 0.55% 142 71099 0.59% 143 75514 0.63% 144 85438 0.71% 145 94602 0.79% 146 111692 0.93% 147 141753 1.18% 148 204974 1.70% 149 416659 3.46% 150 2424056 20.13% 151 6530623 54.23% 12042056 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=39 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=255.47 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=245.70 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=25.7 sequence=GAAGAAGAAGAAA SRR7169816 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:24:50 Started mapping on | Feb 11 20:24:51 Finished on | Feb 11 20:25:51 Mapping speed, Million of reads per hour | 722.52 Number of input reads | 12042056 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11453760 Uniquely mapped reads % | 95.11% Average mapped length | 290.42 Number of splices: Total | 10335549 Number of splices: Annotated (sjdb) | 10153191 Number of splices: GT/AG | 10175918 Number of splices: GC/AG | 125894 Number of splices: AT/AC | 8581 Number of splices: Non-canonical | 25156 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213033 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 32023 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385844 385844 385844 N_multimapping 213033 213033 213033 N_noFeature 272605 11325374 331196 N_ambiguous 115199 611 44991 UnstrandedReadsAssigned:11065956 PositiveStrandReadsAssigned:127775 NegativeStrandReadsAssigned:11077573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169816 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169816-trimmed-pair1.fastq SRR7169816-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,042,056 reads, 11,043,595 reads pseudoaligned [quant] estimated average fragment length: 213.946 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7169816.ke.tsv 34699 SRR7169816.se.tsv 87100 total ==> SRR7169816.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.05 231 12.0189 Potri.005G024800.1.v4.1 1035 822.054 41 4.68408 Potri.004G059700.1.v4.1 961 748.065 6 0.753275 Potri.007G009000.2.v4.1 1416 1203.05 0 0 Potri.003G141000.2.v4.1 2943 2730.05 238 8.18742 Potri.016G087400.1.v4.1 270 92.9961 1104.46 1115.39 Potri.015G069301.1.v4.1 564 354.037 0 0 Potri.010G195200.1.v4.1 1773 1560.05 28 1.68562 Potri.012G127500.1.v4.1 977 764.06 5094 626.142 ==> SRR7169816.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1198 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169816 completed mapping pipeline successfully