Starting /dee2/code/volunteer_pipeline.sh SRR7169828 current disk space = 3052939243520 free memory = 1408326388 SRR7169828 SRAfilesize 417361d1062f0f063fb90dd3f7a4c113 SRR7169828.sra SRR7169828.sra file validated SRR7169828 is paired end SRR7169828 is conventional basespace SRR7169828 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5635 30.0 18.0 33.0 18.0 33.0 2 30.58 31.0 29.0 33.0 27.0 34.0 3 30.59075 31.0 29.0 33.0 27.0 33.0 4 30.586 31.0 29.0 33.0 28.0 33.0 5 32.4045 33.0 33.0 33.0 32.0 33.0 6 36.67925 38.0 37.0 38.0 34.0 38.0 7 37.1935 38.0 38.0 38.0 36.0 38.0 8 37.4865 38.0 38.0 38.0 37.0 38.0 9 37.55025 38.0 38.0 38.0 38.0 38.0 10-14 37.526500000000006 38.0 38.0 38.0 37.4 38.0 15-19 37.5538 38.0 38.0 38.0 37.6 38.0 20-24 37.54345 38.0 38.0 38.0 38.0 38.0 25-29 37.5134 38.0 38.0 38.0 37.6 38.0 30-34 37.513400000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.44285 38.0 38.0 38.0 37.4 38.0 40-44 37.4504 38.0 38.0 38.0 37.4 38.0 45-49 37.43195 38.0 38.0 38.0 37.2 38.0 50-54 37.2935 38.0 38.0 38.0 37.0 38.0 55-59 37.2035 38.0 38.0 38.0 36.6 38.0 60-64 37.191500000000005 38.0 38.0 38.0 36.4 38.0 65-69 37.1545 38.0 38.0 38.0 36.0 38.0 70-74 36.9923 38.0 38.0 38.0 36.0 38.0 75-79 37.01145 38.0 38.0 38.0 36.0 38.0 80-84 36.8748 38.0 38.0 38.0 35.4 38.0 85-89 36.813250000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.74535 38.0 38.0 38.0 35.2 38.0 95-99 36.5724 38.0 38.0 38.0 34.2 38.0 100-104 36.2899 38.0 37.8 38.0 34.0 38.0 105-109 36.0609 38.0 37.0 38.0 33.2 38.0 110-114 35.95425 38.0 37.0 38.0 33.0 38.0 115-119 35.867900000000006 38.0 37.0 38.0 33.0 38.0 120-124 35.477250000000005 38.0 36.2 38.0 31.0 38.0 125-129 35.0618 38.0 36.0 38.0 28.4 38.0 130-134 34.94115000000001 38.0 36.0 38.0 27.8 38.0 135-139 34.77695 38.0 35.4 38.0 28.0 38.0 140-144 34.3154 38.0 35.0 38.0 26.0 38.0 145-149 33.7821 38.0 35.0 38.0 21.6 38.0 150-151 30.34125 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 4.0 17 3.0 18 5.0 19 2.0 20 5.0 21 8.0 22 7.0 23 3.0 24 8.0 25 12.0 26 21.0 27 19.0 28 23.0 29 25.0 30 39.0 31 52.0 32 74.0 33 106.0 34 126.0 35 276.0 36 811.0 37 2363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.342232392575646 12.636664124078312 11.11111111111111 37.90999237223494 2 21.875 15.85 31.825 30.45 3 19.825 19.375 26.025 34.775 4 23.1 26.6 22.75 27.55 5 23.400000000000002 31.025000000000002 23.275000000000002 22.3 6 20.225 33.375 25.85 20.549999999999997 7 16.425 26.1 39.300000000000004 18.175 8 18.3 26.650000000000002 30.349999999999998 24.7 9 18.125 24.275 32.475 25.124999999999996 10-14 19.97 29.665000000000003 26.979999999999997 23.385 15-19 19.615 29.225 27.485 23.674999999999997 20-24 20.025000000000002 28.48 27.255000000000003 24.240000000000002 25-29 20.19 29.17 27.189999999999998 23.45 30-34 19.68 28.315 28.175 23.830000000000002 35-39 20.26 28.875 26.97 23.895 40-44 20.115 28.26 27.465 24.16 45-49 20.599999999999998 28.33 27.265 23.805 50-54 20.36 28.79 27.38 23.47 55-59 20.185 28.810000000000002 27.215 23.79 60-64 20.75 28.325 27.250000000000004 23.674999999999997 65-69 19.97 28.705000000000002 27.229999999999997 24.095 70-74 20.235 28.08 27.689999999999998 23.995 75-79 20.29 28.389999999999997 27.310000000000002 24.01 80-84 20.560000000000002 28.52 26.575 24.345 85-89 20.4 28.065 27.279999999999998 24.255 90-94 20.794999999999998 28.26 27.485 23.46 95-99 21.095 27.57 27.655 23.68 100-104 20.805 28.715000000000003 26.790000000000003 23.69 105-109 20.815 27.750000000000004 27.500000000000004 23.935000000000002 110-114 20.76 28.365000000000002 27.025 23.849999999999998 115-119 20.669999999999998 27.925 27.315 24.09 120-124 20.765 28.494999999999997 26.625 24.115000000000002 125-129 20.895 27.985 27.134999999999998 23.985 130-134 20.755000000000003 27.884999999999998 27.05 24.310000000000002 135-139 20.794999999999998 28.115000000000002 27.07 24.02 140-144 20.985 27.985 26.855 24.175 145-149 20.919999999999998 27.265 27.005000000000003 24.81 150-151 21.0625 27.8875 27.2625 23.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 2.5 27 2.5 28 10.0 29 19.0 30 25.0 31 29.5 32 31.5 33 39.5 34 52.0 35 63.5 36 83.5 37 107.0 38 121.0 39 135.5 40 168.5 41 191.0 42 209.5 43 244.5 44 268.0 45 265.0 46 259.5 47 278.0 48 268.5 49 213.0 50 166.0 51 145.5 52 141.0 53 120.5 54 86.0 55 62.0 56 42.0 57 30.5 58 25.5 59 19.0 60 12.5 61 10.0 62 10.5 63 8.0 64 4.5 65 6.5 66 5.5 67 1.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.5374999999999996 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.825 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.7249999999999996 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAACA 10 0.006577216 146.82278 1 CTATCAT 10 0.006577216 146.82278 1 >>END_MODULE SRR7169828 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6915 33.0 33.0 34.0 32.0 34.0 2 32.7725 34.0 33.0 34.0 32.0 34.0 3 32.81 34.0 33.0 34.0 32.0 34.0 4 32.7165 34.0 33.0 34.0 32.0 34.0 5 32.66525 34.0 33.0 34.0 32.0 34.0 6 36.90575 38.0 38.0 38.0 37.0 38.0 7 36.93575 38.0 38.0 38.0 37.0 38.0 8 36.937 38.0 38.0 38.0 37.0 38.0 9 36.93225 38.0 38.0 38.0 37.0 38.0 10-14 36.92385 38.0 38.0 38.0 37.0 38.0 15-19 36.8803 38.0 38.0 38.0 37.0 38.0 20-24 36.84785 38.0 38.0 38.0 37.0 38.0 25-29 36.8182 38.0 38.0 38.0 36.8 38.0 30-34 36.805949999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.7365 38.0 38.0 38.0 36.0 38.0 40-44 36.7245 38.0 38.0 38.0 36.0 38.0 45-49 36.7579 38.0 38.0 38.0 36.0 38.0 50-54 36.74515 38.0 38.0 38.0 36.0 38.0 55-59 36.6738 38.0 38.0 38.0 36.0 38.0 60-64 36.5947 38.0 38.0 38.0 35.8 38.0 65-69 36.4565 38.0 38.0 38.0 35.2 38.0 70-74 36.38785 38.0 38.0 38.0 35.0 38.0 75-79 36.239549999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.26525 38.0 38.0 38.0 34.2 38.0 85-89 36.19565 38.0 38.0 38.0 34.0 38.0 90-94 36.108850000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.0429 38.0 38.0 38.0 34.0 38.0 100-104 35.92535 38.0 38.0 38.0 33.6 38.0 105-109 35.7683 38.0 37.8 38.0 32.8 38.0 110-114 35.6541 38.0 37.8 38.0 33.0 38.0 115-119 35.39965 38.0 37.2 38.0 31.4 38.0 120-124 35.12725 38.0 36.8 38.0 29.2 38.0 125-129 34.9733 38.0 36.2 38.0 28.6 38.0 130-134 34.7001 38.0 36.0 38.0 27.8 38.0 135-139 34.3122 38.0 35.4 38.0 25.2 38.0 140-144 33.9774 38.0 35.0 38.0 22.6 38.0 145-149 33.3644 38.0 34.8 38.0 18.0 38.0 150-151 29.147999999999996 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 8.0 4 3.0 5 2.0 6 1.0 7 0.0 8 3.0 9 2.0 10 1.0 11 3.0 12 3.0 13 4.0 14 3.0 15 2.0 16 5.0 17 6.0 18 4.0 19 6.0 20 6.0 21 8.0 22 14.0 23 10.0 24 18.0 25 15.0 26 21.0 27 17.0 28 27.0 29 36.0 30 47.0 31 47.0 32 54.0 33 97.0 34 143.0 35 225.0 36 493.0 37 2636.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.499374217772214 20.750938673341675 15.143929912390488 24.60575719649562 2 26.55111780959558 25.67194172318513 28.661140416980658 19.115800050238633 3 20.452261306532662 29.120603015075375 30.15075376884422 20.276381909547737 4 24.49698189134809 32.97283702213279 22.78672032193159 19.743460764587525 5 24.899396378269618 34.98490945674044 21.856136820925553 18.259557344064387 6 19.91961818638533 36.95051494599347 23.762873649836724 19.366993217784476 7 20.97462949007787 22.130118060788746 36.79979904546597 20.09545340366742 8 22.682743029389602 25.84777694046722 26.07385079125848 25.395629238884705 9 21.20070334086913 25.872896257221807 29.01281085154484 23.913589550364232 10-14 24.002813222144077 28.242740882146087 25.967045112026526 21.78740078368331 15-19 23.265511178095956 28.214016578749057 27.601105249937202 20.919366993217782 20-24 22.808339613162524 28.36473247927656 27.43029389600603 21.396634011554884 25-29 23.958804320522482 28.103491585028888 27.22431549861844 20.713388595830192 30-34 23.888470233609645 27.98291886460688 27.339864355689524 20.788746546093947 35-39 23.92866114041698 27.359959809093194 27.545842753077114 21.16553629741271 40-44 23.250439588043207 27.887465460939463 27.79703592062296 21.065059030394373 45-49 23.958804320522482 27.57598593318262 27.324792765636772 21.140416980658124 50-54 23.762873649836724 27.77694046721929 27.148957548354684 21.3112283345893 55-59 23.71765887967847 27.611152976639037 27.596081386586285 21.075106757096208 60-64 23.396131625219795 27.425270032655114 27.942727957799544 21.235870384325548 65-69 23.599457368235942 26.990905893583882 27.97568205798121 21.433954680198966 70-74 24.48251607717042 27.944131832797424 26.813705787781352 20.759646302250804 75-79 24.206189710610932 27.220659163987136 27.58239549839228 20.990755627009648 80-84 23.972465078886543 27.298763943322278 27.61029042307306 21.11848055471812 85-89 23.827948344304307 27.234812320988894 27.56645394703784 21.37078538766896 90-94 23.782724486206725 27.737299633184264 27.44585699211095 21.034118888498064 95-99 23.148055080912656 27.37461051361946 28.10835259825108 21.368981807216805 100-104 24.14087620578778 27.919011254019292 26.94935691318328 20.990755627009648 105-109 23.890647771244787 26.961153826825466 27.97125483692648 21.176943565003267 110-114 24.398089972354864 27.313395325458657 27.34355365669766 20.944961045488817 115-119 24.956010255894626 27.41943592579559 27.41440852646926 20.210145291840533 120-124 24.566081400613772 27.31297479498918 27.343160436685615 20.777783367711425 125-129 24.88806157870906 28.14811088192383 26.336972380137848 20.626855159229258 130-134 24.262855992754353 28.33350105665694 26.28559927543524 21.118043675153466 135-139 24.967293951896952 27.1913052229043 27.45295360772869 20.388447217470063 140-144 24.27536231884058 27.91364734299517 27.455716586151368 20.35527375201288 145-149 24.63760821421381 27.6323736661969 27.39077914233944 20.33923897724985 150-151 24.69182389937107 27.48427672955975 27.371069182389935 20.452830188679243 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 9.0 2 3.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 1.0 27 4.0 28 6.0 29 7.5 30 6.0 31 7.5 32 12.5 33 19.5 34 33.5 35 48.0 36 54.5 37 73.0 38 119.0 39 157.0 40 184.5 41 211.0 42 244.0 43 286.0 44 301.5 45 285.5 46 278.0 47 279.5 48 247.5 49 205.5 50 180.5 51 159.5 52 133.5 53 104.0 54 87.5 55 69.5 56 46.0 57 34.0 58 25.5 59 16.5 60 11.0 61 10.0 62 9.0 63 6.5 64 3.5 65 0.5 66 0.5 67 1.0 68 1.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.475 3 0.5 4 0.6 5 0.6 6 0.475 7 0.475 8 0.475 9 0.475 10-14 0.47000000000000003 15-19 0.475 20-24 0.475 25-29 0.475 30-34 0.475 35-39 0.475 40-44 0.475 45-49 0.475 50-54 0.475 55-59 0.475 60-64 0.475 65-69 0.485 70-74 0.48 75-79 0.48 80-84 0.49 85-89 0.49500000000000005 90-94 0.49500000000000005 95-99 0.51 100-104 0.48 105-109 0.505 110-114 0.525 115-119 0.545 120-124 0.615 125-129 0.615 130-134 0.63 135-139 0.63 140-144 0.64 145-149 0.66 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57189624779652 98.85000000000001 2 0.2770083102493075 0.5499999999999999 3 0.07554772097708386 0.22499999999999998 4 0.02518257365902795 0.1 5 0.02518257365902795 0.125 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.825 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra Read 668159 spots for SRR7169828.sra Written 668159 spots for SRR7169828.sra SRR ids: ['SRR7169828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yxwunm7l SRR7169828.sra spots: 13363180 blocks: [[1, 668159], [668160, 1336318], [1336319, 2004477], [2004478, 2672636], [2672637, 3340795], [3340796, 4008954], [4008955, 4677113], [4677114, 5345272], [5345273, 6013431], [6013432, 6681590], [6681591, 7349749], [7349750, 8017908], [8017909, 8686067], [8686068, 9354226], [9354227, 10022385], [10022386, 10690544], [10690545, 11358703], [11358704, 12026862], [12026863, 12695021], [12695022, 13363180]] SRR7169828 file size 4506642 SRR7169828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169828 SRR7169828_1.fastq SRR7169828_2.fastq Input file: SRR7169828_1.fastq Paired file: SRR7169828_2.fastq trimmed: SRR7169828-trimmed-pair1.fastq, SRR7169828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:15:52 2025 >> started Tue Feb 11 21:16:11 2025 >> done (19.247s) 13363180 read pairs processed; of these: 34883 ( 0.26%) short read pairs filtered out after trimming by size control 60870 ( 0.46%) empty read pairs filtered out after trimming by size control 13267427 (99.28%) read pairs available; of these: 5441189 (41.01%) trimmed read pairs available after processing 7826238 (58.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 7 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 4 0.00% 29 5 0.00% 30 8 0.00% 31 12 0.00% 32 11 0.00% 33 7 0.00% 34 8 0.00% 35 10 0.00% 36 5 0.00% 37 5 0.00% 38 9 0.00% 39 9 0.00% 40 15 0.00% 41 14 0.00% 42 26 0.00% 43 12 0.00% 44 14 0.00% 45 26 0.00% 46 33 0.00% 47 39 0.00% 48 38 0.00% 49 41 0.00% 50 56 0.00% 51 65 0.00% 52 65 0.00% 53 72 0.00% 54 71 0.00% 55 83 0.00% 56 122 0.00% 57 124 0.00% 58 135 0.00% 59 193 0.00% 60 212 0.00% 61 222 0.00% 62 240 0.00% 63 312 0.00% 64 303 0.00% 65 368 0.00% 66 418 0.00% 67 441 0.00% 68 487 0.00% 69 569 0.00% 70 689 0.01% 71 783 0.01% 72 907 0.01% 73 1002 0.01% 74 1187 0.01% 75 1272 0.01% 76 1459 0.01% 77 1566 0.01% 78 1751 0.01% 79 1742 0.01% 80 2012 0.02% 81 2366 0.02% 82 2672 0.02% 83 3074 0.02% 84 4223 0.03% 85 5179 0.04% 86 5365 0.04% 87 5499 0.04% 88 5943 0.04% 89 5902 0.04% 90 6229 0.05% 91 6441 0.05% 92 6989 0.05% 93 7361 0.06% 94 7732 0.06% 95 8114 0.06% 96 8552 0.06% 97 8733 0.07% 98 9062 0.07% 99 9183 0.07% 100 9572 0.07% 101 10058 0.08% 102 10443 0.08% 103 10947 0.08% 104 11731 0.09% 105 12086 0.09% 106 12656 0.10% 107 12976 0.10% 108 13136 0.10% 109 13423 0.10% 110 14080 0.11% 111 14182 0.11% 112 15050 0.11% 113 15729 0.12% 114 16384 0.12% 115 17128 0.13% 116 17837 0.13% 117 18115 0.14% 118 18871 0.14% 119 19050 0.14% 120 19498 0.15% 121 20022 0.15% 122 20882 0.16% 123 21826 0.16% 124 22961 0.17% 125 24134 0.18% 126 24896 0.19% 127 25843 0.19% 128 26674 0.20% 129 27591 0.21% 130 28379 0.21% 131 29897 0.23% 132 31022 0.23% 133 32957 0.25% 134 34732 0.26% 135 37130 0.28% 136 39333 0.30% 137 41452 0.31% 138 45174 0.34% 139 48775 0.37% 140 52448 0.40% 141 57516 0.43% 142 63796 0.48% 143 71657 0.54% 144 83718 0.63% 145 99309 0.75% 146 126173 0.95% 147 170354 1.28% 148 261123 1.97% 149 564980 4.26% 150 2865554 21.60% 151 7826238 58.99% 13267427 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=34 prefix-density=0.26 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=231.06 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=6.61 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=4.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=57.61 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=14.0 sequence=TGTTGGTGGTGGTACTGGA SRR7169828 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:17:36 Started mapping on | Feb 11 21:17:36 Finished on | Feb 11 21:18:54 Mapping speed, Million of reads per hour | 612.34 Number of input reads | 13267427 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 11756273 Uniquely mapped reads % | 88.61% Average mapped length | 287.84 Number of splices: Total | 11222045 Number of splices: Annotated (sjdb) | 11051303 Number of splices: GT/AG | 11060622 Number of splices: GC/AG | 132172 Number of splices: AT/AC | 8158 Number of splices: Non-canonical | 21093 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216001 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 57073 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.27% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1310479 1310479 1310479 N_multimapping 216001 216001 216001 N_noFeature 192385 11639009 232819 N_ambiguous 141260 1011 63694 UnstrandedReadsAssigned:11422628 PositiveStrandReadsAssigned:116253 NegativeStrandReadsAssigned:11459760 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=142 echo kmer=137 SRR7169828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169828-trimmed-pair1.fastq SRR7169828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,267,427 reads, 11,968,536 reads pseudoaligned [quant] estimated average fragment length: 269.497 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds 52401 SRR7169828.ke.tsv 34699 SRR7169828.se.tsv 87100 total ==> SRR7169828.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.5 226 10.096 Potri.005G024800.1.v4.1 1035 766.503 32 3.26279 Potri.004G059700.1.v4.1 961 692.522 1 0.112855 Potri.007G009000.2.v4.1 1416 1147.5 0 0 Potri.003G141000.2.v4.1 2943 2674.5 204 5.9613 Potri.016G087400.1.v4.1 270 78.4368 1548 1542.43 Potri.015G069301.1.v4.1 564 301.45 0 0 Potri.010G195200.1.v4.1 1773 1504.5 26 1.35062 Potri.012G127500.1.v4.1 977 708.509 8669 956.262 ==> SRR7169828.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 871 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169828 completed mapping pipeline successfully