Starting /dee2/code/volunteer_pipeline.sh SRR7169821 current disk space = 3052585119744 free memory = 1573706456 SRR7169821 SRAfilesize 3bd668ae9cecf9e0110de0df77c7acd3 SRR7169821.sra SRR7169821.sra file validated SRR7169821 is paired end SRR7169821 is conventional basespace SRR7169821 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.26325 18.0 18.0 25.0 18.0 32.0 2 29.46375 30.0 27.0 31.0 27.0 33.0 3 31.46125 33.0 31.0 33.0 29.0 33.0 4 32.40225 33.0 33.0 33.0 31.0 33.0 5 33.061 33.0 33.0 34.0 33.0 34.0 6 37.1835 38.0 37.0 38.0 36.0 38.0 7 37.501 38.0 38.0 38.0 37.0 38.0 8 37.627 38.0 38.0 38.0 38.0 38.0 9 37.6905 38.0 38.0 38.0 38.0 38.0 10-14 37.63605 38.0 38.0 38.0 38.0 38.0 15-19 37.635299999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.595749999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.400800000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.478550000000006 38.0 38.0 38.0 37.2 38.0 35-39 37.3789 38.0 38.0 38.0 37.0 38.0 40-44 37.321450000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.2923 38.0 38.0 38.0 36.8 38.0 50-54 37.34915 38.0 38.0 38.0 37.0 38.0 55-59 37.2676 38.0 38.0 38.0 36.8 38.0 60-64 37.17605 38.0 38.0 38.0 36.0 38.0 65-69 36.93945 38.0 38.0 38.0 35.4 38.0 70-74 37.067750000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.27040000000001 38.0 37.2 38.0 32.6 38.0 80-84 36.888650000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.56745000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.6133 38.0 38.0 38.0 34.2 38.0 95-99 36.624199999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.532050000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.410250000000005 38.0 37.6 38.0 34.0 38.0 110-114 35.86565 38.0 36.6 38.0 31.6 38.0 115-119 34.501400000000004 38.0 34.6 38.0 23.8 38.0 120-124 35.708949999999994 38.0 36.2 38.0 31.0 38.0 125-129 35.486599999999996 38.0 36.0 38.0 30.6 38.0 130-134 34.95025 38.0 35.4 38.0 27.6 38.0 135-139 34.8044 38.0 35.0 38.0 27.6 38.0 140-144 33.6231 37.6 33.6 38.0 21.4 38.0 145-149 33.73434999999999 38.0 34.2 38.0 23.0 38.0 150-151 29.136249999999997 36.0 18.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 1.0 16 3.0 17 2.0 18 3.0 19 4.0 20 6.0 21 2.0 22 3.0 23 0.0 24 5.0 25 8.0 26 10.0 27 16.0 28 19.0 29 32.0 30 29.0 31 60.0 32 59.0 33 107.0 34 201.0 35 456.0 36 1133.0 37 1836.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.172587553539934 12.16931216931217 15.167548500881834 37.49055177626606 2 22.400000000000002 16.325 33.25 28.025 3 20.0 21.25 26.25 32.5 4 23.075000000000003 29.65 22.6 24.675 5 22.75 32.7 24.05 20.5 6 18.925 36.3 25.1 19.675 7 14.45 25.8 41.6 18.15 8 18.025 25.924999999999997 30.525000000000002 25.525 9 16.425 24.525 33.050000000000004 26.0 10-14 20.1 29.875 26.900000000000002 23.125 15-19 19.625 28.73 28.050000000000004 23.595 20-24 19.455 29.535 27.345000000000002 23.665 25-29 19.56 28.925 27.800000000000004 23.715 30-34 19.39 29.67 27.07 23.87 35-39 19.595000000000002 28.955 27.71 23.74 40-44 19.68 29.37 27.235 23.715 45-49 19.675 29.215000000000003 27.58 23.53 50-54 20.724999999999998 28.84 27.16 23.275000000000002 55-59 20.244999999999997 28.74 27.42 23.595 60-64 20.745 28.689999999999998 27.3 23.265 65-69 19.830000000000002 29.4 27.015 23.755000000000003 70-74 20.424999999999997 28.845 27.13 23.599999999999998 75-79 20.03 28.63 27.72 23.62 80-84 20.44 28.705000000000002 27.29 23.565 85-89 20.49 28.854999999999997 27.165 23.49 90-94 20.330000000000002 28.68 27.325 23.665 95-99 20.14 28.59 27.185 24.085 100-104 20.4 28.599999999999998 27.034999999999997 23.965 105-109 20.345 27.99 27.939999999999998 23.724999999999998 110-114 20.4 28.525 27.18 23.895 115-119 20.485 28.515 27.47 23.53 120-124 20.816040802040103 28.936446822341118 26.921346067303364 23.326166308315415 125-129 20.74 28.53 27.13 23.599999999999998 130-134 20.794999999999998 28.845 26.775 23.585 135-139 21.15 29.060000000000002 26.16 23.630000000000003 140-144 20.86 28.775000000000002 26.655 23.71 145-149 21.07 28.849999999999998 26.200000000000003 23.880000000000003 150-151 20.7375 28.725 26.7125 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 2.0 23 2.5 24 2.0 25 4.5 26 7.0 27 7.0 28 7.5 29 12.5 30 17.5 31 18.5 32 24.5 33 40.5 34 50.0 35 68.5 36 100.5 37 123.5 38 148.5 39 169.5 40 199.0 41 236.5 42 256.5 43 271.5 44 259.5 45 247.5 46 266.0 47 249.0 48 221.0 49 197.0 50 165.0 51 131.0 52 102.0 53 95.5 54 83.5 55 55.0 56 37.0 57 32.5 58 22.5 59 15.5 60 11.0 61 8.0 62 8.5 63 5.0 64 2.5 65 3.0 66 2.0 67 3.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.5625 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 4.95 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 5.887499999999999 0.0 0.0 0.0 0.0 132-133 6.5375 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTCC 40 0.005621335 54.375 145 >>END_MODULE SRR7169821 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169821_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0645 33.0 33.0 34.0 32.0 34.0 2 33.18575 34.0 33.0 34.0 33.0 34.0 3 33.218 34.0 33.0 34.0 33.0 34.0 4 33.1475 34.0 33.0 34.0 33.0 34.0 5 33.21175 34.0 33.0 34.0 33.0 34.0 6 37.4625 38.0 38.0 38.0 38.0 38.0 7 37.53425 38.0 38.0 38.0 38.0 38.0 8 37.55025 38.0 38.0 38.0 38.0 38.0 9 37.389 38.0 38.0 38.0 37.0 38.0 10-14 37.43475 38.0 38.0 38.0 37.6 38.0 15-19 36.8168 38.0 37.8 38.0 35.0 38.0 20-24 37.36515 38.0 38.0 38.0 37.4 38.0 25-29 36.31915 38.0 37.6 38.0 32.4 38.0 30-34 37.35085 38.0 38.0 38.0 37.2 38.0 35-39 37.3877 38.0 38.0 38.0 37.6 38.0 40-44 37.322100000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.22095 38.0 38.0 38.0 36.8 38.0 50-54 37.21835 38.0 38.0 38.0 36.8 38.0 55-59 37.116499999999995 38.0 38.0 38.0 36.6 38.0 60-64 37.076049999999995 38.0 38.0 38.0 36.4 38.0 65-69 35.64135 38.0 36.4 38.0 28.4 38.0 70-74 36.043549999999996 38.0 37.2 38.0 31.8 38.0 75-79 36.89704999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.368849999999995 38.0 37.4 38.0 33.0 38.0 85-89 36.846 38.0 38.0 38.0 35.6 38.0 90-94 36.909499999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.8395 38.0 38.0 38.0 36.0 38.0 100-104 36.50335 38.0 38.0 38.0 34.4 38.0 105-109 35.722750000000005 38.0 37.2 38.0 31.0 38.0 110-114 35.6644 38.0 37.2 38.0 32.2 38.0 115-119 34.490449999999996 38.0 36.4 38.0 25.2 38.0 120-124 34.4842 38.0 35.8 38.0 25.2 38.0 125-129 34.579249999999995 38.0 35.6 38.0 24.6 38.0 130-134 35.456 38.0 36.0 38.0 30.6 38.0 135-139 35.315200000000004 38.0 36.0 38.0 30.6 38.0 140-144 35.01745 38.0 35.8 38.0 30.4 38.0 145-149 34.31425 38.0 34.4 38.0 27.0 38.0 150-151 29.76625 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 2.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 1.0 16 1.0 17 4.0 18 3.0 19 2.0 20 6.0 21 6.0 22 5.0 23 6.0 24 3.0 25 14.0 26 10.0 27 15.0 28 25.0 29 30.0 30 49.0 31 57.0 32 93.0 33 129.0 34 212.0 35 279.0 36 733.0 37 2301.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.88688688688689 19.91991991991992 15.415415415415415 27.77777777777778 2 27.825 23.849999999999998 31.424999999999997 16.900000000000002 3 20.325 29.525000000000002 30.725 19.425 4 23.925 34.8 21.75 19.525000000000002 5 24.55 35.225 23.275000000000002 16.950000000000003 6 21.575 38.025 22.8 17.599999999999998 7 20.7 21.0 37.824999999999996 20.474999999999998 8 21.625 26.85 27.474999999999998 24.05 9 21.95 25.75 28.925 23.375 10-14 23.415 28.685 26.43 21.47 15-19 23.380000000000003 27.894999999999996 27.744999999999997 20.979999999999997 20-24 23.54 28.205000000000002 27.169999999999998 21.085 25-29 23.11 28.34 27.615000000000002 20.935000000000002 30-34 22.855 28.244999999999997 27.750000000000004 21.15 35-39 23.655 27.73 27.55 21.065 40-44 23.255 27.544999999999998 27.615000000000002 21.584999999999997 45-49 22.97 27.66 28.345 21.025 50-54 23.265 27.560000000000002 27.534999999999997 21.64 55-59 23.435 28.244999999999997 27.61 20.71 60-64 23.31 27.6 28.544999999999998 20.544999999999998 65-69 23.474999999999998 27.310000000000002 28.335 20.880000000000003 70-74 23.05 28.050000000000004 28.405 20.495 75-79 23.491681699739427 28.136901182601726 28.101824012828224 20.269593104830626 80-84 23.830000000000002 27.0 28.810000000000002 20.36 85-89 24.099999999999998 27.29 27.939999999999998 20.669999999999998 90-94 23.830000000000002 27.965 28.084999999999997 20.119999999999997 95-99 23.805 27.815 28.050000000000004 20.330000000000002 100-104 24.831106440474404 27.858679877896215 27.593454436270832 19.716759245358556 105-109 24.35105688607722 27.243058693578348 28.181955113721948 20.223929306622484 110-114 23.8983824349678 27.37690786471274 28.22372090664774 20.50098879367172 115-119 24.339612849654888 27.769993253412217 27.81151071669521 20.07888318023769 120-124 24.22504649721017 27.526348419094855 27.980987807398222 20.267617276296757 125-129 24.618359454508447 27.880113983309585 27.63586403419499 19.865662527986974 130-134 24.530851223540008 27.938747935745383 27.8987139068208 19.63168693389381 135-139 24.8 27.85 27.295 20.055 140-144 25.03 28.365000000000002 26.93 19.675 145-149 25.230000000000004 27.735 27.279999999999998 19.755 150-151 25.7 27.9125 26.9625 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 3.0 29 5.0 30 10.5 31 15.0 32 19.5 33 28.5 34 45.5 35 65.5 36 76.5 37 105.0 38 141.0 39 159.0 40 186.0 41 227.5 42 263.5 43 279.5 44 289.5 45 292.5 46 279.5 47 265.5 48 243.5 49 209.5 50 174.5 51 134.5 52 107.0 53 90.5 54 69.5 55 54.0 56 42.5 57 35.0 58 21.0 59 10.0 60 9.0 61 8.0 62 6.0 63 5.5 64 3.5 65 1.0 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.22 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.415 110-114 1.395 115-119 3.655 120-124 3.2199999999999998 125-129 1.7399999999999998 130-134 0.08499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.4124999999999996 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.075 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.237500000000001 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 7.137499999999999 0.0 0.0 0.0 0.0 136-137 7.7375 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATGG 10 0.0068590776 144.79999 7 ATATGGC 10 0.0068590776 144.79999 8 GGGAAAG 40 0.0056521297 54.299995 145 >>END_MODULE Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668965 spots for SRR7169821.sra Written 668965 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra Read 668963 spots for SRR7169821.sra Written 668963 spots for SRR7169821.sra SRR ids: ['SRR7169821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jyy_o9qn SRR7169821.sra spots: 13379262 blocks: [[1, 668963], [668964, 1337926], [1337927, 2006889], [2006890, 2675852], [2675853, 3344815], [3344816, 4013778], [4013779, 4682741], [4682742, 5351704], [5351705, 6020667], [6020668, 6689630], [6689631, 7358593], [7358594, 8027556], [8027557, 8696519], [8696520, 9365482], [9365483, 10034445], [10034446, 10703408], [10703409, 11372371], [11372372, 12041334], [12041335, 12710297], [12710298, 13379262]] SRR7169821 file size 4512092 SRR7169821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169821 SRR7169821_1.fastq SRR7169821_2.fastq Input file: SRR7169821_1.fastq Paired file: SRR7169821_2.fastq trimmed: SRR7169821-trimmed-pair1.fastq, SRR7169821-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:40:13 2025 >> started Tue Feb 11 21:40:29 2025 >> done (16.494s) 13379262 read pairs processed; of these: 7149 ( 0.05%) short read pairs filtered out after trimming by size control 11116 ( 0.08%) empty read pairs filtered out after trimming by size control 13360997 (99.86%) read pairs available; of these: 6399727 (47.90%) trimmed read pairs available after processing 6961270 (52.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 9 0.00% 25 5 0.00% 26 4 0.00% 27 5 0.00% 28 7 0.00% 29 7 0.00% 30 7 0.00% 31 16 0.00% 32 9 0.00% 33 14 0.00% 34 17 0.00% 35 11 0.00% 36 8 0.00% 37 18 0.00% 38 16 0.00% 39 22 0.00% 40 20 0.00% 41 39 0.00% 42 23 0.00% 43 33 0.00% 44 34 0.00% 45 33 0.00% 46 44 0.00% 47 57 0.00% 48 52 0.00% 49 63 0.00% 50 81 0.00% 51 89 0.00% 52 115 0.00% 53 109 0.00% 54 127 0.00% 55 147 0.00% 56 154 0.00% 57 176 0.00% 58 209 0.00% 59 237 0.00% 60 284 0.00% 61 295 0.00% 62 368 0.00% 63 386 0.00% 64 462 0.00% 65 485 0.00% 66 582 0.00% 67 636 0.00% 68 746 0.01% 69 809 0.01% 70 993 0.01% 71 1131 0.01% 72 1307 0.01% 73 1444 0.01% 74 1642 0.01% 75 1910 0.01% 76 2179 0.02% 77 2276 0.02% 78 2381 0.02% 79 2745 0.02% 80 3194 0.02% 81 3468 0.03% 82 4032 0.03% 83 4630 0.03% 84 5511 0.04% 85 6068 0.05% 86 6722 0.05% 87 7141 0.05% 88 7497 0.06% 89 8047 0.06% 90 8965 0.07% 91 9480 0.07% 92 10267 0.08% 93 11205 0.08% 94 12069 0.09% 95 12937 0.10% 96 13804 0.10% 97 14211 0.11% 98 14761 0.11% 99 15644 0.12% 100 16268 0.12% 101 17060 0.13% 102 18512 0.14% 103 19828 0.15% 104 21022 0.16% 105 22016 0.16% 106 23113 0.17% 107 23511 0.18% 108 23764 0.18% 109 24694 0.18% 110 25618 0.19% 111 26071 0.20% 112 27794 0.21% 113 29166 0.22% 114 30655 0.23% 115 32089 0.24% 116 32808 0.25% 117 33861 0.25% 118 34531 0.26% 119 34167 0.26% 120 35465 0.27% 121 36685 0.27% 122 37657 0.28% 123 38904 0.29% 124 40792 0.31% 125 42480 0.32% 126 43886 0.33% 127 45479 0.34% 128 46229 0.35% 129 46561 0.35% 130 47634 0.36% 131 48839 0.37% 132 50337 0.38% 133 52179 0.39% 134 53956 0.40% 135 56076 0.42% 136 58579 0.44% 137 61009 0.46% 138 63700 0.48% 139 65605 0.49% 140 69347 0.52% 141 74187 0.56% 142 80200 0.60% 143 88750 0.66% 144 101015 0.76% 145 118435 0.89% 146 144712 1.08% 147 190665 1.43% 148 284823 2.13% 149 565701 4.23% 150 2988547 22.37% 151 6961270 52.10% 13360997 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=37 prefix-density=0.20 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=326.57 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=19.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.9 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=258.97 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.5 sequence=AAGAAGAAGAAA SRR7169821 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:41:11 Started mapping on | Feb 11 21:41:12 Finished on | Feb 11 21:42:46 Mapping speed, Million of reads per hour | 511.70 Number of input reads | 13360997 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12680785 Uniquely mapped reads % | 94.91% Average mapped length | 291.92 Number of splices: Total | 11550680 Number of splices: Annotated (sjdb) | 11340385 Number of splices: GT/AG | 11378629 Number of splices: GC/AG | 138152 Number of splices: AT/AC | 9935 Number of splices: Non-canonical | 23964 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242340 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 80975 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446037 446037 446037 N_multimapping 242340 242340 242340 N_noFeature 312982 12526986 385465 N_ambiguous 132095 870 50137 UnstrandedReadsAssigned:12235708 PositiveStrandReadsAssigned:152929 NegativeStrandReadsAssigned:12245183 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169821 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169821-trimmed-pair1.fastq SRR7169821-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,360,997 reads, 12,228,010 reads pseudoaligned [quant] estimated average fragment length: 220.469 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7169821.ke.tsv 34699 SRR7169821.se.tsv 87100 total ==> SRR7169821.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.53 252 11.4225 Potri.005G024800.1.v4.1 1035 815.531 30 2.99889 Potri.004G059700.1.v4.1 961 741.543 3 0.329811 Potri.007G009000.2.v4.1 1416 1196.53 0 0 Potri.003G141000.2.v4.1 2943 2723.53 214.033 6.4066 Potri.016G087400.1.v4.1 270 87.9045 1040 964.5 Potri.015G069301.1.v4.1 564 346.853 0 0 Potri.010G195200.1.v4.1 1773 1553.53 27 1.41685 Potri.012G127500.1.v4.1 977 757.543 6974 750.507 ==> SRR7169821.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1574 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7169821 completed mapping pipeline successfully