Starting /dee2/code/volunteer_pipeline.sh SRR7169817 current disk space = 3052980932608 free memory = 1239290420 SRR7169817 SRAfilesize 18f6f5675dc6ba26896d5c8985b880f1 SRR7169817.sra SRR7169817.sra file validated SRR7169817 is paired end SRR7169817 is conventional basespace SRR7169817 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.04425 32.0 25.0 33.0 18.0 33.0 2 27.318 29.0 25.0 31.0 18.0 33.0 3 30.4985 31.0 29.0 33.0 27.0 33.0 4 32.08625 33.0 31.0 33.0 30.0 33.0 5 32.66575 33.0 33.0 33.0 32.0 34.0 6 36.65025 38.0 37.0 38.0 34.0 38.0 7 37.30125 38.0 38.0 38.0 36.0 38.0 8 37.60125 38.0 38.0 38.0 37.0 38.0 9 37.61625 38.0 38.0 38.0 38.0 38.0 10-14 37.685649999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6913 38.0 38.0 38.0 38.0 38.0 20-24 37.681349999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.64875 38.0 38.0 38.0 38.0 38.0 30-34 37.633250000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.4787 38.0 38.0 38.0 37.8 38.0 40-44 37.228699999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.433949999999996 38.0 38.0 38.0 37.4 38.0 50-54 37.4957 38.0 38.0 38.0 37.2 38.0 55-59 37.439550000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.390100000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.3714 38.0 38.0 38.0 37.0 38.0 70-74 37.27695 38.0 38.0 38.0 36.6 38.0 75-79 37.28615 38.0 38.0 38.0 36.8 38.0 80-84 37.158699999999996 38.0 38.0 38.0 36.2 38.0 85-89 37.042649999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.9816 38.0 38.0 38.0 35.8 38.0 95-99 36.99145 38.0 38.0 38.0 36.0 38.0 100-104 36.81145 38.0 38.0 38.0 35.2 38.0 105-109 36.61995 38.0 38.0 38.0 34.6 38.0 110-114 36.51389999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.42075 38.0 38.0 38.0 34.0 38.0 120-124 36.212149999999994 38.0 37.2 38.0 33.6 38.0 125-129 36.14215 38.0 37.0 38.0 33.6 38.0 130-134 35.68575 38.0 36.2 38.0 31.4 38.0 135-139 35.49715 38.0 36.0 38.0 31.0 38.0 140-144 35.204950000000004 38.0 35.6 38.0 30.6 38.0 145-149 34.6896 38.0 35.0 38.0 28.0 38.0 150-151 30.838124999999998 36.5 29.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 3.0 15 1.0 16 0.0 17 1.0 18 2.0 19 2.0 20 1.0 21 5.0 22 1.0 23 4.0 24 5.0 25 6.0 26 5.0 27 8.0 28 11.0 29 23.0 30 32.0 31 33.0 32 62.0 33 75.0 34 126.0 35 274.0 36 752.0 37 2565.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.56510745891276 12.187104930467763 7.534766118836915 36.713021491782555 2 23.25 14.7 35.4 26.650000000000002 3 20.150000000000002 20.8 25.75 33.300000000000004 4 22.15 29.049999999999997 22.975 25.825 5 22.15 33.125 25.624999999999996 19.1 6 18.625 34.475 25.900000000000002 21.0 7 15.1 24.75 41.975 18.175 8 17.224999999999998 25.3 31.175000000000004 26.3 9 16.675 24.325 34.8 24.2 10-14 20.03 30.049999999999997 26.645000000000003 23.275000000000002 15-19 19.395 29.13 28.544999999999998 22.93 20-24 20.0 29.32 27.42 23.26 25-29 20.71 29.09 26.91 23.29 30-34 19.91 28.79 27.339999999999996 23.96 35-39 20.0 29.15 26.76 24.09 40-44 20.225 29.28 27.155 23.34 45-49 20.52 29.054999999999996 27.400000000000002 23.025000000000002 50-54 20.165 28.494999999999997 28.189999999999998 23.150000000000002 55-59 20.29 28.915000000000003 27.125 23.669999999999998 60-64 20.165 28.794999999999998 27.685 23.355 65-69 20.28 27.975 27.87 23.875 70-74 20.205000000000002 29.425 27.134999999999998 23.235 75-79 19.905 29.025000000000002 27.77 23.3 80-84 20.13 28.93 27.555000000000003 23.385 85-89 20.115 28.660000000000004 27.72 23.505000000000003 90-94 20.560000000000002 28.51 27.43 23.5 95-99 19.64 28.744999999999997 27.560000000000002 24.055 100-104 20.525 28.455000000000002 27.52 23.5 105-109 20.875 28.455000000000002 26.97 23.7 110-114 20.919999999999998 28.48 26.919999999999998 23.68 115-119 20.974999999999998 28.744999999999997 26.75 23.53 120-124 20.845 28.02 27.46 23.674999999999997 125-129 21.005 28.315 26.86 23.82 130-134 20.835 28.665000000000003 26.85 23.65 135-139 20.815 28.215 26.705000000000002 24.265 140-144 21.029999999999998 28.08 26.995 23.895 145-149 21.22 28.299999999999997 26.44 24.04 150-151 21.0375 27.500000000000004 26.887499999999996 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 4.0 26 6.5 27 4.0 28 7.5 29 13.0 30 20.0 31 27.5 32 35.5 33 45.0 34 57.5 35 73.5 36 87.0 37 111.0 38 130.0 39 156.5 40 194.0 41 225.5 42 241.5 43 258.0 44 287.0 45 285.5 46 270.5 47 249.0 48 223.5 49 205.0 50 172.5 51 137.0 52 109.0 53 95.5 54 79.0 55 53.0 56 36.5 57 25.5 58 18.5 59 15.5 60 11.5 61 7.0 62 4.0 63 3.0 64 3.0 65 2.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.825 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.5375 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.4625 0.0 0.0 0.0 0.0 112-113 3.7750000000000004 0.0 0.0 0.0 0.0 114-115 4.2125 0.0 0.0 0.0 0.0 116-117 4.5625 0.0 0.0 0.0 0.0 118-119 4.9 0.0 0.0 0.0 0.0 120-121 5.475 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.5375 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.637499999999999 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.2125 0.0 0.0 0.0 0.0 136-137 9.912500000000001 0.0 0.0 0.0 0.0 138-139 10.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169817 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169817_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7685 33.0 33.0 34.0 32.0 34.0 2 31.88575 33.0 33.0 34.0 27.0 34.0 3 32.733 33.0 33.0 34.0 32.0 34.0 4 32.86225 33.0 33.0 34.0 32.0 34.0 5 33.087 34.0 33.0 34.0 33.0 34.0 6 37.207 38.0 38.0 38.0 37.0 38.0 7 37.32875 38.0 38.0 38.0 37.0 38.0 8 37.31075 38.0 38.0 38.0 37.0 38.0 9 37.39775 38.0 38.0 38.0 38.0 38.0 10-14 37.33370000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.3123 38.0 38.0 38.0 37.2 38.0 20-24 37.27 38.0 38.0 38.0 37.0 38.0 25-29 37.25715 38.0 38.0 38.0 37.0 38.0 30-34 37.2624 38.0 38.0 38.0 37.0 38.0 35-39 36.8842 38.0 38.0 38.0 35.6 38.0 40-44 37.162600000000005 38.0 38.0 38.0 37.0 38.0 45-49 36.795049999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.931799999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.406400000000005 38.0 37.6 38.0 33.8 38.0 60-64 36.9675 38.0 38.0 38.0 36.0 38.0 65-69 36.927350000000004 38.0 38.0 38.0 36.4 38.0 70-74 36.829699999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.674549999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.760450000000006 38.0 38.0 38.0 35.4 38.0 85-89 35.81635 38.0 37.0 38.0 29.6 38.0 90-94 36.606 38.0 38.0 38.0 34.6 38.0 95-99 36.55185 38.0 38.0 38.0 34.6 38.0 100-104 36.4792 38.0 38.0 38.0 34.2 38.0 105-109 35.79215000000001 38.0 37.2 38.0 31.8 38.0 110-114 35.113 38.0 37.0 38.0 29.4 38.0 115-119 34.39745 38.0 36.2 38.0 25.6 38.0 120-124 34.69695 38.0 36.0 38.0 26.8 38.0 125-129 34.572700000000005 38.0 36.0 38.0 25.6 38.0 130-134 34.20495 38.0 34.8 38.0 23.2 38.0 135-139 34.0666 38.0 34.8 38.0 23.2 38.0 140-144 32.68385 37.6 31.8 38.0 18.6 38.0 145-149 32.390750000000004 38.0 32.4 38.0 16.2 38.0 150-151 28.5875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 3.0 11 3.0 12 2.0 13 1.0 14 4.0 15 4.0 16 3.0 17 7.0 18 2.0 19 2.0 20 6.0 21 6.0 22 13.0 23 6.0 24 10.0 25 14.0 26 22.0 27 25.0 28 30.0 29 28.0 30 43.0 31 80.0 32 105.0 33 158.0 34 216.0 35 316.0 36 768.0 37 2114.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.574999999999996 19.525000000000002 13.05 27.85 2 25.474999999999998 25.3 32.375 16.85 3 20.575 27.825 30.025000000000002 21.575 4 23.549999999999997 34.375 23.75 18.325 5 25.525 35.699999999999996 22.475 16.3 6 21.175 38.2 22.875 17.75 7 20.7 20.724999999999998 38.574999999999996 20.0 8 20.625 26.950000000000003 27.1 25.324999999999996 9 21.725 24.175 30.099999999999998 24.0 10-14 23.849999999999998 28.49 26.229999999999997 21.43 15-19 23.115 27.905 28.015 20.965 20-24 23.715 27.98 27.345000000000002 20.96 25-29 23.23 28.215 27.305 21.25 30-34 22.509999999999998 28.249999999999996 28.225 21.015 35-39 23.56 28.144999999999996 27.575 20.72 40-44 23.64 27.965 27.735 20.66 45-49 23.46 27.284999999999997 28.175 21.08 50-54 23.294999999999998 28.765 27.534999999999997 20.405 55-59 23.365 28.115000000000002 27.98 20.54 60-64 22.595000000000002 28.044999999999998 28.12 21.240000000000002 65-69 23.445 27.639999999999997 28.199999999999996 20.715 70-74 23.885 27.500000000000004 27.985 20.630000000000003 75-79 23.57 27.810000000000002 27.889999999999997 20.73 80-84 23.244999999999997 28.18 27.750000000000004 20.825 85-89 24.555 27.834999999999997 27.615000000000002 19.994999999999997 90-94 23.575 27.884999999999998 28.01 20.53 95-99 23.9 27.445000000000004 28.095 20.560000000000002 100-104 24.115000000000002 28.07 27.534999999999997 20.28 105-109 24.255 27.900000000000002 27.62 20.225 110-114 24.212729035880162 28.265196753942735 27.269943347113767 20.25213086306334 115-119 24.853330564352838 27.36618036446706 27.298686464877214 20.481802606302892 120-124 23.820213254425795 28.121014233967657 27.794500280597926 20.264272231008622 125-129 24.864233873014264 28.082017966807086 27.351164797238997 19.702583362939656 130-134 25.365 28.244999999999997 26.995 19.395 135-139 25.240000000000002 27.860000000000003 27.07 19.830000000000002 140-144 25.465 27.694999999999997 27.025 19.814999999999998 145-149 25.564999999999998 28.095 26.44 19.900000000000002 150-151 25.4375 28.299999999999997 26.8 19.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 3.0 27 5.0 28 5.0 29 6.5 30 10.5 31 12.5 32 16.0 33 23.0 34 38.5 35 57.0 36 77.5 37 101.0 38 132.0 39 168.0 40 214.5 41 235.5 42 240.5 43 261.5 44 282.0 45 290.5 46 292.0 47 277.0 48 245.0 49 209.5 50 176.5 51 152.0 52 125.0 53 91.5 54 68.5 55 55.5 56 35.0 57 26.0 58 18.0 59 13.0 60 11.5 61 6.5 62 2.5 63 2.5 64 4.0 65 3.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.035 115-119 3.695 120-124 1.9949999999999999 125-129 1.485 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.825 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.9124999999999996 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 5.2 0.0 0.0 0.0 0.0 122-123 5.7875 0.0 0.0 0.0 0.0 124-125 6.25 0.0 0.0 0.0 0.0 126-127 6.75 0.0 0.0 0.0 0.0 128-129 7.25 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.212499999999999 0.0 0.0 0.0 0.0 134-135 8.787500000000001 0.0 0.0 0.0 0.0 136-137 9.425 0.0 0.0 0.0 0.0 138-139 10.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743272 spots for SRR7169817.sra Written 743272 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra Read 743263 spots for SRR7169817.sra Written 743263 spots for SRR7169817.sra SRR ids: ['SRR7169817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_10xk33qz SRR7169817.sra spots: 14865269 blocks: [[1, 743263], [743264, 1486526], [1486527, 2229789], [2229790, 2973052], [2973053, 3716315], [3716316, 4459578], [4459579, 5202841], [5202842, 5946104], [5946105, 6689367], [6689368, 7432630], [7432631, 8175893], [8175894, 8919156], [8919157, 9662419], [9662420, 10405682], [10405683, 11148945], [11148946, 11892208], [11892209, 12635471], [12635472, 13378734], [13378735, 14121997], [14121998, 14865269]] SRR7169817 file size 5015651 SRR7169817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169817 SRR7169817_1.fastq SRR7169817_2.fastq Input file: SRR7169817_1.fastq Paired file: SRR7169817_2.fastq trimmed: SRR7169817-trimmed-pair1.fastq, SRR7169817-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:37:34 2025 >> started Tue Feb 11 20:37:49 2025 >> done (15.949s) 14865269 read pairs processed; of these: 9772 ( 0.07%) short read pairs filtered out after trimming by size control 11719 ( 0.08%) empty read pairs filtered out after trimming by size control 14843778 (99.86%) read pairs available; of these: 7448884 (50.18%) trimmed read pairs available after processing 7394894 (49.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 3 0.00% 26 4 0.00% 27 9 0.00% 28 5 0.00% 29 1 0.00% 30 2 0.00% 31 5 0.00% 32 8 0.00% 33 7 0.00% 34 14 0.00% 35 19 0.00% 36 5 0.00% 37 22 0.00% 38 19 0.00% 39 30 0.00% 40 31 0.00% 41 47 0.00% 42 27 0.00% 43 39 0.00% 44 51 0.00% 45 55 0.00% 46 76 0.00% 47 79 0.00% 48 106 0.00% 49 122 0.00% 50 144 0.00% 51 173 0.00% 52 183 0.00% 53 217 0.00% 54 224 0.00% 55 242 0.00% 56 251 0.00% 57 276 0.00% 58 316 0.00% 59 354 0.00% 60 455 0.00% 61 575 0.00% 62 612 0.00% 63 711 0.00% 64 761 0.01% 65 834 0.01% 66 960 0.01% 67 1012 0.01% 68 1176 0.01% 69 1327 0.01% 70 1550 0.01% 71 1793 0.01% 72 2135 0.01% 73 2466 0.02% 74 2678 0.02% 75 2920 0.02% 76 3266 0.02% 77 3394 0.02% 78 3780 0.03% 79 4080 0.03% 80 4688 0.03% 81 5399 0.04% 82 5891 0.04% 83 6814 0.05% 84 8077 0.05% 85 9102 0.06% 86 9367 0.06% 87 10110 0.07% 88 10872 0.07% 89 11347 0.08% 90 12040 0.08% 91 13063 0.09% 92 14323 0.10% 93 15689 0.11% 94 16569 0.11% 95 17908 0.12% 96 18735 0.13% 97 19041 0.13% 98 19725 0.13% 99 20543 0.14% 100 21850 0.15% 101 22587 0.15% 102 24506 0.17% 103 25876 0.17% 104 27159 0.18% 105 28312 0.19% 106 29381 0.20% 107 30157 0.20% 108 30610 0.21% 109 31103 0.21% 110 32102 0.22% 111 33053 0.22% 112 34664 0.23% 113 36477 0.25% 114 37792 0.25% 115 39080 0.26% 116 40123 0.27% 117 40708 0.27% 118 41429 0.28% 119 41872 0.28% 120 42393 0.29% 121 43906 0.30% 122 45072 0.30% 123 47101 0.32% 124 48982 0.33% 125 51125 0.34% 126 52403 0.35% 127 53898 0.36% 128 54879 0.37% 129 56053 0.38% 130 57035 0.38% 131 58585 0.39% 132 59710 0.40% 133 62088 0.42% 134 64768 0.44% 135 67678 0.46% 136 69670 0.47% 137 72765 0.49% 138 75387 0.51% 139 79472 0.54% 140 83622 0.56% 141 90103 0.61% 142 97090 0.65% 143 107186 0.72% 144 122317 0.82% 145 143872 0.97% 146 174905 1.18% 147 229288 1.54% 148 338266 2.28% 149 645962 4.35% 150 3315488 22.34% 151 7394894 49.82% 14843778 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=42 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=247.78 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=39 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=163.50 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7169817 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:38:38 Started mapping on | Feb 11 20:38:39 Finished on | Feb 11 20:39:51 Mapping speed, Million of reads per hour | 742.19 Number of input reads | 14843778 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14305525 Uniquely mapped reads % | 96.37% Average mapped length | 290.58 Number of splices: Total | 13486992 Number of splices: Annotated (sjdb) | 13258000 Number of splices: GT/AG | 13287608 Number of splices: GC/AG | 160964 Number of splices: AT/AC | 10820 Number of splices: Non-canonical | 27600 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260607 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 23178 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 287952 287952 287952 N_multimapping 260607 260607 260607 N_noFeature 358200 14154633 433024 N_ambiguous 131012 729 54409 UnstrandedReadsAssigned:13816313 PositiveStrandReadsAssigned:150163 NegativeStrandReadsAssigned:13818092 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169817 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169817-trimmed-pair1.fastq SRR7169817-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,843,778 reads, 13,730,655 reads pseudoaligned [quant] estimated average fragment length: 217.482 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7169817.ke.tsv 34699 SRR7169817.se.tsv 87100 total ==> SRR7169817.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.52 278 11.8218 Potri.005G024800.1.v4.1 1035 818.518 40 3.74377 Potri.004G059700.1.v4.1 961 744.524 3 0.308688 Potri.007G009000.2.v4.1 1416 1199.52 0 0 Potri.003G141000.2.v4.1 2943 2726.52 267 7.50205 Potri.016G087400.1.v4.1 270 91.2288 1188 997.612 Potri.015G069301.1.v4.1 564 349.866 0 0 Potri.010G195200.1.v4.1 1773 1556.52 13 0.639832 Potri.012G127500.1.v4.1 977 760.518 4657 469.109 ==> SRR7169817.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 968 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169817 completed mapping pipeline successfully