Starting /dee2/code/volunteer_pipeline.sh SRR7169818 current disk space = 3053170122752 free memory = 1412436292 SRR7169818 SRAfilesize 9448408754d2c4e2339b0414e3510723 SRR7169818.sra SRR7169818.sra file validated SRR7169818 is paired end SRR7169818 is conventional basespace SRR7169818 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.17575 30.0 18.0 32.0 18.0 33.0 2 25.4185 27.0 18.0 30.0 18.0 33.0 3 28.907 30.0 27.0 31.0 18.0 33.0 4 31.887 33.0 32.0 33.0 31.0 33.0 5 32.24975 33.0 33.0 33.0 32.0 33.0 6 36.52525 38.0 37.0 38.0 34.0 38.0 7 36.98325 38.0 37.0 38.0 35.0 38.0 8 37.42075 38.0 38.0 38.0 37.0 38.0 9 37.53025 38.0 38.0 38.0 37.0 38.0 10-14 37.547000000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.61315 38.0 38.0 38.0 38.0 38.0 20-24 37.55605 38.0 38.0 38.0 38.0 38.0 25-29 37.54975 38.0 38.0 38.0 38.0 38.0 30-34 37.58305 38.0 38.0 38.0 38.0 38.0 35-39 37.48225 38.0 38.0 38.0 37.8 38.0 40-44 37.4244 38.0 38.0 38.0 37.6 38.0 45-49 37.382400000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.2929 38.0 38.0 38.0 36.8 38.0 55-59 37.16605 38.0 38.0 38.0 36.6 38.0 60-64 36.98335 38.0 38.0 38.0 35.8 38.0 65-69 37.1126 38.0 38.0 38.0 36.4 38.0 70-74 37.1726 38.0 38.0 38.0 36.4 38.0 75-79 37.031000000000006 38.0 38.0 38.0 36.2 38.0 80-84 36.9991 38.0 38.0 38.0 36.0 38.0 85-89 36.94815 38.0 38.0 38.0 36.0 38.0 90-94 36.73095000000001 38.0 38.0 38.0 35.4 38.0 95-99 36.88835 38.0 38.0 38.0 36.0 38.0 100-104 36.802749999999996 38.0 38.0 38.0 35.6 38.0 105-109 36.6835 38.0 38.0 38.0 35.2 38.0 110-114 36.5607 38.0 38.0 38.0 34.6 38.0 115-119 36.37545 38.0 38.0 38.0 34.0 38.0 120-124 36.2568 38.0 38.0 38.0 34.2 38.0 125-129 36.09805 38.0 38.0 38.0 33.8 38.0 130-134 35.87785 38.0 37.0 38.0 33.0 38.0 135-139 35.5674 38.0 36.2 38.0 31.4 38.0 140-144 35.385000000000005 38.0 36.0 38.0 31.0 38.0 145-149 35.07355 38.0 36.0 38.0 30.6 38.0 150-151 31.028625 36.5 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 2.0 15 2.0 16 2.0 17 3.0 18 3.0 19 7.0 20 3.0 21 2.0 22 2.0 23 6.0 24 1.0 25 9.0 26 12.0 27 13.0 28 18.0 29 19.0 30 37.0 31 38.0 32 62.0 33 88.0 34 137.0 35 239.0 36 622.0 37 2668.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.175 9.6 14.174999999999999 43.05 2 20.815611708781585 15.261446084563424 34.250688016012006 29.67225419064298 3 20.849999999999998 19.0 24.575 35.575 4 22.85 26.05 21.875 29.225 5 22.725 32.225 24.025 21.025 6 20.225 34.825 25.2 19.75 7 15.375 25.224999999999998 40.949999999999996 18.45 8 19.075 25.624999999999996 30.95 24.349999999999998 9 17.724999999999998 25.1 32.824999999999996 24.349999999999998 10-14 19.115 30.830000000000002 26.950000000000003 23.105 15-19 19.695 29.04 27.529999999999998 23.735 20-24 19.78 28.76 27.55 23.91 25-29 19.85 29.64 26.815 23.695 30-34 19.355 29.215000000000003 27.589999999999996 23.84 35-39 20.905 28.51 27.089999999999996 23.494999999999997 40-44 20.43 28.77 27.71 23.09 45-49 20.465 28.715000000000003 27.134999999999998 23.685000000000002 50-54 20.485 28.689999999999998 27.310000000000002 23.515 55-59 20.21 29.145 26.884999999999998 23.76 60-64 20.185 29.049999999999997 27.284999999999997 23.48 65-69 20.095 28.83 27.24 23.835 70-74 20.155 28.945 26.895000000000003 24.005000000000003 75-79 20.080000000000002 29.020000000000003 27.305 23.595 80-84 20.595 28.7 26.915 23.79 85-89 20.380000000000003 29.345 26.779999999999998 23.494999999999997 90-94 20.815 28.720000000000002 27.115000000000002 23.35 95-99 20.695 28.725 27.185 23.395 100-104 20.48 29.080000000000002 26.91 23.53 105-109 20.810000000000002 28.735 27.065 23.39 110-114 20.76622986896069 28.623587076122835 27.043112933880163 23.56707012103631 115-119 21.095 28.725 26.25 23.93 120-124 21.075 28.43 26.8 23.695 125-129 20.45 28.93 26.695 23.925 130-134 20.705000000000002 29.015 26.44 23.84 135-139 20.695 28.92 26.015 24.37 140-144 21.555 28.349999999999998 25.88 24.215 145-149 21.58 28.754999999999995 25.924999999999997 23.74 150-151 20.875 28.7 25.8125 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 1.0 26 2.5 27 5.5 28 8.5 29 13.0 30 23.0 31 29.0 32 33.0 33 37.0 34 46.5 35 67.5 36 91.5 37 114.0 38 135.0 39 158.5 40 182.0 41 212.5 42 241.0 43 258.5 44 265.5 45 257.0 46 255.0 47 244.5 48 230.0 49 203.0 50 164.5 51 153.0 52 139.0 53 120.0 54 83.5 55 56.5 56 44.5 57 28.5 58 25.0 59 19.0 60 12.0 61 6.5 62 4.5 63 3.5 64 1.5 65 1.5 66 3.0 67 3.0 68 2.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69864389753893 99.25 2 0.2762430939226519 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025113008538422906 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 8 0.2 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.175 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.4125 0.0 0.0 0.0 0.0 110-111 3.8 0.0 0.0 0.0 0.0 112-113 4.125 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 4.975 0.0 0.0 0.0 0.0 118-119 5.6625 0.0 0.0 0.0 0.0 120-121 6.2875 0.0 0.0 0.0 0.0 122-123 6.824999999999999 0.0 0.0 0.0 0.0 124-125 7.225 0.0 0.0 0.0 0.0 126-127 7.825 0.0 0.0 0.0 0.0 128-129 8.45 0.0 0.0 0.0 0.0 130-131 9.025 0.0 0.0 0.0 0.0 132-133 9.6375 0.0 0.0 0.0 0.0 134-135 10.3125 0.0 0.0 0.0 0.0 136-137 10.9 0.0 0.0 0.0 0.0 138-139 11.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAAA 10 0.006830828 145.0 7 CTCAACC 10 0.006830828 145.0 1 >>END_MODULE SRR7169818 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169818_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.935 33.0 33.0 34.0 32.0 34.0 2 33.00075 34.0 33.0 34.0 32.0 34.0 3 33.04975 34.0 33.0 34.0 32.0 34.0 4 33.051 34.0 33.0 34.0 33.0 34.0 5 33.01525 34.0 33.0 34.0 33.0 34.0 6 37.2015 38.0 38.0 38.0 37.0 38.0 7 37.2305 38.0 38.0 38.0 38.0 38.0 8 37.17925 38.0 38.0 38.0 37.0 38.0 9 37.202 38.0 38.0 38.0 37.0 38.0 10-14 37.2219 38.0 38.0 38.0 37.0 38.0 15-19 37.0964 38.0 38.0 38.0 36.8 38.0 20-24 37.139 38.0 38.0 38.0 37.0 38.0 25-29 37.09545000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.03335 38.0 38.0 38.0 36.4 38.0 35-39 37.032450000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.106500000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.0382 38.0 38.0 38.0 37.0 38.0 50-54 37.0294 38.0 38.0 38.0 36.6 38.0 55-59 36.7453 38.0 38.0 38.0 35.8 38.0 60-64 36.63895 38.0 38.0 38.0 35.2 38.0 65-69 36.854949999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.8352 38.0 38.0 38.0 36.0 38.0 75-79 36.04435 38.0 38.0 38.0 33.8 38.0 80-84 36.555699999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.493399999999994 38.0 37.8 38.0 34.4 38.0 90-94 36.52175 38.0 38.0 38.0 34.8 38.0 95-99 36.55415 38.0 38.0 38.0 34.8 38.0 100-104 36.40260000000001 38.0 38.0 38.0 34.4 38.0 105-109 35.05159999999999 38.0 37.0 38.0 27.4 38.0 110-114 34.61255 38.0 37.0 38.0 27.6 38.0 115-119 33.9443 38.0 36.8 38.0 19.0 38.0 120-124 33.94655 38.0 36.4 38.0 22.2 38.0 125-129 34.31155 38.0 36.0 38.0 23.8 38.0 130-134 34.806349999999995 38.0 35.6 38.0 26.8 38.0 135-139 34.46435 38.0 35.2 38.0 25.2 38.0 140-144 34.4955 38.0 35.8 38.0 27.0 38.0 145-149 33.03275000000001 38.0 33.4 38.0 18.8 38.0 150-151 29.743125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 3.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 3.0 13 3.0 14 0.0 15 1.0 16 5.0 17 4.0 18 8.0 19 8.0 20 4.0 21 8.0 22 10.0 23 11.0 24 12.0 25 16.0 26 17.0 27 21.0 28 42.0 29 58.0 30 70.0 31 71.0 32 111.0 33 124.0 34 147.0 35 243.0 36 556.0 37 2427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.349999999999998 16.35 22.625 30.675 2 25.93148287071768 24.006001500375092 31.857964491122782 18.204551137784446 3 21.885942971485743 26.163081540770385 31.065532766383193 20.885442721360683 4 22.536268134067033 32.716358179089546 24.73736868434217 20.01000500250125 5 26.388194097048522 33.71685842921461 23.036518259129565 16.858429214607305 6 20.349999999999998 37.45 22.7 19.5 7 19.525000000000002 19.975 41.449999999999996 19.05 8 22.925 25.25 27.750000000000004 24.075 9 21.625 24.25 30.7 23.425 10-14 23.135 28.4 26.805 21.66 15-19 23.058458768815324 27.244086612991946 28.22423363504526 21.473220983147474 20-24 22.835 28.33 27.935 20.9 25-29 22.905 27.560000000000002 28.075 21.46 30-34 22.74 27.61 28.395 21.255 35-39 23.41 27.51 28.634999999999998 20.445 40-44 23.21 27.389999999999997 28.544999999999998 20.855 45-49 23.232323232323232 27.972797279727974 28.462846284628462 20.332033203320332 50-54 23.16810883809333 27.984794678137348 27.78972640424148 21.057370079527836 55-59 23.293494024103616 27.189078361754266 28.659298894834222 20.858128719307896 60-64 23.926196309815488 27.826391319565978 27.716385819290963 20.531026551327567 65-69 23.21 27.63 28.325 20.835 70-74 23.5220503579116 27.63177654302448 28.05226009911398 20.793912999949942 75-79 22.896958600345847 27.591292849150644 28.944156240463837 20.56759231003967 80-84 24.029686089660014 27.65520008023267 28.31711964697623 19.99799418313108 85-89 23.400000000000002 27.36 28.694999999999997 20.544999999999998 90-94 23.51617580879044 27.60638031901595 28.056402820141006 20.821041052052603 95-99 23.86357953693054 27.904185627844175 28.399259888983348 19.832974946241936 100-104 24.043415195318364 27.90976841894663 27.81473515730506 20.23208122842995 105-109 23.72933251684017 27.556644213104715 28.434374362114717 20.279648907940395 110-114 24.569394272551175 27.490707292811894 27.872886236322707 20.067012198314224 115-119 24.659211927582533 28.892438764643234 26.911608093716723 19.536741214057507 120-124 24.935461777567042 27.933196354248985 27.954270059533215 19.177071808650755 125-129 25.0232366002272 28.24021480945988 27.161003821129814 19.575544769183104 130-134 25.364095891096543 27.34097392522897 27.516140333316653 19.77878985035784 135-139 25.89 27.35 27.169999999999998 19.59 140-144 26.125 27.975 26.974999999999998 18.925 145-149 26.185000000000002 27.584999999999997 26.545 19.685 150-151 26.434040416718968 27.312664742061 27.237354085603112 19.01594075561692 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 1.5 25 0.0 26 2.0 27 3.0 28 4.0 29 6.0 30 15.0 31 26.5 32 32.5 33 42.5 34 53.5 35 64.0 36 75.5 37 103.0 38 142.0 39 172.0 40 191.0 41 224.0 42 254.0 43 269.5 44 293.0 45 281.0 46 261.5 47 254.5 48 232.5 49 204.5 50 172.0 51 153.0 52 127.5 53 96.5 54 73.0 55 52.5 56 36.0 57 20.5 58 13.5 59 11.0 60 8.0 61 3.5 62 3.0 63 4.5 64 3.5 65 2.0 66 2.5 67 2.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.034999999999999996 55-59 0.015 60-64 0.005 65-69 0.0 70-74 0.11499999999999999 75-79 1.69 80-84 0.29 85-89 0.0 90-94 0.005 95-99 0.015 100-104 0.034999999999999996 105-109 2.02 110-114 4.495 115-119 6.1 120-124 5.095000000000001 125-129 3.17 130-134 0.095 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74893296510167 99.325 2 0.20085362791865427 0.4 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025106703489831784 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 1.9 0.0 0.0 0.0 0.0 100-101 2.15 0.0 0.0 0.0 0.0 102-103 2.55 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.1125 0.0 0.0 0.0 0.0 108-109 3.3875 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.5125 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 6.05 0.0 0.0 0.0 0.0 122-123 6.512499999999999 0.0 0.0 0.0 0.0 124-125 6.9 0.0 0.0 0.0 0.0 126-127 7.5 0.0 0.0 0.0 0.0 128-129 8.1125 0.0 0.0 0.0 0.0 130-131 8.662500000000001 0.0 0.0 0.0 0.0 132-133 9.3125 0.0 0.0 0.0 0.0 134-135 9.95 0.0 0.0 0.0 0.0 136-137 10.5625 0.0 0.0 0.0 0.0 138-139 11.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593122 spots for SRR7169818.sra Written 593122 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra Read 593105 spots for SRR7169818.sra Written 593105 spots for SRR7169818.sra SRR ids: ['SRR7169818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5z0yvk08 SRR7169818.sra spots: 11862117 blocks: [[1, 593105], [593106, 1186210], [1186211, 1779315], [1779316, 2372420], [2372421, 2965525], [2965526, 3558630], [3558631, 4151735], [4151736, 4744840], [4744841, 5337945], [5337946, 5931050], [5931051, 6524155], [6524156, 7117260], [7117261, 7710365], [7710366, 8303470], [8303471, 8896575], [8896576, 9489680], [9489681, 10082785], [10082786, 10675890], [10675891, 11268995], [11268996, 11862117]] SRR7169818 file size 3997981 SRR7169818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169818 SRR7169818_1.fastq SRR7169818_2.fastq Input file: SRR7169818_1.fastq Paired file: SRR7169818_2.fastq trimmed: SRR7169818-trimmed-pair1.fastq, SRR7169818-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:18:25 2025 >> started Tue Feb 11 20:18:39 2025 >> done (13.263s) 11862117 read pairs processed; of these: 16451 ( 0.14%) short read pairs filtered out after trimming by size control 51775 ( 0.44%) empty read pairs filtered out after trimming by size control 11793891 (99.42%) read pairs available; of these: 5482367 (46.48%) trimmed read pairs available after processing 6311524 (53.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 5 0.00% 21 8 0.00% 22 2 0.00% 23 7 0.00% 24 2 0.00% 25 5 0.00% 26 6 0.00% 27 6 0.00% 28 5 0.00% 29 8 0.00% 30 2 0.00% 31 6 0.00% 32 9 0.00% 33 20 0.00% 34 16 0.00% 35 20 0.00% 36 16 0.00% 37 32 0.00% 38 31 0.00% 39 25 0.00% 40 36 0.00% 41 47 0.00% 42 56 0.00% 43 59 0.00% 44 71 0.00% 45 79 0.00% 46 108 0.00% 47 101 0.00% 48 124 0.00% 49 147 0.00% 50 161 0.00% 51 200 0.00% 52 233 0.00% 53 300 0.00% 54 254 0.00% 55 251 0.00% 56 296 0.00% 57 316 0.00% 58 448 0.00% 59 454 0.00% 60 484 0.00% 61 566 0.00% 62 618 0.01% 63 697 0.01% 64 772 0.01% 65 803 0.01% 66 899 0.01% 67 990 0.01% 68 1110 0.01% 69 1225 0.01% 70 1354 0.01% 71 1512 0.01% 72 1829 0.02% 73 2240 0.02% 74 2298 0.02% 75 2627 0.02% 76 3263 0.03% 77 3707 0.03% 78 3657 0.03% 79 3660 0.03% 80 4029 0.03% 81 4455 0.04% 82 4934 0.04% 83 5585 0.05% 84 6659 0.06% 85 7817 0.07% 86 8006 0.07% 87 8660 0.07% 88 9322 0.08% 89 9663 0.08% 90 10420 0.09% 91 10839 0.09% 92 11756 0.10% 93 12555 0.11% 94 13581 0.12% 95 14582 0.12% 96 15507 0.13% 97 16125 0.14% 98 16658 0.14% 99 17220 0.15% 100 18252 0.15% 101 18905 0.16% 102 19839 0.17% 103 20928 0.18% 104 21648 0.18% 105 22971 0.19% 106 24179 0.21% 107 24599 0.21% 108 25251 0.21% 109 26272 0.22% 110 26698 0.23% 111 27400 0.23% 112 28388 0.24% 113 29499 0.25% 114 30442 0.26% 115 31739 0.27% 116 32742 0.28% 117 33611 0.28% 118 34481 0.29% 119 34953 0.30% 120 35445 0.30% 121 35991 0.31% 122 37052 0.31% 123 38159 0.32% 124 39261 0.33% 125 40530 0.34% 126 42304 0.36% 127 43616 0.37% 128 44253 0.38% 129 45832 0.39% 130 46302 0.39% 131 47376 0.40% 132 47416 0.40% 133 48728 0.41% 134 50091 0.42% 135 50920 0.43% 136 53693 0.46% 137 55194 0.47% 138 57303 0.49% 139 60190 0.51% 140 64078 0.54% 141 67077 0.57% 142 70729 0.60% 143 76096 0.65% 144 85190 0.72% 145 97186 0.82% 146 113834 0.97% 147 145866 1.24% 148 214799 1.82% 149 460006 3.90% 150 2388385 20.25% 151 6311524 53.52% 11793891 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=204.38 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=53.06 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=13.6 sequence=TGTTGGTGGTGG SRR7169818 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:19:23 Started mapping on | Feb 11 20:19:23 Finished on | Feb 11 20:20:34 Mapping speed, Million of reads per hour | 598.00 Number of input reads | 11793891 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11358044 Uniquely mapped reads % | 96.30% Average mapped length | 290.52 Number of splices: Total | 10439680 Number of splices: Annotated (sjdb) | 10257803 Number of splices: GT/AG | 10283667 Number of splices: GC/AG | 122565 Number of splices: AT/AC | 8678 Number of splices: Non-canonical | 24770 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210790 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 14586 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 237285 237285 237285 N_multimapping 210790 210790 210790 N_noFeature 304612 11240161 358319 N_ambiguous 108602 703 43924 UnstrandedReadsAssigned:10944830 PositiveStrandReadsAssigned:117180 NegativeStrandReadsAssigned:10955801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169818 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169818-trimmed-pair1.fastq SRR7169818-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,793,891 reads, 10,911,128 reads pseudoaligned [quant] estimated average fragment length: 216.863 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7169818.ke.tsv 34699 SRR7169818.se.tsv 87100 total ==> SRR7169818.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.14 239 13.0384 Potri.005G024800.1.v4.1 1035 819.137 35 4.20073 Potri.004G059700.1.v4.1 961 745.142 6 0.791636 Potri.007G009000.2.v4.1 1416 1200.14 0 0 Potri.003G141000.2.v4.1 2943 2727.14 233 8.39967 Potri.016G087400.1.v4.1 270 92.3895 933 992.824 Potri.015G069301.1.v4.1 564 350.693 0 0 Potri.010G195200.1.v4.1 1773 1557.14 26 1.64157 Potri.012G127500.1.v4.1 977 761.142 4471 577.5 ==> SRR7169818.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1190 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7169818 completed mapping pipeline successfully