Starting /dee2/code/volunteer_pipeline.sh SRR7169826 current disk space = 3052674007040 free memory = 1503041200 SRR7169826 SRAfilesize e2c706b2d27295bdc62da787f29fb98f SRR7169826.sra SRR7169826.sra file validated SRR7169826 is paired end SRR7169826 is conventional basespace SRR7169826 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35875 33.0 33.0 34.0 31.0 34.0 2 33.04825 33.0 33.0 34.0 32.0 34.0 3 32.72425 33.0 33.0 34.0 31.0 34.0 4 33.04725 34.0 33.0 34.0 31.0 34.0 5 33.1215 34.0 33.0 34.0 32.0 34.0 6 36.99925 38.0 37.0 38.0 36.0 38.0 7 37.3595 38.0 38.0 38.0 37.0 38.0 8 37.32775 38.0 38.0 38.0 37.0 38.0 9 37.446 38.0 38.0 38.0 37.0 38.0 10-14 37.5126 38.0 38.0 38.0 37.8 38.0 15-19 37.5033 38.0 38.0 38.0 37.8 38.0 20-24 37.45655 38.0 38.0 38.0 37.2 38.0 25-29 37.49935 38.0 38.0 38.0 37.8 38.0 30-34 37.43045 38.0 38.0 38.0 37.2 38.0 35-39 37.4343 38.0 38.0 38.0 37.0 38.0 40-44 37.30435 38.0 38.0 38.0 37.0 38.0 45-49 37.35045 38.0 38.0 38.0 37.0 38.0 50-54 37.26085 38.0 38.0 38.0 36.8 38.0 55-59 37.09185 38.0 38.0 38.0 36.0 38.0 60-64 37.071 38.0 38.0 38.0 36.0 38.0 65-69 37.10665 38.0 38.0 38.0 36.0 38.0 70-74 37.177749999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.04245 38.0 38.0 38.0 36.0 38.0 80-84 36.917950000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.7821 38.0 38.0 38.0 34.8 38.0 90-94 36.73205 38.0 38.0 38.0 34.8 38.0 95-99 36.7186 38.0 38.0 38.0 34.6 38.0 100-104 36.619099999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.366949999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.08775 38.0 37.6 38.0 33.4 38.0 115-119 36.158550000000005 38.0 37.4 38.0 33.6 38.0 120-124 36.22215 38.0 37.4 38.0 33.6 38.0 125-129 36.06185 38.0 37.0 38.0 33.2 38.0 130-134 35.71875 38.0 36.6 38.0 32.2 38.0 135-139 35.2904 38.0 35.8 38.0 30.4 38.0 140-144 34.9137 38.0 35.4 38.0 28.2 38.0 145-149 34.57255 38.0 35.0 38.0 28.0 38.0 150-151 30.893 36.5 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 5.0 22 7.0 23 4.0 24 5.0 25 14.0 26 11.0 27 19.0 28 35.0 29 21.0 30 37.0 31 46.0 32 60.0 33 105.0 34 142.0 35 263.0 36 571.0 37 2648.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.883767535070135 11.798597194388778 9.343687374749498 36.97394789579158 2 22.175 16.475 34.025 27.325 3 19.725 22.975 26.05 31.25 4 22.6 31.4 22.475 23.525 5 22.725 33.4 22.975 20.9 6 19.25 35.875 24.325 20.549999999999997 7 13.8 25.900000000000002 42.05 18.25 8 18.122653316645806 25.231539424280353 30.51314142678348 26.132665832290364 9 17.2 25.474999999999998 32.25 25.074999999999996 10-14 20.305 29.62 27.155 22.919999999999998 15-19 19.48 29.659999999999997 27.43 23.43 20-24 19.885 29.725 26.900000000000002 23.49 25-29 19.62 29.28 27.565 23.535 30-34 19.625 29.65 27.534999999999997 23.189999999999998 35-39 19.314999999999998 29.28 27.595 23.810000000000002 40-44 20.225 29.62 26.83 23.325000000000003 45-49 20.669999999999998 29.099999999999998 27.065 23.165 50-54 20.02 28.76 27.565 23.655 55-59 20.005 29.035 27.71 23.25 60-64 20.285 28.865000000000002 27.694999999999997 23.155 65-69 20.015 28.815 27.589999999999996 23.580000000000002 70-74 20.105 28.84 26.88 24.175 75-79 20.26 28.785 26.93 24.025 80-84 20.135 28.935 26.919999999999998 24.01 85-89 20.43 29.404999999999998 26.63 23.535 90-94 20.695 28.915000000000003 26.810000000000002 23.580000000000002 95-99 20.59 28.115000000000002 27.644999999999996 23.65 100-104 20.715 29.035 26.97 23.28 105-109 20.341622707862346 28.74152223059533 27.41522230595328 23.501632755589046 110-114 20.816778152190313 29.215913091585776 27.123673489916005 22.843635266307903 115-119 20.393058958843827 28.609291393709057 27.029054358153726 23.968595289293393 120-124 21.205 28.694999999999997 27.065 23.035 125-129 20.94209420942094 28.992899289928992 26.642664266426642 23.42234223422342 130-134 20.994198839767954 29.040808161632327 27.010402080416085 22.954590918183637 135-139 20.909181836367274 28.835767153430687 26.44028805761152 23.814762952590517 140-144 20.74829931972789 28.361344537815125 26.90076030412165 23.989595838335333 145-149 21.2 28.785 26.47 23.544999999999998 150-151 20.42297584782881 29.02014766612439 26.229508196721312 24.32736828932549 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.0 24 1.5 25 2.5 26 6.0 27 11.0 28 12.0 29 12.5 30 18.5 31 22.5 32 31.0 33 44.0 34 58.0 35 78.0 36 99.0 37 114.0 38 133.5 39 163.5 40 183.0 41 201.5 42 237.5 43 264.0 44 257.0 45 273.0 46 273.0 47 256.5 48 248.0 49 212.0 50 173.5 51 136.5 52 123.5 53 100.0 54 62.5 55 51.0 56 38.0 57 22.5 58 17.0 59 12.0 60 9.0 61 8.5 62 5.5 63 2.5 64 4.0 65 6.5 66 3.5 67 0.0 68 1.0 69 1.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.125 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.475 110-114 0.585 115-119 0.015 120-124 0.0 125-129 0.01 130-134 0.02 135-139 0.02 140-144 0.04 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91304347826086 97.82499999999999 2 1.0616784630940344 2.1 3 0.02527805864509606 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1749999999999998 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.5750000000000002 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.5999999999999996 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.4375 0.0 0.0 0.0 0.0 112-113 3.8375000000000004 0.0 0.0 0.0 0.0 114-115 4.275 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.1625 0.0 0.0 0.0 0.0 120-121 5.675000000000001 0.0 0.0 0.0 0.0 122-123 6.0375 0.0 0.0 0.0 0.0 124-125 6.4625 0.0 0.0 0.0 0.0 126-127 6.975 0.0 0.0 0.0 0.0 128-129 7.7125 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.175 0.0 0.0 0.0 0.0 134-135 9.7 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 11.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATAAT 10 0.006862618 144.77501 2 CAGGCAA 10 0.006862618 144.77501 1 >>END_MODULE SRR7169826 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89425 33.0 33.0 34.0 32.0 34.0 2 33.006 34.0 33.0 34.0 32.0 34.0 3 33.12325 34.0 33.0 34.0 32.0 34.0 4 33.102 34.0 33.0 34.0 33.0 34.0 5 32.9275 34.0 33.0 34.0 32.0 34.0 6 37.13875 38.0 38.0 38.0 37.0 38.0 7 37.16375 38.0 38.0 38.0 37.0 38.0 8 37.1135 38.0 38.0 38.0 37.0 38.0 9 37.21725 38.0 38.0 38.0 37.0 38.0 10-14 37.1224 38.0 38.0 38.0 36.8 38.0 15-19 37.1079 38.0 38.0 38.0 37.0 38.0 20-24 37.0677 38.0 38.0 38.0 37.0 38.0 25-29 37.0336 38.0 38.0 38.0 36.8 38.0 30-34 36.90435 38.0 38.0 38.0 36.4 38.0 35-39 36.77605 38.0 38.0 38.0 35.6 38.0 40-44 36.8101 38.0 38.0 38.0 36.0 38.0 45-49 36.817400000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.45815 38.0 38.0 38.0 34.8 38.0 55-59 36.3381 38.0 37.8 38.0 33.8 38.0 60-64 36.64855 38.0 38.0 38.0 35.2 38.0 65-69 36.87065 38.0 38.0 38.0 36.0 38.0 70-74 36.468599999999995 38.0 38.0 38.0 35.2 38.0 75-79 35.51665 38.0 38.0 38.0 32.6 38.0 80-84 36.1097 38.0 38.0 38.0 33.2 38.0 85-89 36.461600000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.5047 38.0 38.0 38.0 34.8 38.0 95-99 36.355650000000004 38.0 38.0 38.0 34.6 38.0 100-104 35.97605 38.0 38.0 38.0 33.0 38.0 105-109 35.036 38.0 37.4 38.0 29.2 38.0 110-114 33.27405 38.0 35.4 38.0 15.0 38.0 115-119 33.2119 38.0 36.0 38.0 13.8 38.0 120-124 33.320100000000004 38.0 35.8 38.0 14.8 38.0 125-129 33.743399999999994 38.0 36.0 38.0 19.4 38.0 130-134 34.54545 38.0 35.4 38.0 25.8 38.0 135-139 34.321000000000005 38.0 35.2 38.0 24.0 38.0 140-144 33.6432 38.0 34.4 38.0 21.4 38.0 145-149 33.54315 38.0 33.0 38.0 20.6 38.0 150-151 29.196125000000002 35.5 26.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 6.0 5 1.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 1.0 12 3.0 13 2.0 14 4.0 15 4.0 16 2.0 17 8.0 18 6.0 19 6.0 20 3.0 21 14.0 22 17.0 23 25.0 24 18.0 25 9.0 26 22.0 27 26.0 28 53.0 29 70.0 30 68.0 31 82.0 32 98.0 33 160.0 34 163.0 35 252.0 36 520.0 37 2340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.300000000000004 20.474999999999998 14.149999999999999 26.075 2 26.424999999999997 25.3 31.374999999999996 16.900000000000002 3 20.575 29.525000000000002 31.05 18.85 4 23.825 34.275 23.724999999999998 18.175 5 24.455569461827285 35.69461827284105 21.877346683354194 17.972465581977474 6 20.37037037037037 37.512512512512515 23.773773773773772 18.343343343343342 7 19.950000000000003 22.0 37.95 20.1 8 21.11055527763882 25.312656328164078 27.863931965982992 25.71285642821411 9 21.65 25.124999999999996 30.125 23.1 10-14 23.3023302330233 28.757875787578758 26.547654765476548 21.392139213921393 15-19 23.12080872785507 27.3946551896707 28.28045240716645 21.20408367530778 20-24 23.156260952285585 27.92770239823762 28.082911931106995 20.8331247183698 25-29 22.913330664531625 28.532826261008807 28.05244195356285 20.501401120896716 30-34 22.81009110021023 27.66042646911603 28.48132946240865 21.04815296826509 35-39 23.105814011718163 28.04346737443037 28.389002954579603 20.46171565927187 40-44 22.939910942112373 28.27838094761595 27.587932155901335 21.19377595437034 45-49 23.119679519278918 28.44266399599399 27.69654481722584 20.74111166750125 50-54 23.7124248496994 27.655310621242485 28.236472945891784 20.395791583166336 55-59 23.961933383420984 27.558226897069872 28.36463811670423 20.11520160280491 60-64 23.15278334000801 27.267721265518624 29.20504605526632 20.37444933920705 65-69 23.472298683749564 27.426054752014412 28.78734798058155 20.314298583654473 70-74 23.294509151414307 28.23072656683306 27.76181112287601 20.71295315887662 75-79 23.331099541213465 27.723078509201503 28.578792721274294 20.367029228310738 80-84 23.642687906437466 27.978020870091243 28.179664263749558 20.19962695972173 85-89 23.547094188376754 27.675350701402806 28.466933867735474 20.31062124248497 90-94 23.704630788485606 27.784730913642054 28.185231539424283 20.32540675844806 95-99 23.809523809523807 27.650092634319762 28.37113815031796 20.169245405838467 100-104 24.45758380518114 27.489101568372 27.9651250187904 20.088189607656464 105-109 23.530015919478252 27.545832691418887 28.74236121809685 20.181790171006007 110-114 24.193548387096776 28.281699137655703 27.62163313105504 19.903119344192483 115-119 24.510495199869826 27.368877800075936 28.06855779139773 20.052069208656505 120-124 24.073580378565715 27.23007198080512 28.50439882697947 20.19194881364969 125-129 24.805713085486243 27.515227893299727 27.96681369460197 19.712245326612056 130-134 25.159925452072734 28.081398277338437 27.305696872009268 19.452979398579558 135-139 25.28407668819142 27.932121940231262 27.586724733443457 19.197076638133854 140-144 24.869817744842777 27.708792309232926 28.12938113358702 19.292008812337272 145-149 25.767055408178585 27.69908403824015 27.473847539916914 19.06001301366435 150-151 26.161552911709457 27.41390106449593 27.927363807138384 18.49718221665623 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 1.0 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 5.0 29 9.5 30 16.0 31 20.0 32 24.5 33 29.0 34 44.5 35 69.0 36 84.5 37 110.0 38 146.5 39 183.5 40 211.5 41 238.0 42 263.5 43 285.5 44 299.0 45 292.0 46 270.5 47 240.5 48 225.0 49 201.5 50 169.0 51 135.0 52 99.5 53 84.5 54 66.0 55 42.0 56 27.5 57 25.0 58 24.5 59 14.0 60 5.5 61 4.0 62 2.5 63 1.0 64 3.0 65 3.5 66 2.0 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.125 6 0.1 7 0.0 8 0.05 9 0.0 10-14 0.01 15-19 0.09 20-24 0.135 25-29 0.08 30-34 0.11 35-39 0.155 40-44 0.065 45-49 0.15 50-54 0.2 55-59 0.17500000000000002 60-64 0.12 65-69 0.095 70-74 0.835 75-79 3.005 80-84 0.815 85-89 0.2 90-94 0.125 95-99 0.145 100-104 0.215 105-109 2.635 110-114 6.069999999999999 115-119 7.8149999999999995 120-124 6.225 125-129 4.78 130-134 0.735 135-139 0.11499999999999999 140-144 0.13999999999999999 145-149 0.105 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.5499999999999998 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.8875 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 3.6624999999999996 0.0 0.0 0.0 0.0 114-115 4.050000000000001 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.3875 0.0 0.0 0.0 0.0 122-123 5.7125 0.0 0.0 0.0 0.0 124-125 6.0875 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 8.0875 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.2375 0.0 0.0 0.0 0.0 136-137 9.8875 0.0 0.0 0.0 0.0 138-139 10.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATATCA 10 0.007152202 142.78749 3 >>END_MODULE Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra Read 601474 spots for SRR7169826.sra Written 601474 spots for SRR7169826.sra Read 601458 spots for SRR7169826.sra Written 601458 spots for SRR7169826.sra SRR ids: ['SRR7169826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3xmz87mc SRR7169826.sra spots: 12029176 blocks: [[1, 601458], [601459, 1202916], [1202917, 1804374], [1804375, 2405832], [2405833, 3007290], [3007291, 3608748], [3608749, 4210206], [4210207, 4811664], [4811665, 5413122], [5413123, 6014580], [6014581, 6616038], [6616039, 7217496], [7217497, 7818954], [7818955, 8420412], [8420413, 9021870], [9021871, 9623328], [9623329, 10224786], [10224787, 10826244], [10826245, 11427702], [11427703, 12029176]] SRR7169826 file size 4054592 SRR7169826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169826 SRR7169826_1.fastq SRR7169826_2.fastq Input file: SRR7169826_1.fastq Paired file: SRR7169826_2.fastq trimmed: SRR7169826-trimmed-pair1.fastq, SRR7169826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:30:13 2025 >> started Tue Feb 11 21:30:25 2025 >> done (12.576s) 12029176 read pairs processed; of these: 14383 ( 0.12%) short read pairs filtered out after trimming by size control 12186 ( 0.10%) empty read pairs filtered out after trimming by size control 12002607 (99.78%) read pairs available; of these: 5643697 (47.02%) trimmed read pairs available after processing 6358910 (52.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 7 0.00% 28 3 0.00% 29 3 0.00% 30 5 0.00% 31 3 0.00% 32 4 0.00% 33 3 0.00% 34 11 0.00% 35 8 0.00% 36 13 0.00% 37 13 0.00% 38 18 0.00% 39 25 0.00% 40 26 0.00% 41 33 0.00% 42 28 0.00% 43 30 0.00% 44 41 0.00% 45 42 0.00% 46 51 0.00% 47 54 0.00% 48 66 0.00% 49 87 0.00% 50 110 0.00% 51 118 0.00% 52 132 0.00% 53 149 0.00% 54 149 0.00% 55 165 0.00% 56 176 0.00% 57 212 0.00% 58 256 0.00% 59 283 0.00% 60 310 0.00% 61 357 0.00% 62 453 0.00% 63 459 0.00% 64 562 0.00% 65 568 0.00% 66 666 0.01% 67 670 0.01% 68 853 0.01% 69 932 0.01% 70 1113 0.01% 71 1287 0.01% 72 1451 0.01% 73 1699 0.01% 74 1896 0.02% 75 2103 0.02% 76 2415 0.02% 77 2546 0.02% 78 2653 0.02% 79 3028 0.03% 80 3351 0.03% 81 3922 0.03% 82 4544 0.04% 83 5136 0.04% 84 6198 0.05% 85 6985 0.06% 86 7176 0.06% 87 7582 0.06% 88 8189 0.07% 89 8609 0.07% 90 9237 0.08% 91 10143 0.08% 92 10946 0.09% 93 12052 0.10% 94 13026 0.11% 95 13755 0.11% 96 14552 0.12% 97 14994 0.12% 98 15596 0.13% 99 15999 0.13% 100 17014 0.14% 101 18088 0.15% 102 19452 0.16% 103 20570 0.17% 104 21904 0.18% 105 22598 0.19% 106 23722 0.20% 107 23978 0.20% 108 24620 0.21% 109 25283 0.21% 110 26032 0.22% 111 26945 0.22% 112 28405 0.24% 113 29672 0.25% 114 31406 0.26% 115 32773 0.27% 116 32950 0.27% 117 33879 0.28% 118 34027 0.28% 119 34616 0.29% 120 35204 0.29% 121 36487 0.30% 122 37357 0.31% 123 38828 0.32% 124 40456 0.34% 125 41644 0.35% 126 43425 0.36% 127 44692 0.37% 128 44963 0.37% 129 45320 0.38% 130 46374 0.39% 131 46648 0.39% 132 48133 0.40% 133 50121 0.42% 134 52268 0.44% 135 53909 0.45% 136 56068 0.47% 137 58260 0.49% 138 60389 0.50% 139 63456 0.53% 140 66666 0.56% 141 69860 0.58% 142 74475 0.62% 143 82046 0.68% 144 91955 0.77% 145 105580 0.88% 146 125691 1.05% 147 163928 1.37% 148 236236 1.97% 149 450607 3.75% 150 2484363 20.70% 151 6358910 52.98% 12002607 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=93.89 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.0 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=40 fanout-score=55.28 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=12.4 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169826 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:31:21 Started mapping on | Feb 11 21:31:21 Finished on | Feb 11 21:32:25 Mapping speed, Million of reads per hour | 675.15 Number of input reads | 12002607 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11524391 Uniquely mapped reads % | 96.02% Average mapped length | 290.75 Number of splices: Total | 10332368 Number of splices: Annotated (sjdb) | 10153378 Number of splices: GT/AG | 10184123 Number of splices: GC/AG | 112555 Number of splices: AT/AC | 8938 Number of splices: Non-canonical | 26752 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206236 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 16610 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 282950 282950 282950 N_multimapping 206236 206236 206236 N_noFeature 298111 11374465 356917 N_ambiguous 136620 641 45027 UnstrandedReadsAssigned:11089660 PositiveStrandReadsAssigned:149285 NegativeStrandReadsAssigned:11122447 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169826-trimmed-pair1.fastq SRR7169826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,002,607 reads, 11,064,092 reads pseudoaligned [quant] estimated average fragment length: 213.732 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 982 rounds 52401 SRR7169826.ke.tsv 34699 SRR7169826.se.tsv 87100 total ==> SRR7169826.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.27 193 10.5205 Potri.005G024800.1.v4.1 1035 822.268 27 3.23126 Potri.004G059700.1.v4.1 961 748.274 5 0.657554 Potri.007G009000.2.v4.1 1416 1203.27 0 0 Potri.003G141000.2.v4.1 2943 2730.27 227.038 8.18303 Potri.016G087400.1.v4.1 270 91.2662 1016 1095.48 Potri.015G069301.1.v4.1 564 353.397 0 0 Potri.010G195200.1.v4.1 1773 1560.27 14 0.882979 Potri.012G127500.1.v4.1 977 764.268 1834 236.143 ==> SRR7169826.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1303 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169826 completed mapping pipeline successfully