Starting /dee2/code/volunteer_pipeline.sh SRR7169823 current disk space = 3052986470400 free memory = 1485891552 SRR7169823 SRAfilesize 4e4239157ad6552fc4f09cb0c5fcab13 SRR7169823.sra SRR7169823.sra file validated SRR7169823 is paired end SRR7169823 is conventional basespace SRR7169823 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.77525 30.0 18.0 33.0 18.0 33.0 2 25.999 27.0 18.0 31.0 18.0 33.0 3 29.641 31.0 29.0 33.0 25.0 33.0 4 31.55275 33.0 31.0 33.0 29.0 33.0 5 32.353 33.0 33.0 33.0 32.0 33.0 6 36.479 38.0 37.0 38.0 34.0 38.0 7 37.04075 38.0 37.0 38.0 35.0 38.0 8 37.426 38.0 38.0 38.0 37.0 38.0 9 37.52325 38.0 38.0 38.0 38.0 38.0 10-14 37.6076 38.0 38.0 38.0 37.8 38.0 15-19 37.577600000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.564949999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.575649999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.53190000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.50625 38.0 38.0 38.0 38.0 38.0 40-44 37.5503 38.0 38.0 38.0 38.0 38.0 45-49 37.48335 38.0 38.0 38.0 37.4 38.0 50-54 37.459050000000005 38.0 38.0 38.0 37.2 38.0 55-59 37.3643 38.0 38.0 38.0 37.0 38.0 60-64 36.783950000000004 38.0 37.8 38.0 34.6 38.0 65-69 37.1749 38.0 38.0 38.0 36.4 38.0 70-74 37.253249999999994 38.0 38.0 38.0 36.8 38.0 75-79 37.21635 38.0 38.0 38.0 36.8 38.0 80-84 37.076 38.0 38.0 38.0 36.2 38.0 85-89 36.98955 38.0 38.0 38.0 36.0 38.0 90-94 36.7426 38.0 38.0 38.0 35.2 38.0 95-99 36.829150000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.91074999999999 38.0 38.0 38.0 35.6 38.0 105-109 36.55625 38.0 38.0 38.0 34.6 38.0 110-114 36.436449999999994 38.0 38.0 38.0 34.4 38.0 115-119 36.5872 38.0 38.0 38.0 34.6 38.0 120-124 36.445499999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.3058 38.0 38.0 38.0 34.0 38.0 130-134 36.0465 38.0 37.4 38.0 33.0 38.0 135-139 35.84885 38.0 36.8 38.0 32.6 38.0 140-144 35.5971 38.0 36.0 38.0 31.8 38.0 145-149 35.04215 38.0 35.8 38.0 30.6 38.0 150-151 31.307000000000002 35.5 31.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.0 19 8.0 20 2.0 21 1.0 22 3.0 23 6.0 24 6.0 25 5.0 26 5.0 27 13.0 28 12.0 29 28.0 30 41.0 31 28.0 32 67.0 33 91.0 34 130.0 35 253.0 36 643.0 37 2653.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.290306378704166 10.04520341536916 10.748367654445003 36.91612255148166 2 22.5 14.625 33.825 29.049999999999997 3 21.55 19.825 24.6 34.025 4 23.375 27.450000000000003 23.125 26.05 5 23.075000000000003 32.125 24.175 20.625 6 19.875 34.625 24.9 20.599999999999998 7 14.45 26.174999999999997 40.225 19.15 8 17.375 26.35 30.825000000000003 25.45 9 17.175 25.275 34.425 23.125 10-14 19.8 30.740000000000002 26.71 22.75 15-19 19.91 29.28 27.42 23.39 20-24 19.965 28.585 27.650000000000002 23.799999999999997 25-29 20.36 28.76 27.284999999999997 23.595 30-34 19.540977048852444 28.94644732236612 27.05635281764088 24.456222811140556 35-39 20.206010300515025 28.551427571378568 27.631381569078457 23.611180559027954 40-44 20.145 28.7 27.375 23.78 45-49 19.994999999999997 28.03 28.13 23.845 50-54 19.81 29.054999999999996 27.065 24.07 55-59 20.28 28.689999999999998 27.310000000000002 23.72 60-64 20.175 28.749999999999996 27.284999999999997 23.79 65-69 20.349999999999998 28.79 27.339999999999996 23.52 70-74 20.495 28.1 27.284999999999997 24.12 75-79 20.355 28.1 27.43 24.115000000000002 80-84 20.175 28.860000000000003 26.96 24.005000000000003 85-89 21.07 28.410000000000004 27.589999999999996 22.93 90-94 20.349999999999998 28.925 27.384999999999998 23.34 95-99 20.94 28.53 26.99 23.54 100-104 20.63118935680704 28.76863058917675 26.973091927578274 23.627088126437933 105-109 20.062255246510695 28.225725474445223 27.67346119088262 24.038558088161462 110-114 20.63707729468599 28.155193236714975 27.264492753623188 23.943236714975846 115-119 20.965 28.860000000000003 26.855 23.32 120-124 20.785 28.705000000000002 27.045 23.465 125-129 20.865000000000002 28.375 27.084999999999997 23.674999999999997 130-134 21.46 28.139999999999997 26.5 23.9 135-139 20.810000000000002 27.389999999999997 27.38 24.42 140-144 20.645 27.779999999999998 27.089999999999996 24.485 145-149 21.224999999999998 27.61 26.745 24.42 150-151 19.86498312289036 27.815976997124643 27.25340667583448 25.065633204150515 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 3.5 27 7.5 28 8.0 29 10.0 30 18.0 31 25.0 32 34.5 33 46.0 34 56.5 35 66.5 36 76.5 37 107.5 38 135.0 39 142.5 40 169.0 41 204.0 42 236.0 43 255.0 44 265.5 45 290.0 46 283.5 47 254.5 48 236.0 49 207.5 50 174.5 51 148.5 52 124.0 53 101.0 54 82.5 55 58.5 56 38.5 57 29.0 58 26.0 59 17.0 60 10.5 61 9.5 62 5.0 63 6.5 64 6.0 65 4.0 66 4.0 67 3.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.41000000000000003 110-114 0.64 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49647532729104 98.8 2 0.4531722054380665 0.8999999999999999 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025176233635448138 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 1.9874999999999998 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.4625 0.0 0.0 0.0 0.0 106-107 2.85 0.0 0.0 0.0 0.0 108-109 3.3625 0.0 0.0 0.0 0.0 110-111 3.725 0.0 0.0 0.0 0.0 112-113 4.1375 0.0 0.0 0.0 0.0 114-115 4.612500000000001 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.4125 0.0 0.0 0.0 0.0 120-121 5.8125 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 6.6875 0.0 0.0 0.0 0.0 126-127 7.175 0.0 0.0 0.0 0.0 128-129 7.7625 0.0 0.0 0.0 0.0 130-131 8.2625 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.45 0.0 0.0 0.0 0.0 136-137 10.0125 0.0 0.0 0.0 0.0 138-139 10.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169823 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9855 33.0 33.0 34.0 32.0 34.0 2 33.0605 34.0 33.0 34.0 32.0 34.0 3 33.10175 34.0 33.0 34.0 33.0 34.0 4 33.005 34.0 33.0 34.0 33.0 34.0 5 32.998 34.0 33.0 34.0 33.0 34.0 6 37.22925 38.0 38.0 38.0 37.0 38.0 7 37.2115 38.0 38.0 38.0 37.0 38.0 8 37.16875 38.0 38.0 38.0 37.0 38.0 9 37.22625 38.0 38.0 38.0 37.0 38.0 10-14 37.09505 38.0 38.0 38.0 37.0 38.0 15-19 37.13135 38.0 38.0 38.0 37.0 38.0 20-24 37.116249999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.081500000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.96285 38.0 38.0 38.0 37.0 38.0 35-39 36.569 38.0 38.0 38.0 34.8 38.0 40-44 36.9474 38.0 38.0 38.0 36.6 38.0 45-49 36.92354999999999 38.0 38.0 38.0 36.8 38.0 50-54 36.861650000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.72924999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.862 38.0 38.0 38.0 36.0 38.0 65-69 36.8121 38.0 38.0 38.0 36.0 38.0 70-74 36.3266 38.0 38.0 38.0 35.0 38.0 75-79 35.331050000000005 38.0 38.0 38.0 31.8 38.0 80-84 35.928250000000006 38.0 38.0 38.0 32.0 38.0 85-89 36.565650000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.50635 38.0 38.0 38.0 35.0 38.0 95-99 36.27575 38.0 38.0 38.0 34.4 38.0 100-104 36.09005 38.0 38.0 38.0 33.8 38.0 105-109 34.9011 38.0 37.4 38.0 28.6 38.0 110-114 33.7978 38.0 36.8 38.0 17.8 38.0 115-119 32.89045 38.0 36.0 38.0 8.6 38.0 120-124 33.10365 38.0 35.0 38.0 14.4 38.0 125-129 33.04260000000001 38.0 34.0 38.0 17.4 38.0 130-134 34.7534 38.0 36.0 38.0 26.4 38.0 135-139 34.7096 38.0 35.8 38.0 27.8 38.0 140-144 34.13185 38.0 34.8 38.0 24.4 38.0 145-149 33.18465 38.0 33.4 38.0 15.0 38.0 150-151 29.413624999999996 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 4.0 5 2.0 6 1.0 7 2.0 8 0.0 9 3.0 10 0.0 11 3.0 12 2.0 13 3.0 14 2.0 15 7.0 16 6.0 17 5.0 18 9.0 19 4.0 20 8.0 21 6.0 22 11.0 23 13.0 24 14.0 25 18.0 26 21.0 27 36.0 28 62.0 29 68.0 30 58.0 31 93.0 32 89.0 33 120.0 34 150.0 35 272.0 36 518.0 37 2374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.375 19.375 16.05 28.199999999999996 2 25.25 24.775 30.95 19.025 3 21.65 27.800000000000004 31.15 19.400000000000002 4 24.55 32.324999999999996 22.875 20.25 5 24.075 36.025 23.35 16.55 6 19.900000000000002 36.075 25.05 18.975 7 20.849999999999998 20.05 40.6 18.5 8 21.55 24.15 28.499999999999996 25.8 9 21.775 25.974999999999998 30.025000000000002 22.225 10-14 23.57 28.415000000000003 26.540000000000003 21.475 15-19 23.09 27.845 28.01 21.055 20-24 23.385 28.060000000000002 27.91 20.645 25-29 23.205000000000002 27.925 27.77 21.099999999999998 30-34 22.68 27.905 28.51 20.905 35-39 22.795 28.365000000000002 28.355000000000004 20.485 40-44 23.665 27.18 28.415000000000003 20.74 45-49 23.41 27.71 28.115000000000002 20.765 50-54 22.75 28.62 27.894999999999996 20.735 55-59 23.585 27.810000000000002 27.939999999999998 20.665 60-64 23.169999999999998 28.4 27.54 20.89 65-69 24.075 27.634999999999998 27.685 20.605 70-74 23.52792391744233 27.99473897207608 28.03520841764468 20.44212869283691 75-79 23.700051894135964 27.841203943954334 28.028022833419826 20.43072132848988 80-84 23.31241777148062 28.160105252504806 27.952636372836757 20.574840603177815 85-89 24.025 27.815 27.49 20.669999999999998 90-94 23.765 27.76 27.82 20.655 95-99 23.830000000000002 27.72 27.925 20.525 100-104 24.28078250863061 28.143293140541353 27.622954920698454 19.95296943012958 105-109 24.105344694035633 28.066098631551768 27.766589207332814 20.061967467079782 110-114 24.25339366515837 27.905243545381953 27.234495608198028 20.606867181261645 115-119 24.961715160796324 28.58783635965872 26.77204112885583 19.678407350689127 120-124 25.16559829059829 28.012820512820515 26.773504273504273 20.048076923076923 125-129 24.494405631139358 28.07164994484425 27.162893313022007 20.271051110994378 130-134 24.869687249398556 27.776663993584606 27.090016038492383 20.26363271852446 135-139 25.53 27.49 27.224999999999998 19.755 140-144 25.729999999999997 27.595 26.974999999999998 19.7 145-149 25.330000000000002 27.68 26.545 20.445 150-151 25.82947289345186 26.893702266182544 27.61988230875172 19.656942531613872 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 3.0 27 4.5 28 8.0 29 12.0 30 12.5 31 13.0 32 26.5 33 41.0 34 47.5 35 61.5 36 83.0 37 103.5 38 131.0 39 177.0 40 222.5 41 245.5 42 249.0 43 255.5 44 273.0 45 288.5 46 270.5 47 251.0 48 245.0 49 203.0 50 161.5 51 151.5 52 118.0 53 79.0 54 64.5 55 48.5 56 36.0 57 28.5 58 20.0 59 12.0 60 7.5 61 7.0 62 6.5 63 5.0 64 5.0 65 3.5 66 2.5 67 1.0 68 0.5 69 1.5 70 1.5 71 0.0 72 1.5 73 1.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 1.16 75-79 3.65 80-84 1.1900000000000002 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 3.175 110-114 6.075 115-119 8.58 120-124 6.4 125-129 4.8149999999999995 130-134 0.24 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.698568198945 99.225 2 0.27631248430042704 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025119316754584273 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.1749999999999998 0.0 0.0 0.0 0.0 96-97 1.3875 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.2125 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.2875 0.0 0.0 0.0 0.0 116-117 4.675 0.0 0.0 0.0 0.0 118-119 5.05 0.0 0.0 0.0 0.0 120-121 5.45 0.0 0.0 0.0 0.0 122-123 5.762499999999999 0.0 0.0 0.0 0.0 124-125 6.2375 0.0 0.0 0.0 0.0 126-127 6.6875 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.725 0.0 0.0 0.0 0.0 132-133 8.35 0.0 0.0 0.0 0.0 134-135 8.8625 0.0 0.0 0.0 0.0 136-137 9.412500000000001 0.0 0.0 0.0 0.0 138-139 9.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700584 spots for SRR7169823.sra Written 700584 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra Read 700572 spots for SRR7169823.sra Written 700572 spots for SRR7169823.sra SRR ids: ['SRR7169823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dggauo4b SRR7169823.sra spots: 14011452 blocks: [[1, 700572], [700573, 1401144], [1401145, 2101716], [2101717, 2802288], [2802289, 3502860], [3502861, 4203432], [4203433, 4904004], [4904005, 5604576], [5604577, 6305148], [6305149, 7005720], [7005721, 7706292], [7706293, 8406864], [8406865, 9107436], [9107437, 9808008], [9808009, 10508580], [10508581, 11209152], [11209153, 11909724], [11909725, 12610296], [12610297, 13310868], [13310869, 14011452]] SRR7169823 file size 4726320 SRR7169823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169823 SRR7169823_1.fastq SRR7169823_2.fastq Input file: SRR7169823_1.fastq Paired file: SRR7169823_2.fastq trimmed: SRR7169823-trimmed-pair1.fastq, SRR7169823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:13:45 2025 >> started Tue Feb 11 21:14:01 2025 >> done (15.341s) 14011452 read pairs processed; of these: 18096 ( 0.13%) short read pairs filtered out after trimming by size control 47835 ( 0.34%) empty read pairs filtered out after trimming by size control 13945521 (99.53%) read pairs available; of these: 6463147 (46.35%) trimmed read pairs available after processing 7482374 (53.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 6 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 5 0.00% 27 8 0.00% 28 9 0.00% 29 10 0.00% 30 11 0.00% 31 12 0.00% 32 19 0.00% 33 23 0.00% 34 20 0.00% 35 30 0.00% 36 33 0.00% 37 35 0.00% 38 40 0.00% 39 49 0.00% 40 50 0.00% 41 53 0.00% 42 85 0.00% 43 80 0.00% 44 81 0.00% 45 123 0.00% 46 118 0.00% 47 149 0.00% 48 138 0.00% 49 167 0.00% 50 200 0.00% 51 236 0.00% 52 246 0.00% 53 284 0.00% 54 301 0.00% 55 305 0.00% 56 363 0.00% 57 352 0.00% 58 394 0.00% 59 496 0.00% 60 556 0.00% 61 631 0.00% 62 726 0.01% 63 827 0.01% 64 926 0.01% 65 951 0.01% 66 1077 0.01% 67 1138 0.01% 68 1328 0.01% 69 1458 0.01% 70 1582 0.01% 71 1926 0.01% 72 2292 0.02% 73 2496 0.02% 74 2640 0.02% 75 2974 0.02% 76 3550 0.03% 77 4086 0.03% 78 4130 0.03% 79 4317 0.03% 80 4641 0.03% 81 5163 0.04% 82 5795 0.04% 83 6478 0.05% 84 7799 0.06% 85 8787 0.06% 86 9401 0.07% 87 9649 0.07% 88 10319 0.07% 89 10843 0.08% 90 11411 0.08% 91 12456 0.09% 92 13387 0.10% 93 14556 0.10% 94 15494 0.11% 95 16377 0.12% 96 17223 0.12% 97 17856 0.13% 98 18715 0.13% 99 19196 0.14% 100 20365 0.15% 101 20791 0.15% 102 22071 0.16% 103 23522 0.17% 104 24574 0.18% 105 25947 0.19% 106 26936 0.19% 107 27550 0.20% 108 27963 0.20% 109 28965 0.21% 110 29591 0.21% 111 30945 0.22% 112 31915 0.23% 113 32909 0.24% 114 34558 0.25% 115 36098 0.26% 116 36729 0.26% 117 37658 0.27% 118 38588 0.28% 119 38341 0.27% 120 39308 0.28% 121 39907 0.29% 122 40882 0.29% 123 42775 0.31% 124 44418 0.32% 125 45952 0.33% 126 48111 0.34% 127 49567 0.36% 128 50634 0.36% 129 50505 0.36% 130 50854 0.36% 131 51516 0.37% 132 52928 0.38% 133 55171 0.40% 134 56472 0.40% 135 58595 0.42% 136 60709 0.44% 137 63570 0.46% 138 66078 0.47% 139 67863 0.49% 140 71894 0.52% 141 75952 0.54% 142 82040 0.59% 143 88421 0.63% 144 100374 0.72% 145 118599 0.85% 146 136105 0.98% 147 180011 1.29% 148 261717 1.88% 149 501374 3.60% 150 2935107 21.05% 151 7482374 53.65% 13945521 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=284.19 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.20 fanout-score-rank=31 prefix-density=0.36 prefix-fanout=3.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=268.68 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=27.2 sequence=AAGAAGAAGAAG SRR7169823 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:14:43 Started mapping on | Feb 11 21:14:43 Finished on | Feb 11 21:15:56 Mapping speed, Million of reads per hour | 687.72 Number of input reads | 13945521 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13333033 Uniquely mapped reads % | 95.61% Average mapped length | 290.96 Number of splices: Total | 12402722 Number of splices: Annotated (sjdb) | 12190568 Number of splices: GT/AG | 12218684 Number of splices: GC/AG | 144635 Number of splices: AT/AC | 10594 Number of splices: Non-canonical | 28809 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260472 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 107076 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 366614 366614 366614 N_multimapping 260472 260472 260472 N_noFeature 335106 13199564 398311 N_ambiguous 121028 859 50142 UnstrandedReadsAssigned:12876899 PositiveStrandReadsAssigned:132610 NegativeStrandReadsAssigned:12884580 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169823-trimmed-pair1.fastq SRR7169823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,945,521 reads, 12,883,528 reads pseudoaligned [quant] estimated average fragment length: 218.807 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR7169823.ke.tsv 34699 SRR7169823.se.tsv 87100 total ==> SRR7169823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.19 254 11.4404 Potri.005G024800.1.v4.1 1035 817.193 36 3.57194 Potri.004G059700.1.v4.1 961 743.199 2 0.218198 Potri.007G009000.2.v4.1 1416 1198.19 0 0 Potri.003G141000.2.v4.1 2943 2725.19 218.16 6.49088 Potri.016G087400.1.v4.1 270 90.5474 1911.25 1711.46 Potri.015G069301.1.v4.1 564 348.837 0 0 Potri.010G195200.1.v4.1 1773 1555.19 11 0.573501 Potri.012G127500.1.v4.1 977 759.199 4858 518.833 ==> SRR7169823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1080 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169823 completed mapping pipeline successfully