Starting /dee2/code/volunteer_pipeline.sh SRR7169820 current disk space = 3052923121664 free memory = 1422671704 SRR7169820 SRAfilesize d0647566e5b756a7a42cc1cf6edeb103 SRR7169820.sra SRR7169820.sra file validated SRR7169820 is paired end SRR7169820 is conventional basespace SRR7169820 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.4555 18.0 18.0 18.0 18.0 28.0 2 24.82325 27.0 25.0 27.0 18.0 28.0 3 24.61975 25.0 18.0 29.0 18.0 31.0 4 29.05225 29.0 27.0 31.0 27.0 33.0 5 30.83075 32.0 31.0 33.0 27.0 33.0 6 35.19925 37.0 34.0 38.0 31.0 38.0 7 36.59675 38.0 37.0 38.0 34.0 38.0 8 36.8725 38.0 37.0 38.0 35.0 38.0 9 37.2705 38.0 38.0 38.0 36.0 38.0 10-14 37.454499999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.552350000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.7029 38.0 38.0 38.0 38.0 38.0 25-29 37.6521 38.0 38.0 38.0 38.0 38.0 30-34 37.5945 38.0 38.0 38.0 37.8 38.0 35-39 37.493849999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.4707 38.0 38.0 38.0 37.6 38.0 45-49 37.44345 38.0 38.0 38.0 37.0 38.0 50-54 37.276650000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.4035 38.0 38.0 38.0 37.0 38.0 60-64 37.39215 38.0 38.0 38.0 37.0 38.0 65-69 37.0703 38.0 38.0 38.0 35.8 38.0 70-74 37.220150000000004 38.0 38.0 38.0 36.4 38.0 75-79 37.1197 38.0 38.0 38.0 36.0 38.0 80-84 36.837900000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.84195 38.0 38.0 38.0 35.0 38.0 90-94 36.7727 38.0 38.0 38.0 35.0 38.0 95-99 36.732049999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.6503 38.0 38.0 38.0 34.6 38.0 105-109 36.53215 38.0 37.8 38.0 34.0 38.0 110-114 36.217200000000005 38.0 37.4 38.0 33.8 38.0 115-119 35.549850000000006 38.0 36.0 38.0 30.2 38.0 120-124 36.1984 38.0 37.0 38.0 33.4 38.0 125-129 35.22835 38.0 35.4 38.0 27.2 38.0 130-134 35.1288 38.0 35.4 38.0 28.2 38.0 135-139 35.413149999999995 38.0 35.8 38.0 30.4 38.0 140-144 34.763400000000004 38.0 35.2 38.0 28.0 38.0 145-149 34.4769 38.0 35.0 38.0 27.2 38.0 150-151 30.6235 36.5 29.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 2.0 18 1.0 19 4.0 20 0.0 21 2.0 22 3.0 23 4.0 24 4.0 25 5.0 26 8.0 27 18.0 28 7.0 29 30.0 30 23.0 31 49.0 32 65.0 33 114.0 34 169.0 35 404.0 36 1276.0 37 1807.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 9.439676930843008 58.68248359414437 7.7990913679959615 24.078748107016658 2 24.099999999999998 16.25 32.225 27.425 3 22.625 19.225 25.0 33.15 4 24.275 28.4 21.375 25.95 5 23.65 32.0 23.674999999999997 20.674999999999997 6 20.5 34.55 23.95 21.0 7 14.7 26.625 40.8 17.875 8 18.675 26.450000000000003 29.65 25.224999999999998 9 17.825 24.85 34.025 23.3 10-14 20.22 29.099999999999998 27.66 23.02 15-19 20.365 28.685 27.295 23.655 20-24 20.345 29.175 27.46 23.02 25-29 20.13 28.82 27.810000000000002 23.24 30-34 20.34 29.03 27.165 23.465 35-39 19.785 29.154999999999998 27.339999999999996 23.72 40-44 20.265 29.099999999999998 27.015 23.62 45-49 20.75 28.410000000000004 27.465 23.375 50-54 20.135 29.15 27.33 23.385 55-59 20.53 28.194999999999997 27.235 24.04 60-64 20.655 28.87 27.685 22.79 65-69 20.549999999999997 28.29 27.095000000000002 24.065 70-74 20.16 29.01 26.840000000000003 23.990000000000002 75-79 20.48 28.74 27.055 23.724999999999998 80-84 20.225 28.64 27.025 24.11 85-89 20.385 28.26 27.894999999999996 23.46 90-94 20.97 28.095 27.38 23.555 95-99 20.66 28.744999999999997 27.089999999999996 23.505000000000003 100-104 21.035 28.335 27.305 23.325000000000003 105-109 20.735 28.64 26.985 23.64 110-114 21.28941554529022 28.67041574613376 26.767423177344845 23.27274553123117 115-119 21.175 29.020000000000003 26.625 23.18 120-124 21.32 28.095 27.115000000000002 23.47 125-129 21.0 28.315 26.729999999999997 23.955000000000002 130-134 21.175 28.365000000000002 26.61 23.849999999999998 135-139 20.845 28.265 26.290000000000003 24.6 140-144 21.709999999999997 28.025 26.31 23.955000000000002 145-149 21.04 29.485 25.679999999999996 23.794999999999998 150-151 20.474999999999998 27.425 26.2875 25.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.5 25 3.5 26 3.5 27 5.0 28 8.0 29 11.0 30 18.5 31 26.5 32 35.5 33 45.5 34 58.0 35 73.0 36 109.0 37 122.5 38 130.0 39 162.0 40 195.0 41 208.0 42 236.5 43 282.5 44 286.0 45 266.5 46 246.5 47 243.0 48 229.0 49 214.0 50 174.5 51 120.5 52 104.5 53 91.5 54 66.5 55 49.5 56 37.5 57 26.5 58 22.0 59 19.0 60 15.5 61 10.0 62 5.0 63 4.5 64 4.5 65 4.5 66 3.0 67 4.5 68 4.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.42 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.0250000000000004 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.8375 0.0 0.0 0.0 0.0 116-117 4.324999999999999 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.175000000000001 0.0 0.0 0.0 0.0 122-123 5.75 0.0 0.0 0.0 0.0 124-125 6.3125 0.0 0.0 0.0 0.0 126-127 6.85 0.0 0.0 0.0 0.0 128-129 7.35 0.0 0.0 0.0 0.0 130-131 7.8125 0.0 0.0 0.0 0.0 132-133 8.5 0.0 0.0 0.0 0.0 134-135 9.25 0.0 0.0 0.0 0.0 136-137 10.175 0.0 0.0 0.0 0.0 138-139 10.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAGAA 10 0.006830828 145.0 1 GAAGGCC 10 0.006830828 145.0 5 >>END_MODULE SRR7169820 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169820_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82475 33.0 33.0 34.0 32.0 34.0 2 32.94 33.0 33.0 34.0 32.0 34.0 3 32.269 33.0 33.0 34.0 31.0 34.0 4 32.16025 33.0 33.0 34.0 31.0 34.0 5 32.94275 33.0 33.0 34.0 32.0 34.0 6 37.37175 38.0 38.0 38.0 37.0 38.0 7 37.469 38.0 38.0 38.0 37.0 38.0 8 37.51825 38.0 38.0 38.0 38.0 38.0 9 37.4505 38.0 38.0 38.0 38.0 38.0 10-14 37.444399999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.4657 38.0 38.0 38.0 38.0 38.0 20-24 37.016949999999994 38.0 38.0 38.0 35.6 38.0 25-29 37.3636 38.0 38.0 38.0 37.2 38.0 30-34 37.37689999999999 38.0 38.0 38.0 37.6 38.0 35-39 37.32785 38.0 38.0 38.0 37.2 38.0 40-44 37.2939 38.0 38.0 38.0 37.0 38.0 45-49 37.36685 38.0 38.0 38.0 37.0 38.0 50-54 37.3309 38.0 38.0 38.0 37.0 38.0 55-59 37.2132 38.0 38.0 38.0 37.0 38.0 60-64 36.995400000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.9621 38.0 38.0 38.0 36.0 38.0 70-74 36.985 38.0 38.0 38.0 36.0 38.0 75-79 36.722249999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.303549999999994 38.0 37.4 38.0 33.8 38.0 85-89 36.79074999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.88945 38.0 38.0 38.0 36.0 38.0 95-99 36.8085 38.0 38.0 38.0 35.6 38.0 100-104 36.58355 38.0 38.0 38.0 34.8 38.0 105-109 35.33645 38.0 36.8 38.0 28.6 38.0 110-114 35.15915 38.0 37.0 38.0 30.0 38.0 115-119 34.59630000000001 38.0 37.0 38.0 27.0 38.0 120-124 34.3972 38.0 36.0 38.0 24.6 38.0 125-129 34.487350000000006 38.0 36.0 38.0 25.4 38.0 130-134 35.00125 38.0 36.0 38.0 27.8 38.0 135-139 35.03955 38.0 36.0 38.0 29.4 38.0 140-144 34.84755 38.0 35.8 38.0 29.0 38.0 145-149 34.17805 38.0 34.4 38.0 26.8 38.0 150-151 29.8985 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 2.0 15 2.0 16 3.0 17 1.0 18 3.0 19 6.0 20 8.0 21 5.0 22 4.0 23 13.0 24 10.0 25 15.0 26 14.0 27 18.0 28 34.0 29 45.0 30 48.0 31 60.0 32 86.0 33 128.0 34 135.0 35 261.0 36 608.0 37 2482.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 20.849999999999998 14.499999999999998 28.15 2 26.974999999999998 26.35 29.349999999999998 17.325 3 19.025 29.325000000000003 30.5 21.15 4 23.974999999999998 33.4 22.925 19.7 5 24.9 34.949999999999996 22.45 17.7 6 21.375 37.075 22.625 18.925 7 20.1 20.849999999999998 39.15 19.900000000000002 8 23.075000000000003 25.174999999999997 27.1 24.65 9 22.650000000000002 24.375 28.475 24.5 10-14 24.085 28.405 25.66 21.85 15-19 23.585 27.305 27.98 21.13 20-24 23.05 27.935 27.72 21.295 25-29 23.41 27.589999999999996 27.775 21.224999999999998 30-34 22.925 28.46 27.265 21.349999999999998 35-39 24.099999999999998 28.165000000000003 27.125 20.61 40-44 23.474999999999998 28.134999999999998 27.43 20.96 45-49 23.5 27.62 27.310000000000002 21.57 50-54 23.635 27.985 27.16 21.22 55-59 24.05 27.415 27.43 21.105 60-64 23.415 27.555000000000003 27.779999999999998 21.25 65-69 23.630000000000003 27.639999999999997 27.810000000000002 20.919999999999998 70-74 23.655 27.215 28.125 21.005 75-79 23.482250907624042 27.838846308995564 28.343081887858006 20.33582089552239 80-84 24.131351677043583 27.811809600321354 27.51556537457321 20.541273348061857 85-89 23.89 27.705000000000002 27.92 20.485 90-94 23.515 27.26 28.125 21.099999999999998 95-99 23.89 27.815 27.685 20.61 100-104 24.102051025512754 27.953976988494244 27.20360180090045 20.740370185092548 105-109 24.3157576977259 28.10424632722882 27.04266452002415 20.537331455021132 110-114 23.897720841693676 27.812934094767712 27.545403097185776 20.743941966352832 115-119 24.204688154039346 27.794056090414397 27.370238593553786 20.631017161992464 120-124 24.244940321743645 27.690710949662687 27.39491437467566 20.669434353918007 125-129 25.08425364234977 26.935241354280087 27.92554570436045 20.054959299009695 130-134 25.678875510101264 27.144944329689153 26.80739583858129 20.368784321628294 135-139 25.324999999999996 27.415 26.775 20.485 140-144 25.955000000000002 27.495000000000005 26.915 19.634999999999998 145-149 26.375 26.935 27.0 19.689999999999998 150-151 26.1125 27.0125 26.575 20.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.0 26 1.0 27 1.0 28 2.0 29 4.0 30 7.0 31 8.0 32 15.5 33 25.0 34 33.0 35 48.0 36 63.0 37 86.0 38 117.0 39 158.0 40 205.5 41 233.5 42 260.0 43 280.0 44 300.0 45 299.5 46 270.5 47 267.0 48 247.5 49 210.5 50 181.5 51 157.0 52 133.0 53 100.5 54 65.0 55 49.0 56 39.5 57 27.5 58 25.0 59 18.0 60 13.0 61 8.5 62 6.0 63 6.0 64 7.0 65 6.0 66 2.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.84 80-84 0.42 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.62 110-114 2.815 115-119 4.44 120-124 3.65 125-129 3.565 130-134 0.755 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.9875 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.7 0.0 0.0 0.0 0.0 116-117 4.2125 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 6.074999999999999 0.0 0.0 0.0 0.0 126-127 6.574999999999999 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.274999999999999 0.0 0.0 0.0 0.0 134-135 9.0 0.0 0.0 0.0 0.0 136-137 9.95 0.0 0.0 0.0 0.0 138-139 10.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAGG 10 0.007020917 143.675 3 AAAAAAA 65 0.00811574 13.262308 20-24 >>END_MODULE Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra Read 568404 spots for SRR7169820.sra Written 568404 spots for SRR7169820.sra SRR ids: ['SRR7169820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fza7ztiu SRR7169820.sra spots: 11368080 blocks: [[1, 568404], [568405, 1136808], [1136809, 1705212], [1705213, 2273616], [2273617, 2842020], [2842021, 3410424], [3410425, 3978828], [3978829, 4547232], [4547233, 5115636], [5115637, 5684040], [5684041, 6252444], [6252445, 6820848], [6820849, 7389252], [7389253, 7957656], [7957657, 8526060], [8526061, 9094464], [9094465, 9662868], [9662869, 10231272], [10231273, 10799676], [10799677, 11368080]] SRR7169820 file size 3830568 SRR7169820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169820 SRR7169820_1.fastq SRR7169820_2.fastq Input file: SRR7169820_1.fastq Paired file: SRR7169820_2.fastq trimmed: SRR7169820-trimmed-pair1.fastq, SRR7169820-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:40:12 2025 >> started Tue Feb 11 20:40:25 2025 >> done (13.053s) 11368080 read pairs processed; of these: 5796 ( 0.05%) short read pairs filtered out after trimming by size control 10599 ( 0.09%) empty read pairs filtered out after trimming by size control 11351685 (99.86%) read pairs available; of these: 5580850 (49.16%) trimmed read pairs available after processing 5770835 (50.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 5 0.00% 23 1 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 5 0.00% 30 7 0.00% 31 11 0.00% 32 6 0.00% 33 9 0.00% 34 7 0.00% 35 8 0.00% 36 13 0.00% 37 12 0.00% 38 11 0.00% 39 15 0.00% 40 19 0.00% 41 18 0.00% 42 17 0.00% 43 17 0.00% 44 21 0.00% 45 26 0.00% 46 39 0.00% 47 53 0.00% 48 51 0.00% 49 58 0.00% 50 58 0.00% 51 76 0.00% 52 93 0.00% 53 95 0.00% 54 106 0.00% 55 99 0.00% 56 132 0.00% 57 154 0.00% 58 179 0.00% 59 205 0.00% 60 265 0.00% 61 266 0.00% 62 318 0.00% 63 374 0.00% 64 452 0.00% 65 489 0.00% 66 544 0.00% 67 575 0.01% 68 680 0.01% 69 790 0.01% 70 869 0.01% 71 1049 0.01% 72 1235 0.01% 73 1376 0.01% 74 1636 0.01% 75 1862 0.02% 76 2033 0.02% 77 2251 0.02% 78 2423 0.02% 79 2563 0.02% 80 2846 0.03% 81 3381 0.03% 82 3712 0.03% 83 4309 0.04% 84 5176 0.05% 85 5685 0.05% 86 6188 0.05% 87 6780 0.06% 88 7336 0.06% 89 7633 0.07% 90 8305 0.07% 91 8830 0.08% 92 9872 0.09% 93 10808 0.10% 94 11657 0.10% 95 12447 0.11% 96 13124 0.12% 97 13628 0.12% 98 14158 0.12% 99 14696 0.13% 100 15558 0.14% 101 16513 0.15% 102 17537 0.15% 103 18429 0.16% 104 19685 0.17% 105 20866 0.18% 106 21914 0.19% 107 22664 0.20% 108 22968 0.20% 109 23525 0.21% 110 24361 0.21% 111 25213 0.22% 112 26545 0.23% 113 27701 0.24% 114 28984 0.26% 115 30642 0.27% 116 31461 0.28% 117 32112 0.28% 118 32544 0.29% 119 32540 0.29% 120 33284 0.29% 121 34229 0.30% 122 35313 0.31% 123 36509 0.32% 124 38034 0.34% 125 39476 0.35% 126 40956 0.36% 127 41841 0.37% 128 43125 0.38% 129 43837 0.39% 130 44473 0.39% 131 45113 0.40% 132 45979 0.41% 133 47951 0.42% 134 49422 0.44% 135 51387 0.45% 136 53404 0.47% 137 55344 0.49% 138 57676 0.51% 139 59847 0.53% 140 62028 0.55% 141 67750 0.60% 142 72604 0.64% 143 76923 0.68% 144 87689 0.77% 145 102643 0.90% 146 123197 1.09% 147 165613 1.46% 148 245242 2.16% 149 486669 4.29% 150 2507273 22.09% 151 5770835 50.84% 11351685 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=105.61 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=16.9 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.92 fanout-score-rank=15 prefix-density=0.30 prefix-fanout=4.6 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=65.93 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.7 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7169820 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:41:11 Started mapping on | Feb 11 20:41:11 Finished on | Feb 11 20:42:25 Mapping speed, Million of reads per hour | 552.24 Number of input reads | 11351685 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10754362 Uniquely mapped reads % | 94.74% Average mapped length | 291.01 Number of splices: Total | 9567317 Number of splices: Annotated (sjdb) | 9404800 Number of splices: GT/AG | 9427143 Number of splices: GC/AG | 111571 Number of splices: AT/AC | 7757 Number of splices: Non-canonical | 20846 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217156 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 23080 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 386475 386475 386475 N_multimapping 217156 217156 217156 N_noFeature 255382 10621851 316132 N_ambiguous 110436 888 38015 UnstrandedReadsAssigned:10388544 PositiveStrandReadsAssigned:131623 NegativeStrandReadsAssigned:10400215 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169820 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169820-trimmed-pair1.fastq SRR7169820-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,351,685 reads, 10,345,471 reads pseudoaligned [quant] estimated average fragment length: 216.016 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7169820.ke.tsv 34699 SRR7169820.se.tsv 87100 total ==> SRR7169820.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.98 162 8.3676 Potri.005G024800.1.v4.1 1035 819.984 23 2.61216 Potri.004G059700.1.v4.1 961 745.984 1 0.124838 Potri.007G009000.2.v4.1 1416 1200.98 0 0 Potri.003G141000.2.v4.1 2943 2727.98 226 7.71515 Potri.016G087400.1.v4.1 270 90.9825 994.902 1018.36 Potri.015G069301.1.v4.1 564 351.474 0 0 Potri.010G195200.1.v4.1 1773 1557.98 11 0.657518 Potri.012G127500.1.v4.1 977 761.984 6069 741.735 ==> SRR7169820.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1119 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169820 completed mapping pipeline successfully