Starting /dee2/code/volunteer_pipeline.sh SRR7169827 current disk space = 3052673875968 free memory = 1472778180 SRR7169827 SRAfilesize 4143a12b961c38d29552337651c32702 SRR7169827.sra SRR7169827.sra file validated SRR7169827 is paired end SRR7169827 is conventional basespace SRR7169827 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.06275 32.0 25.0 33.0 18.0 33.0 2 30.956 33.0 30.0 33.0 27.0 33.0 3 31.28675 33.0 31.0 33.0 29.0 33.0 4 31.62375 33.0 32.0 33.0 30.0 33.0 5 32.5075 33.0 33.0 33.0 32.0 34.0 6 36.77125 38.0 37.0 38.0 35.0 38.0 7 37.24825 38.0 38.0 38.0 36.0 38.0 8 37.52825 38.0 38.0 38.0 37.0 38.0 9 37.6315 38.0 38.0 38.0 38.0 38.0 10-14 37.56855 38.0 38.0 38.0 38.0 38.0 15-19 37.6029 38.0 38.0 38.0 38.0 38.0 20-24 37.5851 38.0 38.0 38.0 38.0 38.0 25-29 37.616499999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.63135 38.0 38.0 38.0 38.0 38.0 35-39 37.5569 38.0 38.0 38.0 38.0 38.0 40-44 37.544599999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.50015 38.0 38.0 38.0 37.6 38.0 50-54 37.36235 38.0 38.0 38.0 37.2 38.0 55-59 37.2097 38.0 38.0 38.0 36.6 38.0 60-64 37.112 38.0 38.0 38.0 36.2 38.0 65-69 37.25235 38.0 38.0 38.0 36.8 38.0 70-74 37.23465 38.0 38.0 38.0 36.8 38.0 75-79 37.12275 38.0 38.0 38.0 36.4 38.0 80-84 37.0857 38.0 38.0 38.0 36.2 38.0 85-89 37.0498 38.0 38.0 38.0 36.0 38.0 90-94 36.880700000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.9674 38.0 38.0 38.0 36.0 38.0 100-104 36.958200000000005 38.0 38.0 38.0 36.0 38.0 105-109 36.854 38.0 38.0 38.0 35.6 38.0 110-114 36.651700000000005 38.0 38.0 38.0 34.6 38.0 115-119 36.43130000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.39790000000001 38.0 38.0 38.0 34.2 38.0 125-129 36.2496 38.0 38.0 38.0 33.8 38.0 130-134 35.969 38.0 37.4 38.0 33.0 38.0 135-139 35.682449999999996 38.0 36.6 38.0 32.0 38.0 140-144 35.540350000000004 38.0 36.0 38.0 31.8 38.0 145-149 35.11874999999999 38.0 36.0 38.0 30.8 38.0 150-151 31.11675 36.5 30.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 2.0 18 4.0 19 6.0 20 2.0 21 2.0 22 1.0 23 4.0 24 7.0 25 9.0 26 8.0 27 15.0 28 12.0 29 17.0 30 30.0 31 34.0 32 68.0 33 75.0 34 130.0 35 209.0 36 575.0 37 2786.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 12.4 11.799999999999999 37.85 2 22.372372372372375 15.19019019019019 33.033033033033036 29.404404404404406 3 19.875 18.224999999999998 26.025 35.875 4 22.25 26.450000000000003 23.775 27.525 5 22.8 31.3 23.849999999999998 22.05 6 19.725 34.525 25.05 20.7 7 15.55 27.6 39.074999999999996 17.775 8 18.625 27.650000000000002 29.975 23.75 9 17.5 26.875 32.074999999999996 23.549999999999997 10-14 19.830000000000002 30.615 26.590000000000003 22.965 15-19 19.91 28.544999999999998 27.655 23.89 20-24 20.205000000000002 29.03 27.060000000000002 23.705000000000002 25-29 19.900000000000002 29.7 26.93 23.47 30-34 19.470000000000002 29.505 26.515 24.51 35-39 20.04 28.999999999999996 27.0 23.96 40-44 20.01 29.38 26.834999999999997 23.775 45-49 19.75 28.549999999999997 27.355 24.345 50-54 20.195 28.67 26.884999999999998 24.25 55-59 20.515 28.325 27.33 23.830000000000002 60-64 19.43 29.42 27.08 24.07 65-69 20.195 29.07 26.76 23.974999999999998 70-74 19.875 28.925 26.784999999999997 24.415 75-79 20.27 28.360000000000003 27.505000000000003 23.865 80-84 20.555 28.875 26.979999999999997 23.59 85-89 20.27 28.349999999999998 26.924999999999997 24.455 90-94 20.455000000000002 28.63 26.52 24.395 95-99 20.32 28.46 27.115000000000002 24.104999999999997 100-104 20.945 28.77 26.695 23.59 105-109 20.605 28.375 27.015 24.005000000000003 110-114 21.02735957585155 28.394938228379935 26.814385034762168 23.763317161006352 115-119 21.29 27.935 26.605 24.169999999999998 120-124 21.125 28.689999999999998 26.005 24.18 125-129 20.990000000000002 28.375 26.365 24.27 130-134 21.415 28.255000000000003 25.965 24.365000000000002 135-139 21.695 27.775 25.895000000000003 24.635 140-144 20.8 28.199999999999996 25.655 25.345000000000002 145-149 20.96 27.76 26.515 24.765 150-151 21.337500000000002 27.237499999999997 26.400000000000002 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 4.0 26 5.0 27 4.5 28 11.0 29 18.5 30 23.5 31 30.5 32 33.0 33 37.0 34 55.0 35 73.0 36 89.0 37 107.0 38 114.0 39 125.0 40 161.0 41 208.0 42 235.0 43 257.5 44 277.0 45 272.5 46 269.0 47 239.5 48 201.0 49 196.5 50 188.5 51 167.5 52 137.5 53 117.0 54 95.5 55 66.0 56 45.5 57 31.5 58 22.5 59 16.5 60 13.5 61 10.5 62 9.0 63 6.0 64 5.0 65 3.5 66 2.0 67 3.5 68 2.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.034999999999999996 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52165156092649 98.825 2 0.4028197381671702 0.8 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025176233635448138 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7125 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.2375 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.0374999999999996 0.0 0.0 0.0 0.0 98-99 2.4000000000000004 0.0 0.0 0.0 0.0 100-101 2.7625 0.0 0.0 0.0 0.0 102-103 3.2125 0.0 0.0 0.0 0.0 104-105 3.525 0.0 0.0 0.0 0.0 106-107 3.8375 0.0 0.0 0.0 0.0 108-109 4.237500000000001 0.0 0.0 0.0 0.0 110-111 4.7875 0.0 0.0 0.0 0.0 112-113 5.3125 0.0 0.0 0.0 0.0 114-115 5.875 0.0 0.0 0.0 0.0 116-117 6.525 0.0 0.0 0.0 0.0 118-119 7.2625 0.0 0.0 0.0 0.0 120-121 7.95 0.0 0.0 0.0 0.0 122-123 8.6625 0.0 0.0 0.0 0.0 124-125 9.212499999999999 0.0 0.0 0.0 0.0 126-127 10.075 0.0 0.0 0.0 0.0 128-129 10.875 0.0 0.0 0.0 0.0 130-131 11.825 0.0 0.0 0.0 0.0 132-133 12.3875 0.0 0.0 0.0 0.0 134-135 13.274999999999999 0.0 0.0 0.0 0.0 136-137 13.9625 0.0 0.0 0.0 0.0 138-139 14.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169827 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02975 33.0 33.0 34.0 32.0 34.0 2 33.136 34.0 33.0 34.0 33.0 34.0 3 33.09225 34.0 33.0 34.0 33.0 34.0 4 33.03825 34.0 33.0 34.0 33.0 34.0 5 33.06475 34.0 33.0 34.0 33.0 34.0 6 37.27625 38.0 38.0 38.0 37.0 38.0 7 37.24025 38.0 38.0 38.0 37.0 38.0 8 37.201 38.0 38.0 38.0 37.0 38.0 9 37.238 38.0 38.0 38.0 37.0 38.0 10-14 37.23909999999999 38.0 38.0 38.0 37.4 38.0 15-19 37.1426 38.0 38.0 38.0 37.0 38.0 20-24 37.196149999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.1291 38.0 38.0 38.0 37.0 38.0 30-34 36.96900000000001 38.0 38.0 38.0 36.4 38.0 35-39 37.0386 38.0 38.0 38.0 36.8 38.0 40-44 37.123749999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.03475 38.0 38.0 38.0 37.0 38.0 50-54 37.01325 38.0 38.0 38.0 37.0 38.0 55-59 36.7609 38.0 38.0 38.0 36.0 38.0 60-64 36.678799999999995 38.0 38.0 38.0 35.6 38.0 65-69 36.84805 38.0 38.0 38.0 36.2 38.0 70-74 36.91145 38.0 38.0 38.0 36.6 38.0 75-79 36.03830000000001 38.0 38.0 38.0 34.4 38.0 80-84 36.53060000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.5117 38.0 38.0 38.0 34.6 38.0 90-94 36.47515 38.0 38.0 38.0 34.8 38.0 95-99 36.521550000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.4049 38.0 38.0 38.0 35.0 38.0 105-109 34.986 38.0 37.0 38.0 27.4 38.0 110-114 34.522650000000006 38.0 37.4 38.0 26.4 38.0 115-119 33.783699999999996 38.0 36.8 38.0 16.2 38.0 120-124 33.961499999999994 38.0 36.8 38.0 21.4 38.0 125-129 34.330600000000004 38.0 36.2 38.0 23.8 38.0 130-134 34.8503 38.0 35.8 38.0 26.8 38.0 135-139 34.663 38.0 35.4 38.0 26.4 38.0 140-144 34.7085 38.0 35.8 38.0 28.2 38.0 145-149 33.445949999999996 38.0 33.8 38.0 21.4 38.0 150-151 30.231375 35.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 3.0 5 1.0 6 1.0 7 2.0 8 0.0 9 3.0 10 1.0 11 1.0 12 3.0 13 2.0 14 2.0 15 3.0 16 2.0 17 2.0 18 4.0 19 5.0 20 10.0 21 5.0 22 11.0 23 9.0 24 20.0 25 12.0 26 14.0 27 17.0 28 41.0 29 54.0 30 60.0 31 91.0 32 83.0 33 128.0 34 135.0 35 218.0 36 471.0 37 2569.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.25 20.474999999999998 15.6 26.674999999999997 2 26.594946209657245 26.169627220415308 29.44708531398549 17.788341255941955 3 21.21212121212121 27.42299023290759 29.952416729276234 21.41247182569497 4 25.04387064427175 34.018551015292054 21.283529706693407 19.654048633742793 5 24.53066332916145 35.91989987484355 22.453066332916144 17.09637046307885 6 21.25 36.6 23.625 18.525 7 21.025 21.375 37.75 19.85 8 21.825 25.174999999999997 26.8 26.200000000000003 9 22.5 25.3 29.2 23.0 10-14 24.279999999999998 29.095 25.415 21.21 15-19 24.16208104052026 27.773886943471737 26.993496748374184 21.070535267633815 20-24 23.810000000000002 28.365000000000002 26.76 21.065 25-29 23.9 27.944999999999997 27.310000000000002 20.845 30-34 23.796189809490475 28.086404320216012 27.2213610680534 20.896044802240112 35-39 23.845 27.865000000000002 27.284999999999997 21.005 40-44 24.305 27.88 27.13 20.685000000000002 45-49 23.75093773443361 28.177044261065266 27.68192048012003 20.390097524381094 50-54 24.174008810572687 27.588105726872246 27.397877452943533 20.840008009611534 55-59 24.691110999949977 27.472362563153418 27.36231304086839 20.47421339602821 60-64 24.433665049757465 27.499124868730306 27.56413462019303 20.5030754613192 65-69 24.709999999999997 27.625 27.375 20.29 70-74 24.19007560963397 27.34464974212608 27.464823994792447 21.0004506534475 75-79 23.92835272504593 27.265768524188612 27.827107572974075 20.978771177791387 80-84 23.92089941778759 28.066653282473396 27.760489861473598 20.251957438265407 85-89 25.095 27.794999999999998 27.224999999999998 19.885 90-94 24.457445744574457 27.39273927392739 27.627762776277624 20.522052205220522 95-99 24.592296148074038 27.348674337168582 27.888944472236116 20.17008504252126 100-104 24.746135761092493 27.907558401280575 27.31729278175179 20.029013055875144 105-109 24.948843871495804 28.09494577450379 26.97462656026192 19.981583793738487 110-114 24.961980177251036 27.872463160102782 26.839372804027477 20.326183858618702 115-119 25.324987963408763 27.48087519392286 27.063606697694325 20.130530144974053 120-124 25.409230119336783 27.436899355792587 26.882458548949202 20.271411975921428 125-129 25.511313622948272 28.02257546730182 26.79542277222596 19.670688137523946 130-134 26.22039753667451 27.582236018625146 26.786161317779 19.411205126921345 135-139 25.974999999999998 27.485 26.93 19.61 140-144 26.200000000000003 27.575 26.93 19.295 145-149 26.651332566628334 26.911345567278367 26.846342317115855 19.59097954897745 150-151 26.504964182480833 26.517531733065226 27.573205982154082 19.40429810229986 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 2.5 28 4.0 29 5.5 30 9.0 31 10.0 32 13.0 33 20.5 34 26.0 35 41.0 36 57.5 37 82.0 38 113.5 39 153.5 40 195.5 41 229.5 42 262.5 43 277.0 44 292.5 45 288.5 46 267.0 47 265.0 48 244.5 49 222.0 50 199.5 51 165.5 52 136.0 53 110.5 54 90.0 55 56.5 56 36.0 57 30.0 58 23.5 59 22.5 60 13.5 61 5.5 62 5.0 63 4.5 64 4.5 65 3.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.075 3 0.17500000000000002 4 0.27499999999999997 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.05 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.12 55-59 0.045 60-64 0.015 65-69 0.0 70-74 0.145 75-79 2.02 80-84 0.38 85-89 0.0 90-94 0.01 95-99 0.05 100-104 0.045 105-109 2.26 110-114 4.655 115-119 6.535 120-124 5.3100000000000005 125-129 3.435 130-134 0.135 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54716981132076 98.925 2 0.42767295597484273 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025157232704402514 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9750000000000001 0.0 0.0 0.0 0.0 90-91 1.1749999999999998 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.725 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.375 0.0 0.0 0.0 0.0 100-101 2.7125000000000004 0.0 0.0 0.0 0.0 102-103 3.1375 0.0 0.0 0.0 0.0 104-105 3.375 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.05 0.0 0.0 0.0 0.0 110-111 4.5875 0.0 0.0 0.0 0.0 112-113 5.1 0.0 0.0 0.0 0.0 114-115 5.6625 0.0 0.0 0.0 0.0 116-117 6.300000000000001 0.0 0.0 0.0 0.0 118-119 6.975 0.0 0.0 0.0 0.0 120-121 7.6375 0.0 0.0 0.0 0.0 122-123 8.3375 0.0 0.0 0.0 0.0 124-125 8.85 0.0 0.0 0.0 0.0 126-127 9.6875 0.0 0.0 0.0 0.0 128-129 10.5 0.0 0.0 0.0 0.0 130-131 11.337499999999999 0.0 0.0 0.0 0.0 132-133 11.899999999999999 0.0 0.0 0.0 0.0 134-135 12.774999999999999 0.0 0.0 0.0 0.0 136-137 13.4375 0.0 0.0 0.0 0.0 138-139 14.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573472 spots for SRR7169827.sra Written 573472 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra Read 573455 spots for SRR7169827.sra Written 573455 spots for SRR7169827.sra SRR ids: ['SRR7169827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mt8n2ze9 SRR7169827.sra spots: 11469117 blocks: [[1, 573455], [573456, 1146910], [1146911, 1720365], [1720366, 2293820], [2293821, 2867275], [2867276, 3440730], [3440731, 4014185], [4014186, 4587640], [4587641, 5161095], [5161096, 5734550], [5734551, 6308005], [6308006, 6881460], [6881461, 7454915], [7454916, 8028370], [8028371, 8601825], [8601826, 9175280], [9175281, 9748735], [9748736, 10322190], [10322191, 10895645], [10895646, 11469117]] SRR7169827 file size 3864807 SRR7169827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169827 SRR7169827_1.fastq SRR7169827_2.fastq Input file: SRR7169827_1.fastq Paired file: SRR7169827_2.fastq trimmed: SRR7169827-trimmed-pair1.fastq, SRR7169827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:30:08 2025 >> started Tue Feb 11 21:30:21 2025 >> done (13.213s) 11469117 read pairs processed; of these: 14171 ( 0.12%) short read pairs filtered out after trimming by size control 37291 ( 0.33%) empty read pairs filtered out after trimming by size control 11417655 (99.55%) read pairs available; of these: 5513363 (48.29%) trimmed read pairs available after processing 5904292 (51.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 6 0.00% 27 8 0.00% 28 8 0.00% 29 8 0.00% 30 5 0.00% 31 14 0.00% 32 14 0.00% 33 8 0.00% 34 10 0.00% 35 19 0.00% 36 23 0.00% 37 24 0.00% 38 22 0.00% 39 34 0.00% 40 24 0.00% 41 27 0.00% 42 37 0.00% 43 50 0.00% 44 61 0.00% 45 70 0.00% 46 81 0.00% 47 86 0.00% 48 68 0.00% 49 112 0.00% 50 136 0.00% 51 152 0.00% 52 187 0.00% 53 186 0.00% 54 191 0.00% 55 224 0.00% 56 229 0.00% 57 292 0.00% 58 296 0.00% 59 378 0.00% 60 407 0.00% 61 490 0.00% 62 578 0.01% 63 676 0.01% 64 754 0.01% 65 704 0.01% 66 889 0.01% 67 1021 0.01% 68 1106 0.01% 69 1360 0.01% 70 1474 0.01% 71 1763 0.02% 72 2013 0.02% 73 2386 0.02% 74 2488 0.02% 75 2950 0.03% 76 4080 0.04% 77 4199 0.04% 78 3811 0.03% 79 4123 0.04% 80 4604 0.04% 81 5363 0.05% 82 6020 0.05% 83 6872 0.06% 84 8162 0.07% 85 9353 0.08% 86 9811 0.09% 87 10514 0.09% 88 11146 0.10% 89 11796 0.10% 90 12852 0.11% 91 13392 0.12% 92 14382 0.13% 93 15785 0.14% 94 16932 0.15% 95 18365 0.16% 96 19157 0.17% 97 19983 0.18% 98 20531 0.18% 99 21070 0.18% 100 22390 0.20% 101 22841 0.20% 102 24241 0.21% 103 25773 0.23% 104 26901 0.24% 105 28566 0.25% 106 29587 0.26% 107 30301 0.27% 108 30971 0.27% 109 31576 0.28% 110 32514 0.28% 111 32975 0.29% 112 34143 0.30% 113 36317 0.32% 114 37098 0.32% 115 38713 0.34% 116 39790 0.35% 117 40574 0.36% 118 41134 0.36% 119 41502 0.36% 120 41368 0.36% 121 42497 0.37% 122 42946 0.38% 123 44689 0.39% 124 46319 0.41% 125 47195 0.41% 126 49367 0.43% 127 50757 0.44% 128 51358 0.45% 129 51866 0.45% 130 52238 0.46% 131 53040 0.46% 132 53306 0.47% 133 55038 0.48% 134 55821 0.49% 135 57263 0.50% 136 59742 0.52% 137 61033 0.53% 138 63398 0.56% 139 66022 0.58% 140 68119 0.60% 141 70658 0.62% 142 73922 0.65% 143 78310 0.69% 144 85770 0.75% 145 95637 0.84% 146 110700 0.97% 147 137960 1.21% 148 198411 1.74% 149 414535 3.63% 150 2189698 19.18% 151 5904292 51.71% 11417655 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=60.92 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.3 sequence=CATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=41 prefix-density=0.31 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=131.46 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169827 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:31:23 Started mapping on | Feb 11 21:31:23 Finished on | Feb 11 21:32:48 Mapping speed, Million of reads per hour | 483.57 Number of input reads | 11417655 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 10835146 Uniquely mapped reads % | 94.90% Average mapped length | 288.49 Number of splices: Total | 9199912 Number of splices: Annotated (sjdb) | 9037615 Number of splices: GT/AG | 9066915 Number of splices: GC/AG | 105070 Number of splices: AT/AC | 7470 Number of splices: Non-canonical | 20457 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201921 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 16339 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 391861 391861 391861 N_multimapping 201921 201921 201921 N_noFeature 226285 10690311 282990 N_ambiguous 132721 631 44161 UnstrandedReadsAssigned:10476140 PositiveStrandReadsAssigned:144204 NegativeStrandReadsAssigned:10507995 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169827-trimmed-pair1.fastq SRR7169827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,417,655 reads, 10,453,507 reads pseudoaligned [quant] estimated average fragment length: 204.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7169827.ke.tsv 34699 SRR7169827.se.tsv 87100 total ==> SRR7169827.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.42 190 9.60709 Potri.005G024800.1.v4.1 1035 831.422 40 4.41382 Potri.004G059700.1.v4.1 961 757.428 1 0.121126 Potri.007G009000.2.v4.1 1416 1212.42 0 0 Potri.003G141000.2.v4.1 2943 2739.42 170.035 5.6945 Potri.016G087400.1.v4.1 270 96.4906 1410 1340.64 Potri.015G069301.1.v4.1 564 361.806 0 0 Potri.010G195200.1.v4.1 1773 1569.42 14 0.818399 Potri.012G127500.1.v4.1 977 773.422 3142 372.706 ==> SRR7169827.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 897 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169827 completed mapping pipeline successfully