Starting /dee2/code/volunteer_pipeline.sh SRR7169822 current disk space = 3052855386112 free memory = 1260558392 SRR7169822 SRAfilesize 9d1c5f6864046a5e1d3e8fe97317153f SRR7169822.sra SRR7169822.sra file validated SRR7169822 is paired end SRR7169822 is conventional basespace SRR7169822 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.63625 18.0 18.0 18.0 18.0 32.0 2 27.81375 27.0 27.0 30.0 25.0 31.0 3 28.963 29.0 27.0 31.0 25.0 33.0 4 31.437 33.0 31.0 33.0 29.0 33.0 5 32.176 33.0 32.0 33.0 31.0 33.0 6 36.3355 37.0 36.0 38.0 34.0 38.0 7 37.04675 38.0 38.0 38.0 35.0 38.0 8 37.2825 38.0 38.0 38.0 36.0 38.0 9 37.377 38.0 38.0 38.0 37.0 38.0 10-14 37.537600000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.5958 38.0 38.0 38.0 38.0 38.0 20-24 37.641000000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.60265 38.0 38.0 38.0 38.0 38.0 30-34 37.5469 38.0 38.0 38.0 37.8 38.0 35-39 37.28455 38.0 38.0 38.0 36.8 38.0 40-44 36.995050000000006 38.0 38.0 38.0 36.0 38.0 45-49 37.31 38.0 38.0 38.0 36.8 38.0 50-54 37.39945 38.0 38.0 38.0 37.0 38.0 55-59 37.40415 38.0 38.0 38.0 37.0 38.0 60-64 37.2753 38.0 38.0 38.0 37.0 38.0 65-69 37.27175 38.0 38.0 38.0 36.8 38.0 70-74 37.21965 38.0 38.0 38.0 36.2 38.0 75-79 37.0912 38.0 38.0 38.0 36.0 38.0 80-84 37.02055 38.0 38.0 38.0 36.0 38.0 85-89 36.8237 38.0 38.0 38.0 35.4 38.0 90-94 36.6833 38.0 38.0 38.0 34.6 38.0 95-99 36.74125 38.0 38.0 38.0 35.2 38.0 100-104 36.598 38.0 38.0 38.0 34.2 38.0 105-109 36.3711 38.0 37.8 38.0 33.8 38.0 110-114 36.19805 38.0 37.6 38.0 33.6 38.0 115-119 36.0968 38.0 37.0 38.0 33.4 38.0 120-124 36.00699999999999 38.0 37.0 38.0 33.2 38.0 125-129 35.78505 38.0 36.6 38.0 32.2 38.0 130-134 35.2787 38.0 35.6 38.0 29.8 38.0 135-139 35.1064 38.0 35.6 38.0 29.6 38.0 140-144 34.568 38.0 35.0 38.0 27.4 38.0 145-149 34.176 38.0 35.0 38.0 26.4 38.0 150-151 30.05375 36.0 27.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 4.0 17 1.0 18 4.0 19 8.0 20 1.0 21 5.0 22 4.0 23 2.0 24 10.0 25 11.0 26 10.0 27 13.0 28 20.0 29 33.0 30 28.0 31 38.0 32 57.0 33 94.0 34 160.0 35 297.0 36 984.0 37 2213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.712002029941644 19.233697031210355 9.845216950012688 36.209083988835324 2 22.725 15.299999999999999 31.85 30.125 3 20.325 20.825 25.4 33.45 4 23.65 29.175 22.55 24.625 5 23.5 32.625 22.575 21.3 6 19.45 35.875 24.325 20.349999999999998 7 15.55 27.05 40.1 17.299999999999997 8 18.45 26.275 30.425 24.85 9 18.325 25.825 32.2 23.65 10-14 19.74 30.17 27.185 22.905 15-19 19.395 30.145 26.96 23.5 20-24 20.0 29.165000000000003 27.405 23.43 25-29 19.89 29.68 26.93 23.5 30-34 19.535 29.64 27.0 23.825 35-39 19.86 29.165000000000003 27.355 23.62 40-44 20.005 30.075000000000003 26.965 22.955000000000002 45-49 20.515 29.310000000000002 26.939999999999998 23.235 50-54 20.05 28.735 27.529999999999998 23.685000000000002 55-59 20.14 28.76 27.255000000000003 23.845 60-64 20.16 29.42 26.674999999999997 23.745 65-69 20.54 28.994999999999997 27.134999999999998 23.330000000000002 70-74 20.225 29.755 26.790000000000003 23.23 75-79 20.05 28.715000000000003 27.85 23.385 80-84 20.535 29.2 27.12 23.145 85-89 19.845 29.315 26.955000000000002 23.885 90-94 20.36 29.195 27.060000000000002 23.385 95-99 20.595 29.294999999999998 26.919999999999998 23.189999999999998 100-104 21.205 29.17 26.700000000000003 22.925 105-109 20.635 29.195 26.795 23.375 110-114 21.145 28.749999999999996 26.325 23.78 115-119 20.7 29.235 26.695 23.369999999999997 120-124 20.724999999999998 28.53 26.875 23.87 125-129 20.810000000000002 28.689999999999998 26.515 23.985 130-134 21.315 28.799999999999997 26.36 23.525 135-139 20.794999999999998 28.88 26.32 24.005000000000003 140-144 20.330000000000002 28.78 26.6 24.29 145-149 20.955 28.79 26.334999999999997 23.919999999999998 150-151 20.2625 29.1875 26.637499999999996 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 2.5 24 1.5 25 3.5 26 7.0 27 7.5 28 9.5 29 21.5 30 26.0 31 31.5 32 47.5 33 62.5 34 65.5 35 63.0 36 83.0 37 109.5 38 141.5 39 152.0 40 164.5 41 208.0 42 236.0 43 252.0 44 260.0 45 257.5 46 260.5 47 259.5 48 230.0 49 203.5 50 184.5 51 161.5 52 122.5 53 86.5 54 69.5 55 57.0 56 47.5 57 30.0 58 19.5 59 15.5 60 10.5 61 7.0 62 5.0 63 3.5 64 2.0 65 0.5 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.5541561712846348 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025188916876574305 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.3875 0.0 0.0 0.0 0.0 92-93 1.675 0.0 0.0 0.0 0.0 94-95 1.975 0.0 0.0 0.0 0.0 96-97 2.2625 0.0 0.0 0.0 0.0 98-99 2.6625 0.0 0.0 0.0 0.0 100-101 3.1125 0.0 0.0 0.0 0.0 102-103 3.4625000000000004 0.0 0.0 0.0 0.0 104-105 4.0375 0.0 0.0 0.0 0.0 106-107 4.5 0.0 0.0 0.0 0.0 108-109 5.0 0.0 0.0 0.0 0.0 110-111 5.5125 0.0 0.0 0.025 0.0 112-113 6.074999999999999 0.0 0.0 0.025 0.0 114-115 6.65 0.0 0.0 0.025 0.0 116-117 7.1875 0.0 0.0 0.025 0.0 118-119 7.6875 0.0 0.0 0.025 0.0 120-121 8.4125 0.0 0.0 0.025 0.0 122-123 9.1875 0.0 0.0 0.025 0.0 124-125 9.8625 0.0 0.0 0.025 0.0 126-127 10.5625 0.0 0.0 0.025 0.0 128-129 11.1375 0.0 0.0 0.025 0.0 130-131 11.875 0.0 0.0 0.025 0.0 132-133 12.287500000000001 0.0 0.0 0.025 0.0 134-135 13.0875 0.0 0.0 0.025 0.0 136-137 13.7875 0.0 0.0 0.025 0.0 138-139 14.475 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGAAA 10 0.006832588 144.9875 6 >>END_MODULE SRR7169822 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169822_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.679 33.0 33.0 34.0 32.0 34.0 2 31.5495 33.0 32.0 34.0 27.0 34.0 3 32.597 33.0 33.0 34.0 31.0 34.0 4 32.858 33.0 33.0 34.0 32.0 34.0 5 33.00875 34.0 33.0 34.0 32.0 34.0 6 37.2505 38.0 38.0 38.0 37.0 38.0 7 37.2795 38.0 38.0 38.0 37.0 38.0 8 37.2325 38.0 38.0 38.0 37.0 38.0 9 37.2995 38.0 38.0 38.0 37.0 38.0 10-14 37.25 38.0 38.0 38.0 37.0 38.0 15-19 37.23235 38.0 38.0 38.0 37.4 38.0 20-24 37.18299999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.1631 38.0 38.0 38.0 37.0 38.0 30-34 37.09925 38.0 38.0 38.0 37.0 38.0 35-39 36.70095 38.0 38.0 38.0 35.2 38.0 40-44 37.01525 38.0 38.0 38.0 36.8 38.0 45-49 36.70135 38.0 38.0 38.0 35.4 38.0 50-54 36.91215 38.0 38.0 38.0 36.6 38.0 55-59 36.20515 38.0 37.4 38.0 31.2 38.0 60-64 36.7823 38.0 38.0 38.0 36.0 38.0 65-69 36.74455 38.0 38.0 38.0 35.6 38.0 70-74 36.72795 38.0 38.0 38.0 36.0 38.0 75-79 36.635149999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.545399999999994 38.0 38.0 38.0 35.4 38.0 85-89 35.3634 38.0 36.4 38.0 29.0 38.0 90-94 36.36065 38.0 38.0 38.0 34.4 38.0 95-99 36.35415 38.0 38.0 38.0 34.6 38.0 100-104 36.1915 38.0 38.0 38.0 34.0 38.0 105-109 35.5068 38.0 37.2 38.0 30.4 38.0 110-114 34.5877 38.0 36.6 38.0 25.4 38.0 115-119 33.62915 38.0 35.8 38.0 19.8 38.0 120-124 34.11985 38.0 36.0 38.0 23.2 38.0 125-129 34.00855 38.0 35.0 38.0 21.2 38.0 130-134 33.7948 38.0 34.4 38.0 21.0 38.0 135-139 33.65045 38.0 34.4 38.0 22.0 38.0 140-144 32.2827 37.2 31.4 38.0 17.0 38.0 145-149 31.884749999999997 37.6 31.6 38.0 13.0 38.0 150-151 28.630625000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 7.0 5 2.0 6 0.0 7 3.0 8 2.0 9 3.0 10 0.0 11 2.0 12 2.0 13 2.0 14 3.0 15 5.0 16 7.0 17 7.0 18 1.0 19 6.0 20 12.0 21 6.0 22 6.0 23 7.0 24 13.0 25 19.0 26 19.0 27 29.0 28 21.0 29 37.0 30 34.0 31 72.0 32 101.0 33 176.0 34 189.0 35 353.0 36 871.0 37 1967.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 19.225 17.05 26.375 2 25.1 26.55 30.7 17.65 3 20.125 28.349999999999998 31.55 19.975 4 24.05 32.6 23.225 20.125 5 25.874999999999996 34.175 22.275 17.675 6 21.625 35.775 23.65 18.95 7 20.025000000000002 21.55 38.224999999999994 20.200000000000003 8 22.7 24.55 28.725 24.025 9 21.099999999999998 25.1 30.025000000000002 23.775 10-14 23.755000000000003 28.615000000000002 26.540000000000003 21.09 15-19 23.445 27.560000000000002 28.189999999999998 20.805 20-24 23.24 27.925 28.134999999999998 20.7 25-29 23.7 28.055000000000003 27.400000000000002 20.845 30-34 22.835 28.055000000000003 28.199999999999996 20.91 35-39 23.35 28.005000000000003 27.295 21.349999999999998 40-44 23.630000000000003 27.63 27.834999999999997 20.905 45-49 23.155 27.644999999999996 28.27 20.93 50-54 23.200000000000003 27.779999999999998 28.139999999999997 20.880000000000003 55-59 23.72 27.46 28.33 20.49 60-64 22.695 27.805000000000003 28.48 21.02 65-69 23.265 27.57 28.310000000000002 20.855 70-74 22.97 27.675 28.694999999999997 20.66 75-79 23.51 27.389999999999997 28.384999999999998 20.715 80-84 23.385 27.755000000000003 28.365000000000002 20.495 85-89 23.74 27.565 28.215 20.48 90-94 23.565 27.915 28.439999999999998 20.080000000000002 95-99 23.5 28.165000000000003 27.694999999999997 20.64 100-104 24.335 28.005000000000003 27.500000000000004 20.16 105-109 24.175 27.775 28.265 19.785 110-114 24.41662803276155 27.852469994333696 27.70823674857055 20.02266522433421 115-119 24.676011637133033 27.341973023009785 28.082517852419997 19.899497487437188 120-124 25.14147546043832 26.983228727235314 27.914394485029327 19.960901327297048 125-129 25.233740356613705 27.062790578858632 27.778061615490728 19.92540744903694 130-134 25.255 26.745 27.439999999999998 20.560000000000002 135-139 25.080000000000002 26.865 27.555000000000003 20.5 140-144 25.5 27.36 27.16 19.98 145-149 25.174999999999997 27.195000000000004 27.250000000000004 20.380000000000003 150-151 26.087500000000002 26.5875 27.925 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 0.5 25 1.0 26 3.0 27 3.5 28 3.5 29 5.0 30 12.0 31 16.5 32 22.0 33 36.5 34 48.0 35 66.0 36 87.0 37 108.0 38 144.5 39 168.5 40 189.5 41 225.5 42 254.0 43 253.5 44 260.0 45 286.0 46 281.5 47 271.5 48 243.0 49 212.0 50 181.5 51 142.0 52 121.0 53 88.5 54 60.5 55 51.0 56 42.0 57 30.5 58 22.5 59 15.0 60 9.0 61 6.5 62 6.0 63 6.5 64 4.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.935 115-119 5.475 120-124 2.81 125-129 2.1350000000000002 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47089947089947 98.7 2 0.47871000251952633 0.95 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.3625 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 1.95 0.0 0.0 0.0 0.0 96-97 2.2 0.0 0.0 0.0 0.0 98-99 2.5999999999999996 0.0 0.0 0.0 0.0 100-101 3.0625 0.0 0.0 0.0 0.0 102-103 3.4 0.0 0.0 0.0 0.0 104-105 3.9 0.0 0.0 0.0 0.0 106-107 4.3375 0.0 0.0 0.0 0.0 108-109 4.800000000000001 0.0 0.0 0.0 0.0 110-111 5.25 0.0 0.0 0.0 0.0 112-113 5.8125 0.0 0.0 0.0 0.0 114-115 6.3375 0.0 0.0 0.0 0.0 116-117 6.8625 0.0 0.0 0.0 0.0 118-119 7.3375 0.0 0.0 0.0 0.0 120-121 8.0625 0.0 0.0 0.0 0.0 122-123 8.787500000000001 0.0 0.0 0.0 0.0 124-125 9.4875 0.0 0.0 0.0 0.0 126-127 10.0875 0.0 0.0 0.0 0.0 128-129 10.6375 0.0 0.0 0.0 0.0 130-131 11.325 0.0 0.0 0.0 0.0 132-133 11.6875 0.0 0.0 0.0 0.0 134-135 12.475000000000001 0.0 0.0 0.0 0.0 136-137 13.1875 0.0 0.0 0.0 0.0 138-139 13.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTCA 10 0.0069682184 144.03749 7 TTTTTTT 60 0.0036346328 14.964935 120-124 >>END_MODULE Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972032 spots for SRR7169822.sra Written 972032 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra Read 972027 spots for SRR7169822.sra Written 972027 spots for SRR7169822.sra SRR ids: ['SRR7169822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dc_ly4d7 SRR7169822.sra spots: 19440545 blocks: [[1, 972027], [972028, 1944054], [1944055, 2916081], [2916082, 3888108], [3888109, 4860135], [4860136, 5832162], [5832163, 6804189], [6804190, 7776216], [7776217, 8748243], [8748244, 9720270], [9720271, 10692297], [10692298, 11664324], [11664325, 12636351], [12636352, 13608378], [13608379, 14580405], [14580406, 15552432], [15552433, 16524459], [16524460, 17496486], [17496487, 18468513], [18468514, 19440545]] SRR7169822 file size 6566062 SRR7169822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169822 SRR7169822_1.fastq SRR7169822_2.fastq Input file: SRR7169822_1.fastq Paired file: SRR7169822_2.fastq trimmed: SRR7169822-trimmed-pair1.fastq, SRR7169822-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:52:53 2025 >> started Tue Feb 11 20:53:13 2025 >> done (19.845s) 19440545 read pairs processed; of these: 24329 ( 0.13%) short read pairs filtered out after trimming by size control 84579 ( 0.44%) empty read pairs filtered out after trimming by size control 19331637 (99.44%) read pairs available; of these: 10638862 (55.03%) trimmed read pairs available after processing 8692775 (44.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 7 0.00% 21 8 0.00% 22 8 0.00% 23 13 0.00% 24 15 0.00% 25 9 0.00% 26 15 0.00% 27 18 0.00% 28 17 0.00% 29 26 0.00% 30 22 0.00% 31 33 0.00% 32 39 0.00% 33 34 0.00% 34 52 0.00% 35 52 0.00% 36 69 0.00% 37 79 0.00% 38 77 0.00% 39 97 0.00% 40 105 0.00% 41 120 0.00% 42 158 0.00% 43 176 0.00% 44 180 0.00% 45 205 0.00% 46 264 0.00% 47 253 0.00% 48 316 0.00% 49 362 0.00% 50 432 0.00% 51 511 0.00% 52 582 0.00% 53 638 0.00% 54 605 0.00% 55 740 0.00% 56 735 0.00% 57 913 0.00% 58 1040 0.01% 59 1125 0.01% 60 1248 0.01% 61 1537 0.01% 62 1790 0.01% 63 1963 0.01% 64 2212 0.01% 65 2259 0.01% 66 2453 0.01% 67 2746 0.01% 68 3117 0.02% 69 3522 0.02% 70 4006 0.02% 71 4575 0.02% 72 5515 0.03% 73 6296 0.03% 74 6921 0.04% 75 8361 0.04% 76 11798 0.06% 77 11940 0.06% 78 10173 0.05% 79 10218 0.05% 80 11315 0.06% 81 12582 0.07% 82 13989 0.07% 83 15498 0.08% 84 17630 0.09% 85 19741 0.10% 86 20709 0.11% 87 21725 0.11% 88 22983 0.12% 89 23634 0.12% 90 24863 0.13% 91 26518 0.14% 92 28460 0.15% 93 30199 0.16% 94 32425 0.17% 95 34411 0.18% 96 35453 0.18% 97 36657 0.19% 98 37335 0.19% 99 38104 0.20% 100 39863 0.21% 101 40600 0.21% 102 42907 0.22% 103 44954 0.23% 104 47042 0.24% 105 49335 0.26% 106 51023 0.26% 107 51585 0.27% 108 52271 0.27% 109 53543 0.28% 110 54075 0.28% 111 55581 0.29% 112 57416 0.30% 113 59558 0.31% 114 61869 0.32% 115 63830 0.33% 116 65268 0.34% 117 66554 0.34% 118 66957 0.35% 119 67684 0.35% 120 68310 0.35% 121 69664 0.36% 122 71141 0.37% 123 73025 0.38% 124 75959 0.39% 125 77786 0.40% 126 80651 0.42% 127 82291 0.43% 128 82821 0.43% 129 84480 0.44% 130 86104 0.45% 131 86926 0.45% 132 89777 0.46% 133 92079 0.48% 134 94609 0.49% 135 97958 0.51% 136 102095 0.53% 137 105249 0.54% 138 109874 0.57% 139 114395 0.59% 140 119729 0.62% 141 127756 0.66% 142 136851 0.71% 143 149705 0.77% 144 169992 0.88% 145 198789 1.03% 146 240062 1.24% 147 316876 1.64% 148 469421 2.43% 149 903116 4.67% 150 4352411 22.51% 151 8692775 44.97% 19331637 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.15 sequence-density-rank=5 fanout-score=66.97 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=14.4 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=42 prefix-density=0.25 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=32.65 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=1.3 sequence=CACCACCCGTTGTCTGAAATCTTGCATTTTCTCTTCTCCCTCCACGCCTCTGTTTTTTCCAGCAAGAAAGTTTTTCACAATGGAGGCATTGAAGATGAGAGTGTTTTTGGCTATCGTGGTTGTGCTCATGGCTGTTTCAGCCGTCCAAAATGTAGCAGCAGCGGA SRR7169822 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:53:57 Started mapping on | Feb 11 20:53:57 Finished on | Feb 11 20:55:44 Mapping speed, Million of reads per hour | 650.41 Number of input reads | 19331637 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 18470766 Uniquely mapped reads % | 95.55% Average mapped length | 287.54 Number of splices: Total | 15622548 Number of splices: Annotated (sjdb) | 15356257 Number of splices: GT/AG | 15403843 Number of splices: GC/AG | 170523 Number of splices: AT/AC | 12924 Number of splices: Non-canonical | 35258 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304323 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 25742 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.71% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576963 576963 576963 N_multimapping 304323 304323 304323 N_noFeature 435084 18226361 534742 N_ambiguous 214335 893 69022 UnstrandedReadsAssigned:17821347 PositiveStrandReadsAssigned:243512 NegativeStrandReadsAssigned:17867002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169822 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169822-trimmed-pair1.fastq SRR7169822-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,331,637 reads, 17,791,841 reads pseudoaligned [quant] estimated average fragment length: 205.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7169822.ke.tsv 34699 SRR7169822.se.tsv 87100 total ==> SRR7169822.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.98 298 9.48247 Potri.005G024800.1.v4.1 1035 830.98 28 1.94493 Potri.004G059700.1.v4.1 961 756.985 3 0.228755 Potri.007G009000.2.v4.1 1416 1211.98 0 0 Potri.003G141000.2.v4.1 2943 2738.98 263.108 5.54476 Potri.016G087400.1.v4.1 270 96.9384 1774 1056.32 Potri.015G069301.1.v4.1 564 361.792 0 0 Potri.010G195200.1.v4.1 1773 1568.98 41 1.50836 Potri.012G127500.1.v4.1 977 772.98 5756 429.823 ==> SRR7169822.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1746 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169822 completed mapping pipeline successfully