Starting /dee2/code/volunteer_pipeline.sh SRR7169825 current disk space = 3052944904192 free memory = 1497996112 SRR7169825 SRAfilesize e87e54a7e28f0ad9afa511ffbe9e31cc SRR7169825.sra SRR7169825.sra file validated SRR7169825 is paired end SRR7169825 is conventional basespace SRR7169825 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.741 32.0 25.0 33.0 18.0 33.0 2 30.42175 31.0 29.0 33.0 27.0 33.0 3 32.297 33.0 33.0 33.0 31.0 33.0 4 32.773 33.0 33.0 34.0 31.0 34.0 5 33.20225 33.0 33.0 34.0 33.0 34.0 6 37.29225 38.0 38.0 38.0 36.0 38.0 7 37.56825 38.0 38.0 38.0 37.0 38.0 8 37.624 38.0 38.0 38.0 38.0 38.0 9 37.66625 38.0 38.0 38.0 38.0 38.0 10-14 37.711149999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.70225 38.0 38.0 38.0 38.0 38.0 20-24 37.69625 38.0 38.0 38.0 38.0 38.0 25-29 37.7037 38.0 38.0 38.0 38.0 38.0 30-34 37.6698 38.0 38.0 38.0 38.0 38.0 35-39 37.682849999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.61194999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.58775 38.0 38.0 38.0 38.0 38.0 50-54 37.48015 38.0 38.0 38.0 37.8 38.0 55-59 37.56255 38.0 38.0 38.0 38.0 38.0 60-64 37.38945 38.0 38.0 38.0 37.6 38.0 65-69 37.401799999999994 38.0 38.0 38.0 37.4 38.0 70-74 37.389250000000004 38.0 38.0 38.0 37.2 38.0 75-79 37.2965 38.0 38.0 38.0 37.0 38.0 80-84 37.20215 38.0 38.0 38.0 37.0 38.0 85-89 37.116049999999994 38.0 38.0 38.0 37.0 38.0 90-94 37.04775 38.0 38.0 38.0 36.4 38.0 95-99 37.069500000000005 38.0 38.0 38.0 36.4 38.0 100-104 36.96775 38.0 38.0 38.0 36.2 38.0 105-109 36.432399999999994 38.0 38.0 38.0 35.2 38.0 110-114 36.4293 38.0 38.0 38.0 35.0 38.0 115-119 36.66765 38.0 38.0 38.0 35.0 38.0 120-124 36.65145 38.0 38.0 38.0 35.0 38.0 125-129 36.5363 38.0 38.0 38.0 34.8 38.0 130-134 36.2447 38.0 38.0 38.0 34.0 38.0 135-139 35.96385 38.0 37.8 38.0 33.0 38.0 140-144 35.7457 38.0 36.8 38.0 32.8 38.0 145-149 35.4152 38.0 36.2 38.0 31.4 38.0 150-151 32.35375 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 3.0 18 2.0 19 8.0 20 2.0 21 5.0 22 3.0 23 1.0 24 7.0 25 6.0 26 6.0 27 5.0 28 15.0 29 12.0 30 22.0 31 31.0 32 39.0 33 62.0 34 92.0 35 169.0 36 457.0 37 3043.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.84472827448034 10.793889306286001 11.470072627097421 37.89130979213624 2 22.8 15.35 32.675 29.175 3 19.900000000000002 19.1 25.924999999999997 35.075 4 22.516887665749312 27.570678008506377 22.466850137603203 27.445584188141105 5 23.3 30.825000000000003 25.074999999999996 20.8 6 19.925 33.425 24.3 22.35 7 15.775 26.375 40.025 17.825 8 17.4 25.25 31.6 25.75 9 16.35 25.05 34.449999999999996 24.15 10-14 20.21 29.354999999999997 27.205000000000002 23.23 15-19 20.244999999999997 28.075 27.775 23.905 20-24 19.675 28.605000000000004 28.175 23.544999999999998 25-29 19.495 28.685 27.800000000000004 24.02 30-34 20.146007300365017 28.96644832241612 27.011350567528375 23.876193809690484 35-39 19.66 28.84 27.325 24.175 40-44 19.515 28.955 27.455000000000002 24.075 45-49 20.419999999999998 28.425 27.265 23.89 50-54 20.095 28.439999999999998 27.284999999999997 24.18 55-59 20.125 28.305000000000003 27.689999999999998 23.880000000000003 60-64 20.293484249010866 28.23659037411729 27.560474783392596 23.90945059347924 65-69 19.825 28.365000000000002 27.3 24.51 70-74 20.165 29.360000000000003 26.82 23.655 75-79 20.169999999999998 28.34 27.474999999999998 24.015 80-84 20.53 28.439999999999998 27.315 23.715 85-89 20.200000000000003 28.884999999999998 27.045 23.87 90-94 20.51 28.470000000000002 27.12 23.9 95-99 20.44 29.294999999999998 26.284999999999997 23.98 100-104 20.624906113865105 28.61649391617846 27.675128936958586 23.083471032997846 105-109 20.551403756816804 27.832761058372046 27.72167238941628 23.89416279539487 110-114 20.694353332996922 27.920472321743954 27.471362971186352 23.913811374072765 115-119 20.48 28.585 26.884999999999998 24.05 120-124 20.61 28.189999999999998 26.86 24.34 125-129 21.495 28.49 26.279999999999998 23.735 130-134 21.01 28.000000000000004 26.615 24.375 135-139 21.215 28.595 25.985000000000003 24.205 140-144 20.724999999999998 28.65 26.165 24.46 145-149 21.185000000000002 27.800000000000004 26.13 24.884999999999998 150-151 20.375 27.9125 26.987499999999997 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 1.0 25 3.0 26 6.5 27 7.0 28 9.0 29 12.0 30 13.0 31 24.5 32 35.5 33 44.5 34 48.0 35 53.0 36 76.0 37 95.5 38 125.0 39 158.5 40 185.0 41 214.5 42 235.5 43 246.0 44 254.0 45 263.5 46 272.0 47 265.0 48 249.0 49 221.5 50 186.5 51 150.5 52 120.5 53 104.0 54 89.5 55 70.0 56 43.0 57 28.5 58 27.5 59 20.0 60 9.5 61 6.0 62 5.0 63 6.0 64 4.5 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.165 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.145 105-109 0.98 110-114 0.915 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.6046863189720333 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02519526329050139 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 8 0.2 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.2249999999999996 0.0 0.0 0.0 0.0 114-115 3.625 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.4875 0.0 0.0 0.0 0.0 122-123 6.237500000000001 0.0 0.0 0.0 0.0 124-125 6.775 0.0 0.0 0.0 0.0 126-127 7.324999999999999 0.0 0.0 0.0 0.0 128-129 7.9375 0.0 0.0 0.0 0.0 130-131 8.575 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 9.8625 0.0 0.0 0.0 0.0 136-137 10.4125 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTTA 10 0.0068661636 144.75 8 GGCTTTA 10 0.0068661636 144.75 4 >>END_MODULE SRR7169825 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.184 34.0 33.0 34.0 33.0 34.0 2 33.24375 34.0 33.0 34.0 33.0 34.0 3 33.274 34.0 33.0 34.0 33.0 34.0 4 33.20925 34.0 33.0 34.0 33.0 34.0 5 33.1965 34.0 33.0 34.0 33.0 34.0 6 37.38675 38.0 38.0 38.0 38.0 38.0 7 37.39825 38.0 38.0 38.0 38.0 38.0 8 37.379 38.0 38.0 38.0 38.0 38.0 9 37.43075 38.0 38.0 38.0 38.0 38.0 10-14 37.42305 38.0 38.0 38.0 38.0 38.0 15-19 37.40805 38.0 38.0 38.0 38.0 38.0 20-24 37.33975 38.0 38.0 38.0 38.0 38.0 25-29 37.303700000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.3054 38.0 38.0 38.0 38.0 38.0 35-39 37.26175 38.0 38.0 38.0 38.0 38.0 40-44 37.2581 38.0 38.0 38.0 38.0 38.0 45-49 37.1815 38.0 38.0 38.0 37.4 38.0 50-54 37.06425 38.0 38.0 38.0 36.8 38.0 55-59 36.918150000000004 38.0 38.0 38.0 36.2 38.0 60-64 36.33435000000001 38.0 37.8 38.0 33.6 38.0 65-69 37.190200000000004 38.0 38.0 38.0 37.0 38.0 70-74 36.898 38.0 38.0 38.0 36.8 38.0 75-79 35.99695 38.0 38.0 38.0 35.4 38.0 80-84 36.534800000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.906549999999996 38.0 38.0 38.0 36.8 38.0 90-94 36.87175 38.0 38.0 38.0 36.4 38.0 95-99 36.85315 38.0 38.0 38.0 36.2 38.0 100-104 36.5653 38.0 38.0 38.0 35.4 38.0 105-109 35.18985 38.0 38.0 38.0 31.8 38.0 110-114 34.408550000000005 38.0 38.0 38.0 23.6 38.0 115-119 33.7531 38.0 37.2 38.0 14.8 38.0 120-124 33.71204999999999 38.0 36.4 38.0 19.4 38.0 125-129 34.22955 38.0 36.8 38.0 23.4 38.0 130-134 35.13215 38.0 36.8 38.0 28.8 38.0 135-139 35.345299999999995 38.0 37.0 38.0 32.0 38.0 140-144 34.4578 38.0 35.4 38.0 26.2 38.0 145-149 34.47165 38.0 36.0 38.0 29.2 38.0 150-151 30.383499999999998 35.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 3.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 3.0 13 0.0 14 3.0 15 3.0 16 3.0 17 10.0 18 7.0 19 7.0 20 8.0 21 10.0 22 9.0 23 21.0 24 9.0 25 16.0 26 11.0 27 34.0 28 33.0 29 62.0 30 62.0 31 51.0 32 67.0 33 92.0 34 102.0 35 193.0 36 440.0 37 2728.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.76971214017522 19.424280350438046 16.77096370463079 28.035043804755944 2 25.60120240480962 24.799599198396795 30.085170340681362 19.514028056112224 3 20.635317658829415 27.988994497248626 32.416208104052025 18.959479739869938 4 24.80600750938673 32.866082603254064 22.703379224030037 19.62453066332916 5 24.712356178089045 35.24262131065532 21.935967983991997 18.10905452726363 6 21.205301325331334 35.8589647411853 23.53088272068017 19.4048512128032 7 19.779944986246562 21.13028257064266 39.6099024756189 19.479869967491872 8 22.525000000000002 25.825 27.925 23.724999999999998 9 22.775000000000002 25.2 28.799999999999997 23.225 10-14 23.96 28.59 25.545 21.905 15-19 23.755000000000003 27.894999999999996 27.034999999999997 21.315 20-24 23.2746549309862 27.720544108821766 27.730546109221844 21.274254850970195 25-29 23.634180508304983 28.111867120272166 27.556533920352212 20.697418451070643 30-34 23.934360616369823 28.46708024814889 27.13127876726036 20.467280368220933 35-39 23.67749361893799 27.41604524298083 27.8214303588409 21.085030779240277 40-44 24.402081457019914 27.614330031021716 27.904533173221257 20.079055338737117 45-49 24.105847631434145 27.212245510479715 27.64243909759392 21.039467760492222 50-54 23.442032609782935 28.018405521656497 27.093127938381517 21.446433930179055 55-59 24.14948969381629 27.70662397438463 27.576545927556534 20.567340404242547 60-64 23.666183309165458 27.571378568928445 28.186409320466023 20.57602880144007 65-69 23.134626925385078 27.310462092418486 28.52070414082817 21.034206841368274 70-74 24.31100382216858 27.96218064775699 26.981492657412996 20.745322872661436 75-79 23.673364245234417 27.90829469345698 27.429160226687276 20.98918083462133 80-84 24.467281245277317 28.47715480328447 27.19762228603093 19.85794166540728 85-89 23.787840880660497 27.500625469101823 28.006004503377536 20.705529146860144 90-94 24.159663865546218 27.696078431372552 27.385954381752704 20.75830332132853 95-99 24.133620043006452 27.99419912986948 27.684152622893432 20.188028204230633 100-104 24.776852873332665 28.001203490121352 27.053455019556715 20.16848861698927 105-109 24.840731340964417 27.528875537369867 27.844823121147773 19.785570000517946 110-114 24.69825065135322 27.548253309937788 27.27707768384112 20.476418354867867 115-119 24.916460062520212 27.772986956990408 27.789155977147782 19.521397003341598 120-124 25.250266240681572 27.710330138445155 27.252396166134186 19.787007454739083 125-129 25.506561679790025 27.62729658792651 27.54855643044619 19.31758530183727 130-134 25.58888665190256 27.617274008455812 27.13408496074089 19.659754378900747 135-139 26.07630381519076 27.301365068253414 26.921346067303364 19.700985049252463 140-144 25.82533013205282 27.501000400160063 27.125850340136054 19.54781912765106 145-149 26.383957593639046 27.78916837525629 26.939040856128422 18.887833174976247 150-151 27.141955835962143 26.977917981072558 27.293375394321767 18.58675078864353 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 1.0 25 0.0 26 1.0 27 2.0 28 4.0 29 7.5 30 10.0 31 16.0 32 20.0 33 23.0 34 29.5 35 45.0 36 66.0 37 90.0 38 125.0 39 166.5 40 192.0 41 216.0 42 249.0 43 263.0 44 279.0 45 297.5 46 300.5 47 280.0 48 259.5 49 226.0 50 175.0 51 150.0 52 124.0 53 96.0 54 81.5 55 59.0 56 30.0 57 22.5 58 20.5 59 12.0 60 10.0 61 9.0 62 10.0 63 8.0 64 4.5 65 3.0 66 2.0 67 1.5 68 2.5 69 2.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.2 3 0.05 4 0.125 5 0.05 6 0.025 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.06 30-34 0.06 35-39 0.095 40-44 0.06999999999999999 45-49 0.045 50-54 0.03 55-59 0.06 60-64 0.005 65-69 0.02 70-74 0.58 75-79 2.9499999999999997 80-84 0.745 85-89 0.075 90-94 0.04 95-99 0.015 100-104 0.29 105-109 3.465 110-114 5.965 115-119 7.23 120-124 6.1 125-129 4.75 130-134 0.66 135-139 0.005 140-144 0.04 145-149 0.015 150-151 0.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.5033979360684621 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025169896803423106 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.7249999999999996 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.9625 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 5.2 0.0 0.0 0.0 0.0 122-123 5.9625 0.0 0.0 0.0 0.0 124-125 6.5375 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.6375 0.0 0.0 0.0 0.0 130-131 8.2875 0.0 0.0 0.0 0.0 132-133 8.962499999999999 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.1125 0.0 0.0 0.0 0.0 138-139 10.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATAC 10 0.007127921 142.95 8 ACCAGCT 10 0.007127921 142.95 6 >>END_MODULE Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558079 spots for SRR7169825.sra Written 558079 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra Read 558071 spots for SRR7169825.sra Written 558071 spots for SRR7169825.sra SRR ids: ['SRR7169825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_382_pdnq SRR7169825.sra spots: 11161428 blocks: [[1, 558071], [558072, 1116142], [1116143, 1674213], [1674214, 2232284], [2232285, 2790355], [2790356, 3348426], [3348427, 3906497], [3906498, 4464568], [4464569, 5022639], [5022640, 5580710], [5580711, 6138781], [6138782, 6696852], [6696853, 7254923], [7254924, 7812994], [7812995, 8371065], [8371066, 8929136], [8929137, 9487207], [9487208, 10045278], [10045279, 10603349], [10603350, 11161428]] SRR7169825 file size 3760541 SRR7169825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169825 SRR7169825_1.fastq SRR7169825_2.fastq Input file: SRR7169825_1.fastq Paired file: SRR7169825_2.fastq trimmed: SRR7169825-trimmed-pair1.fastq, SRR7169825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:57:57 2025 >> started Tue Feb 11 20:58:09 2025 >> done (12.148s) 11161428 read pairs processed; of these: 14770 ( 0.13%) short read pairs filtered out after trimming by size control 25042 ( 0.22%) empty read pairs filtered out after trimming by size control 11121616 (99.64%) read pairs available; of these: 4888557 (43.96%) trimmed read pairs available after processing 6233059 (56.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 6 0.00% 25 3 0.00% 26 7 0.00% 27 6 0.00% 28 4 0.00% 29 2 0.00% 30 8 0.00% 31 6 0.00% 32 11 0.00% 33 6 0.00% 34 10 0.00% 35 8 0.00% 36 10 0.00% 37 14 0.00% 38 18 0.00% 39 12 0.00% 40 20 0.00% 41 21 0.00% 42 25 0.00% 43 24 0.00% 44 36 0.00% 45 28 0.00% 46 40 0.00% 47 50 0.00% 48 57 0.00% 49 66 0.00% 50 77 0.00% 51 63 0.00% 52 86 0.00% 53 128 0.00% 54 121 0.00% 55 124 0.00% 56 154 0.00% 57 142 0.00% 58 180 0.00% 59 222 0.00% 60 245 0.00% 61 288 0.00% 62 342 0.00% 63 394 0.00% 64 442 0.00% 65 461 0.00% 66 553 0.00% 67 595 0.01% 68 709 0.01% 69 774 0.01% 70 870 0.01% 71 1105 0.01% 72 1236 0.01% 73 1411 0.01% 74 1627 0.01% 75 1852 0.02% 76 2338 0.02% 77 2976 0.03% 78 2972 0.03% 79 2938 0.03% 80 3079 0.03% 81 3469 0.03% 82 4030 0.04% 83 4433 0.04% 84 5612 0.05% 85 6528 0.06% 86 6841 0.06% 87 7352 0.07% 88 8050 0.07% 89 8260 0.07% 90 8865 0.08% 91 9559 0.09% 92 10105 0.09% 93 10884 0.10% 94 11894 0.11% 95 12740 0.11% 96 13476 0.12% 97 14298 0.13% 98 14735 0.13% 99 14935 0.13% 100 15908 0.14% 101 16826 0.15% 102 17856 0.16% 103 19016 0.17% 104 20104 0.18% 105 21110 0.19% 106 22127 0.20% 107 22629 0.20% 108 22958 0.21% 109 24004 0.22% 110 24543 0.22% 111 25144 0.23% 112 26298 0.24% 113 28074 0.25% 114 29012 0.26% 115 30237 0.27% 116 31027 0.28% 117 31550 0.28% 118 32236 0.29% 119 32410 0.29% 120 33432 0.30% 121 34167 0.31% 122 35121 0.32% 123 36240 0.33% 124 37212 0.33% 125 38476 0.35% 126 39945 0.36% 127 41010 0.37% 128 41801 0.38% 129 42228 0.38% 130 42663 0.38% 131 43585 0.39% 132 44520 0.40% 133 45654 0.41% 134 47258 0.42% 135 49308 0.44% 136 50316 0.45% 137 51699 0.46% 138 54055 0.49% 139 55474 0.50% 140 57993 0.52% 141 60333 0.54% 142 64811 0.58% 143 67632 0.61% 144 75852 0.68% 145 82864 0.75% 146 96640 0.87% 147 122522 1.10% 148 174192 1.57% 149 353014 3.17% 150 2170385 19.52% 151 6233059 56.04% 11121616 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.5 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=351.54 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=18.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=40 prefix-density=0.17 prefix-fanout=2.2 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=51.55 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.0 sequence=TCAAGGAAGCTTTCAG SRR7169825 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:58:56 Started mapping on | Feb 11 20:58:57 Finished on | Feb 11 21:00:10 Mapping speed, Million of reads per hour | 548.46 Number of input reads | 11121616 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10450864 Uniquely mapped reads % | 93.97% Average mapped length | 291.07 Number of splices: Total | 9117040 Number of splices: Annotated (sjdb) | 8949820 Number of splices: GT/AG | 8979879 Number of splices: GC/AG | 106655 Number of splices: AT/AC | 7463 Number of splices: Non-canonical | 23043 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190078 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 13780 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 493038 493038 493038 N_multimapping 190078 190078 190078 N_noFeature 258419 10321320 311475 N_ambiguous 122335 995 45089 UnstrandedReadsAssigned:10070110 PositiveStrandReadsAssigned:128549 NegativeStrandReadsAssigned:10094300 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169825-trimmed-pair1.fastq SRR7169825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,121,616 reads, 10,047,542 reads pseudoaligned [quant] estimated average fragment length: 212.193 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7169825.ke.tsv 34699 SRR7169825.se.tsv 87100 total ==> SRR7169825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.81 228 13.2686 Potri.005G024800.1.v4.1 1035 823.807 30 3.82912 Potri.004G059700.1.v4.1 961 749.813 4 0.560932 Potri.007G009000.2.v4.1 1416 1204.81 0 0 Potri.003G141000.2.v4.1 2943 2731.81 191.044 7.35337 Potri.016G087400.1.v4.1 270 91.1879 1026.83 1184.04 Potri.015G069301.1.v4.1 564 354.475 0 0 Potri.010G195200.1.v4.1 1773 1561.81 41 2.76032 Potri.012G127500.1.v4.1 977 765.813 4834 663.724 ==> SRR7169825.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1520 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169825 completed mapping pipeline successfully