Starting /dee2/code/volunteer_pipeline.sh SRR7169824 current disk space = 3052899123200 free memory = 1347700464 SRR7169824 SRAfilesize a93de9172250151b3bf62dccea2cd3e4 SRR7169824.sra SRR7169824.sra file validated SRR7169824 is paired end SRR7169824 is conventional basespace SRR7169824 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5255 30.0 18.0 32.0 18.0 33.0 2 31.498 33.0 31.0 33.0 29.0 33.0 3 31.911 33.0 31.0 33.0 29.0 33.0 4 32.29275 33.0 33.0 33.0 31.0 34.0 5 33.1815 33.0 33.0 34.0 33.0 34.0 6 37.32225 38.0 38.0 38.0 36.0 38.0 7 37.615 38.0 38.0 38.0 37.0 38.0 8 37.70675 38.0 38.0 38.0 38.0 38.0 9 37.6565 38.0 38.0 38.0 38.0 38.0 10-14 37.6998 38.0 38.0 38.0 38.0 38.0 15-19 37.7264 38.0 38.0 38.0 38.0 38.0 20-24 37.697700000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.687250000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.70505000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.6824 38.0 38.0 38.0 38.0 38.0 40-44 37.6095 38.0 38.0 38.0 38.0 38.0 45-49 37.623900000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.47485 38.0 38.0 38.0 37.6 38.0 55-59 37.5795 38.0 38.0 38.0 38.0 38.0 60-64 37.48965 38.0 38.0 38.0 37.8 38.0 65-69 37.44085 38.0 38.0 38.0 37.0 38.0 70-74 37.44215 38.0 38.0 38.0 37.0 38.0 75-79 37.30095 38.0 38.0 38.0 37.0 38.0 80-84 37.18805 38.0 38.0 38.0 37.0 38.0 85-89 37.1366 38.0 38.0 38.0 36.8 38.0 90-94 37.022400000000005 38.0 38.0 38.0 36.0 38.0 95-99 37.05705 38.0 38.0 38.0 36.2 38.0 100-104 36.9473 38.0 38.0 38.0 36.0 38.0 105-109 36.4775 38.0 38.0 38.0 35.2 38.0 110-114 36.453250000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.64755 38.0 38.0 38.0 35.0 38.0 120-124 36.58095 38.0 38.0 38.0 34.8 38.0 125-129 36.4528 38.0 38.0 38.0 34.0 38.0 130-134 36.24635 38.0 38.0 38.0 34.0 38.0 135-139 35.97715000000001 38.0 37.0 38.0 33.0 38.0 140-144 35.5723 38.0 36.0 38.0 31.0 38.0 145-149 35.3994 38.0 36.0 38.0 31.6 38.0 150-151 32.26025 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 4.0 19 13.0 20 1.0 21 1.0 22 2.0 23 1.0 24 5.0 25 4.0 26 4.0 27 7.0 28 13.0 29 14.0 30 21.0 31 26.0 32 45.0 33 72.0 34 112.0 35 199.0 36 479.0 37 2970.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.26643251379829 9.934771700953336 16.28198695434019 40.51680883090818 2 22.125 15.950000000000001 32.975 28.95 3 21.725 18.0 24.15 36.125 4 22.778473091364205 25.632040050062578 22.202753441802255 29.386733416770966 5 23.9 32.85 22.575 20.674999999999997 6 19.900000000000002 36.125 24.65 19.325 7 15.299999999999999 25.974999999999998 41.325 17.4 8 18.275 25.825 31.474999999999998 24.425 9 18.224999999999998 24.9 33.125 23.75 10-14 19.794999999999998 30.580000000000002 26.77 22.855 15-19 19.68 28.87 28.22 23.23 20-24 19.945 29.185 27.700000000000003 23.169999999999998 25-29 19.865 29.104999999999997 27.435 23.595 30-34 19.65098254912746 29.106455322766138 27.42137106855343 23.821191059552977 35-39 19.965 28.345 27.169999999999998 24.52 40-44 20.294999999999998 28.93 27.46 23.315 45-49 20.119999999999997 29.7 26.939999999999998 23.24 50-54 20.265 28.27 27.57 23.895 55-59 19.55 29.12 27.500000000000004 23.830000000000002 60-64 20.686029043565348 29.00350525788683 26.86529794692038 23.44516775162744 65-69 20.465 29.595 27.295 22.645 70-74 20.02 28.665000000000003 27.38 23.935000000000002 75-79 20.165 28.494999999999997 27.515 23.825 80-84 20.1 28.849999999999998 27.889999999999997 23.16 85-89 20.36 29.075 26.915 23.65 90-94 20.669999999999998 28.64 27.61 23.080000000000002 95-99 20.04 28.775000000000002 27.505000000000003 23.68 100-104 21.011770598547457 28.68519909842224 27.38292011019284 22.920110192837466 105-109 21.252209038121688 28.255491037616764 27.089118909366324 23.403181014895228 110-114 21.04201341604882 29.253038785494528 26.832097644626014 22.872850153830633 115-119 20.979999999999997 29.015 26.025 23.98 120-124 21.154999999999998 27.92 27.045 23.880000000000003 125-129 20.735 28.849999999999998 26.51 23.905 130-134 20.830000000000002 28.96 26.474999999999998 23.735 135-139 21.48 28.185 26.1 24.235 140-144 21.205 28.565 26.275 23.955000000000002 145-149 21.125 28.499999999999996 26.314999999999998 24.060000000000002 150-151 21.5 28.175 26.5 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 3.0 26 5.5 27 8.0 28 10.0 29 16.0 30 21.5 31 28.0 32 32.0 33 40.0 34 55.5 35 72.5 36 97.5 37 114.0 38 132.0 39 156.5 40 178.0 41 201.5 42 228.5 43 259.0 44 273.5 45 284.0 46 280.5 47 260.5 48 235.5 49 207.0 50 177.0 51 146.5 52 116.5 53 91.5 54 73.5 55 47.0 56 37.5 57 33.5 58 19.0 59 14.0 60 13.5 61 8.0 62 5.0 63 4.0 64 3.5 65 1.5 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.15 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.17500000000000002 105-109 0.975 110-114 0.865 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41963159222811 98.5 2 0.5551349987383295 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025233409033560434 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 16 0.4 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9625 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.55 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.449999999999999 0.0 0.0 0.0 0.0 118-119 5.0375 0.0 0.0 0.0 0.0 120-121 5.699999999999999 0.0 0.0 0.0 0.0 122-123 6.375 0.0 0.0 0.0 0.0 124-125 7.15 0.0 0.0 0.0 0.0 126-127 7.7125 0.0 0.0 0.0 0.0 128-129 8.3125 0.0 0.0 0.0 0.0 130-131 8.9125 0.0 0.0 0.0 0.0 132-133 9.6125 0.0 0.0 0.0 0.0 134-135 10.2375 0.0 0.0 0.0 0.0 136-137 10.774999999999999 0.0 0.0 0.0 0.0 138-139 11.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169824 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.106 34.0 33.0 34.0 33.0 34.0 2 33.1705 34.0 33.0 34.0 33.0 34.0 3 33.248 34.0 33.0 34.0 33.0 34.0 4 33.18725 34.0 33.0 34.0 33.0 34.0 5 33.13875 34.0 33.0 34.0 33.0 34.0 6 37.38075 38.0 38.0 38.0 38.0 38.0 7 37.42175 38.0 38.0 38.0 38.0 38.0 8 37.368 38.0 38.0 38.0 38.0 38.0 9 37.412 38.0 38.0 38.0 38.0 38.0 10-14 37.418400000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.37645 38.0 38.0 38.0 38.0 38.0 20-24 37.31915 38.0 38.0 38.0 38.0 38.0 25-29 37.2916 38.0 38.0 38.0 38.0 38.0 30-34 37.297 38.0 38.0 38.0 38.0 38.0 35-39 37.23965 38.0 38.0 38.0 38.0 38.0 40-44 37.271950000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.207350000000005 38.0 38.0 38.0 37.8 38.0 50-54 37.1171 38.0 38.0 38.0 37.0 38.0 55-59 36.91695 38.0 38.0 38.0 36.4 38.0 60-64 36.33775 38.0 37.8 38.0 33.4 38.0 65-69 37.193400000000004 38.0 38.0 38.0 37.4 38.0 70-74 36.91735 38.0 38.0 38.0 37.0 38.0 75-79 36.0208 38.0 38.0 38.0 35.6 38.0 80-84 36.5035 38.0 38.0 38.0 35.8 38.0 85-89 36.908100000000005 38.0 38.0 38.0 36.8 38.0 90-94 36.9001 38.0 38.0 38.0 37.0 38.0 95-99 36.83145 38.0 38.0 38.0 36.0 38.0 100-104 36.55415 38.0 38.0 38.0 35.6 38.0 105-109 35.22745 38.0 38.0 38.0 32.4 38.0 110-114 34.3073 38.0 37.8 38.0 23.4 38.0 115-119 33.69839999999999 38.0 37.2 38.0 14.6 38.0 120-124 33.6825 38.0 36.6 38.0 17.6 38.0 125-129 34.22965 38.0 37.0 38.0 22.6 38.0 130-134 35.0674 38.0 37.2 38.0 27.4 38.0 135-139 35.4629 38.0 37.0 38.0 33.0 38.0 140-144 34.6125 38.0 35.4 38.0 27.2 38.0 145-149 34.702099999999994 38.0 36.0 38.0 29.8 38.0 150-151 30.859375 35.5 29.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 6.0 4 2.0 5 0.0 6 0.0 7 1.0 8 1.0 9 3.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 5.0 16 3.0 17 3.0 18 2.0 19 4.0 20 19.0 21 10.0 22 4.0 23 24.0 24 10.0 25 11.0 26 6.0 27 35.0 28 33.0 29 40.0 30 53.0 31 54.0 32 77.0 33 99.0 34 101.0 35 205.0 36 432.0 37 2741.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.46182728410513 18.34793491864831 23.103879849812266 29.086357947434294 2 24.699097291875628 24.899699097291876 31.018054162487463 19.383149448345037 3 21.42142142142142 27.677677677677675 30.53053053053053 20.37037037037037 4 22.753441802252816 31.76470588235294 24.780976220275345 20.700876095118897 5 25.231539424280353 34.01752190237797 23.62953692115144 17.121401752190238 6 21.25 37.05 23.849999999999998 17.849999999999998 7 19.579894973743436 20.905226306576644 40.41010252563141 19.10477619404851 8 21.9 24.9 28.4 24.8 9 21.85 25.650000000000002 29.7 22.8 10-14 23.810000000000002 28.610000000000003 26.295 21.285 15-19 23.1 27.77 28.28 20.849999999999998 20-24 22.65406162464986 28.50640256102441 27.74609843937575 21.093437374949982 25-29 22.876013209246473 27.83448413889723 27.93955769038327 21.34994496147303 30-34 22.709761344874167 27.73802971931756 28.603592335017762 20.948616600790515 35-39 23.35835835835836 27.64764764764765 28.073073073073076 20.92092092092092 40-44 23.302137030178667 28.081677593714026 27.806416095290526 20.809769280816777 45-49 23.618895116092876 27.66212970376301 28.282626100880705 20.43634907926341 50-54 23.42702810843253 28.453536060818248 27.488246473942183 20.63118935680704 55-59 23.597978888388614 27.835309420181098 27.86032317774776 20.706388513682526 60-64 23.8973897389739 27.07270727072707 27.797779777977798 21.232123212321234 65-69 23.862158647594278 27.588276482944885 27.98839651895569 20.561168350505152 70-74 23.44095755381211 27.47435123717562 28.414805874069604 20.669885334942666 75-79 23.25162220620043 27.701102070244104 28.380883716139664 20.666392007415798 80-84 23.2757317749005 28.33392110433775 28.06690513375989 20.323441987001864 85-89 23.68868868868869 27.017017017017015 28.31831831831832 20.975975975975977 90-94 23.201240868608025 27.509256479535676 28.700090063044133 20.58941258881217 95-99 24.09240924092409 27.597759775977597 28.04280428042804 20.267026702670268 100-104 24.264005215908522 27.930187070565225 27.127739605797686 20.678068107728574 105-109 23.548002694160925 27.858660173048026 27.874203409149782 20.71913372364126 110-114 24.271533781620235 27.847155512861566 27.895186252534955 19.98612445298324 115-119 24.672299859170188 28.3230419239519 27.077239735673274 19.927418481204636 120-124 24.434461735921705 27.958714369752393 27.39718701534841 20.209636878977484 125-129 24.64233115926783 27.945508100147276 27.182831895644853 20.229328844940035 130-134 25.32581895033463 27.73612438987571 26.99139536053943 19.94666129925024 135-139 24.98624931246562 27.74138706935347 27.636381819090953 19.635981799089954 140-144 26.108054027013505 27.693846923461727 27.01350675337669 19.18459229614807 145-149 25.507652295688704 28.543563068920676 27.01810543162949 18.930679203761127 150-151 26.289895294562886 27.16033808502586 26.88280560111013 19.666961019301123 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 1.5 24 1.5 25 2.0 26 1.5 27 1.0 28 3.5 29 10.5 30 14.0 31 11.5 32 17.5 33 30.5 34 49.5 35 70.5 36 89.0 37 117.5 38 144.5 39 162.5 40 184.0 41 212.5 42 248.0 43 278.0 44 288.5 45 293.0 46 287.5 47 269.0 48 249.5 49 212.0 50 173.0 51 141.0 52 111.0 53 93.5 54 72.0 55 47.5 56 28.5 57 18.0 58 14.0 59 9.5 60 7.0 61 6.0 62 5.0 63 4.0 64 2.5 65 2.0 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.3 3 0.1 4 0.125 5 0.125 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.06999999999999999 30-34 0.065 35-39 0.1 40-44 0.095 45-49 0.08 50-54 0.03 55-59 0.055 60-64 0.01 65-69 0.03 70-74 0.58 75-79 2.91 80-84 0.755 85-89 0.1 90-94 0.06999999999999999 95-99 0.01 100-104 0.305 105-109 3.495 110-114 6.3100000000000005 115-119 7.6899999999999995 120-124 6.505 125-129 4.9399999999999995 130-134 0.635 135-139 0.005 140-144 0.05 145-149 0.03 150-151 0.9125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49584068565667 98.675 2 0.4789513486261659 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 15 0.375 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.9000000000000004 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 3.9875 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.925 0.0 0.0 0.0 0.0 120-121 5.5125 0.0 0.0 0.0 0.0 122-123 6.1375 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.35 0.0 0.0 0.0 0.0 128-129 7.8625 0.0 0.0 0.0 0.0 130-131 8.4625 0.0 0.0 0.0 0.0 132-133 9.1625 0.0 0.0 0.0 0.0 134-135 9.7625 0.0 0.0 0.0 0.0 136-137 10.3 0.0 0.0 0.0 0.0 138-139 11.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGT 10 0.0071167517 143.025 7 GACCTGT 10 0.0071167517 143.025 6 >>END_MODULE Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra Read 623940 spots for SRR7169824.sra Written 623940 spots for SRR7169824.sra Read 623932 spots for SRR7169824.sra Written 623932 spots for SRR7169824.sra SRR ids: ['SRR7169824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mth34zvp SRR7169824.sra spots: 12478648 blocks: [[1, 623932], [623933, 1247864], [1247865, 1871796], [1871797, 2495728], [2495729, 3119660], [3119661, 3743592], [3743593, 4367524], [4367525, 4991456], [4991457, 5615388], [5615389, 6239320], [6239321, 6863252], [6863253, 7487184], [7487185, 8111116], [8111117, 8735048], [8735049, 9358980], [9358981, 9982912], [9982913, 10606844], [10606845, 11230776], [11230777, 11854708], [11854709, 12478648]] SRR7169824 file size 4206903 SRR7169824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169824 SRR7169824_1.fastq SRR7169824_2.fastq Input file: SRR7169824_1.fastq Paired file: SRR7169824_2.fastq trimmed: SRR7169824-trimmed-pair1.fastq, SRR7169824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:15:46 2025 >> started Tue Feb 11 21:16:01 2025 >> done (14.411s) 12478648 read pairs processed; of these: 14724 ( 0.12%) short read pairs filtered out after trimming by size control 71730 ( 0.57%) empty read pairs filtered out after trimming by size control 12392194 (99.31%) read pairs available; of these: 5603742 (45.22%) trimmed read pairs available after processing 6788452 (54.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 8 0.00% 21 8 0.00% 22 5 0.00% 23 4 0.00% 24 7 0.00% 25 7 0.00% 26 7 0.00% 27 7 0.00% 28 4 0.00% 29 3 0.00% 30 8 0.00% 31 12 0.00% 32 15 0.00% 33 11 0.00% 34 20 0.00% 35 14 0.00% 36 23 0.00% 37 31 0.00% 38 24 0.00% 39 38 0.00% 40 56 0.00% 41 54 0.00% 42 56 0.00% 43 54 0.00% 44 84 0.00% 45 90 0.00% 46 86 0.00% 47 121 0.00% 48 166 0.00% 49 154 0.00% 50 203 0.00% 51 213 0.00% 52 226 0.00% 53 263 0.00% 54 255 0.00% 55 284 0.00% 56 317 0.00% 57 366 0.00% 58 443 0.00% 59 438 0.00% 60 573 0.00% 61 560 0.00% 62 581 0.00% 63 689 0.01% 64 761 0.01% 65 803 0.01% 66 874 0.01% 67 973 0.01% 68 1185 0.01% 69 1245 0.01% 70 1470 0.01% 71 1637 0.01% 72 1999 0.02% 73 2327 0.02% 74 2411 0.02% 75 2795 0.02% 76 3864 0.03% 77 4494 0.04% 78 3719 0.03% 79 3818 0.03% 80 4240 0.03% 81 4842 0.04% 82 5266 0.04% 83 5921 0.05% 84 7043 0.06% 85 7940 0.06% 86 8483 0.07% 87 9162 0.07% 88 9768 0.08% 89 10332 0.08% 90 11048 0.09% 91 11567 0.09% 92 12464 0.10% 93 13523 0.11% 94 14422 0.12% 95 15631 0.13% 96 16038 0.13% 97 17308 0.14% 98 17933 0.14% 99 18542 0.15% 100 19626 0.16% 101 20212 0.16% 102 21283 0.17% 103 22413 0.18% 104 23105 0.19% 105 24595 0.20% 106 25875 0.21% 107 26193 0.21% 108 27166 0.22% 109 28149 0.23% 110 28832 0.23% 111 29361 0.24% 112 30636 0.25% 113 31244 0.25% 114 32342 0.26% 115 34306 0.28% 116 35045 0.28% 117 35662 0.29% 118 36535 0.29% 119 37167 0.30% 120 37556 0.30% 121 38599 0.31% 122 39026 0.31% 123 39914 0.32% 124 41407 0.33% 125 42637 0.34% 126 43936 0.35% 127 45050 0.36% 128 45857 0.37% 129 46593 0.38% 130 47921 0.39% 131 48241 0.39% 132 48506 0.39% 133 49963 0.40% 134 51471 0.42% 135 52141 0.42% 136 54051 0.44% 137 56491 0.46% 138 58563 0.47% 139 60516 0.49% 140 62913 0.51% 141 66491 0.54% 142 70747 0.57% 143 74954 0.60% 144 82938 0.67% 145 90861 0.73% 146 107587 0.87% 147 138922 1.12% 148 203095 1.64% 149 420079 3.39% 150 2504523 20.21% 151 6788452 54.78% 12392194 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=10 fanout-score=56.33 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=12.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.43 fanout-score-rank=18 prefix-density=0.31 prefix-fanout=3.9 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=40 fanout-score=51.74 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.3 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169824 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:17:20 Started mapping on | Feb 11 21:17:20 Finished on | Feb 11 21:18:40 Mapping speed, Million of reads per hour | 557.65 Number of input reads | 12392194 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11902968 Uniquely mapped reads % | 96.05% Average mapped length | 290.72 Number of splices: Total | 10731884 Number of splices: Annotated (sjdb) | 10549435 Number of splices: GT/AG | 10585141 Number of splices: GC/AG | 115415 Number of splices: AT/AC | 8839 Number of splices: Non-canonical | 22489 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195387 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 76325 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.66% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 303649 303649 303649 N_multimapping 195387 195387 195387 N_noFeature 298059 11751648 349863 N_ambiguous 145149 650 45241 UnstrandedReadsAssigned:11459760 PositiveStrandReadsAssigned:150670 NegativeStrandReadsAssigned:11507864 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169824-trimmed-pair1.fastq SRR7169824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,392,194 reads, 11,501,555 reads pseudoaligned [quant] estimated average fragment length: 214.764 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7169824.ke.tsv 34699 SRR7169824.se.tsv 87100 total ==> SRR7169824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.24 205 10.9294 Potri.005G024800.1.v4.1 1035 821.236 9 1.05417 Potri.004G059700.1.v4.1 961 747.271 2 0.257448 Potri.007G009000.2.v4.1 1416 1202.24 0 0 Potri.003G141000.2.v4.1 2943 2729.24 187.084 6.59377 Potri.016G087400.1.v4.1 270 92.496 1022.53 1063.39 Potri.015G069301.1.v4.1 564 352.688 0 0 Potri.010G195200.1.v4.1 1773 1559.24 13.8058 0.8517 Potri.012G127500.1.v4.1 977 763.259 1865 235.041 ==> SRR7169824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1139 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169824 completed mapping pipeline successfully