Starting /dee2/code/volunteer_pipeline.sh SRR7169829 current disk space = 3052637605888 free memory = 1574821232 SRR7169829 SRAfilesize 347f88623344d3bc13c8a931f4d3f694 SRR7169829.sra SRR7169829.sra file validated SRR7169829 is paired end SRR7169829 is conventional basespace SRR7169829 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.055 28.0 18.0 33.0 18.0 33.0 2 29.27775 31.0 27.0 33.0 25.0 33.0 3 31.29525 33.0 31.0 33.0 29.0 33.0 4 31.51425 33.0 31.0 33.0 29.0 33.0 5 32.4505 33.0 33.0 33.0 32.0 33.0 6 36.682 38.0 37.0 38.0 34.0 38.0 7 36.27525 38.0 37.0 38.0 33.0 38.0 8 37.328 38.0 38.0 38.0 37.0 38.0 9 37.5705 38.0 38.0 38.0 37.0 38.0 10-14 37.6361 38.0 38.0 38.0 38.0 38.0 15-19 37.63645 38.0 38.0 38.0 38.0 38.0 20-24 37.5591 38.0 38.0 38.0 37.8 38.0 25-29 37.640750000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5724 38.0 38.0 38.0 38.0 38.0 35-39 37.57320000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.449600000000004 38.0 38.0 38.0 37.4 38.0 45-49 37.552350000000004 38.0 38.0 38.0 37.8 38.0 50-54 37.451299999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.366949999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.30714999999999 38.0 38.0 38.0 36.8 38.0 65-69 37.20485000000001 38.0 38.0 38.0 36.2 38.0 70-74 37.14895 38.0 38.0 38.0 36.0 38.0 75-79 37.04809999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.0274 38.0 38.0 38.0 36.0 38.0 85-89 36.83625 38.0 38.0 38.0 35.4 38.0 90-94 36.42475 38.0 37.6 38.0 33.6 38.0 95-99 36.4748 38.0 37.8 38.0 34.0 38.0 100-104 35.36725 38.0 36.2 38.0 28.8 38.0 105-109 36.06179999999999 38.0 36.8 38.0 32.8 38.0 110-114 36.080650000000006 38.0 37.0 38.0 32.8 38.0 115-119 35.77205 38.0 36.4 38.0 31.4 38.0 120-124 34.859449999999995 38.0 35.0 38.0 26.6 38.0 125-129 35.16775 38.0 35.6 38.0 29.0 38.0 130-134 33.945750000000004 37.6 33.8 38.0 23.6 38.0 135-139 34.5481 38.0 35.0 38.0 27.0 38.0 140-144 33.73685 38.0 34.2 38.0 21.4 38.0 145-149 31.890799999999995 36.6 31.0 38.0 14.0 38.0 150-151 28.6845 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 0.0 19 3.0 20 7.0 21 1.0 22 3.0 23 6.0 24 7.0 25 12.0 26 10.0 27 11.0 28 14.0 29 41.0 30 40.0 31 63.0 32 79.0 33 95.0 34 204.0 35 459.0 36 1223.0 37 1715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 10.174999999999999 9.175 41.65 2 21.349999999999998 13.55 34.525 30.575000000000003 3 19.900000000000002 17.175 25.324999999999996 37.6 4 24.05 26.625 22.625 26.700000000000003 5 23.175 31.525 24.099999999999998 21.2 6 19.0 35.625 24.275 21.099999999999998 7 13.950000000000001 27.500000000000004 40.550000000000004 18.0 8 17.150000000000002 26.875 32.675 23.3 9 17.974999999999998 24.6 33.875 23.549999999999997 10-14 19.78 29.909999999999997 27.884999999999998 22.425 15-19 19.75 28.17 27.855 24.224999999999998 20-24 19.99 28.83 27.105 24.075 25-29 20.085 29.18 27.33 23.405 30-34 19.665 28.449999999999996 27.389999999999997 24.495 35-39 19.78 28.660000000000004 27.93 23.630000000000003 40-44 20.294999999999998 29.18 27.155 23.369999999999997 45-49 20.23 29.53 27.04 23.200000000000003 50-54 20.4 29.165000000000003 27.26 23.175 55-59 20.14 28.494999999999997 27.255000000000003 24.11 60-64 20.015 28.83 27.800000000000004 23.355 65-69 20.355 28.625 27.665 23.355 70-74 20.29 29.005 26.865 23.84 75-79 19.814999999999998 29.21 26.915 24.060000000000002 80-84 19.855 28.825 27.465 23.855 85-89 20.205000000000002 28.625 27.095000000000002 24.075 90-94 20.025000000000002 28.535 27.51 23.93 95-99 20.244999999999997 28.38 27.605 23.77 100-104 20.495 28.825 27.389999999999997 23.29 105-109 20.150000000000002 28.405 27.589999999999996 23.855 110-114 20.724999999999998 28.465 27.084999999999997 23.724999999999998 115-119 20.015 29.14 27.72 23.125 120-124 20.015 28.725 27.305 23.955000000000002 125-129 20.59 27.915 27.63 23.865 130-134 20.355 28.715000000000003 27.325 23.605 135-139 20.395 27.825 27.935 23.845 140-144 20.815 27.79 27.68 23.715 145-149 20.905 28.345 27.6 23.150000000000002 150-151 21.1875 27.437499999999996 27.737499999999997 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.0 24 1.5 25 2.5 26 2.0 27 6.0 28 11.0 29 12.5 30 15.5 31 22.5 32 31.5 33 45.0 34 56.0 35 68.0 36 92.0 37 113.5 38 117.0 39 137.0 40 183.0 41 213.5 42 244.0 43 259.0 44 263.5 45 276.0 46 276.5 47 284.5 48 258.5 49 211.5 50 170.5 51 131.0 52 112.0 53 93.0 54 74.5 55 57.0 56 38.0 57 25.0 58 21.0 59 17.5 60 12.0 61 10.5 62 8.0 63 3.5 64 3.5 65 4.0 66 2.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.6 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAATA 10 0.006830828 145.0 2 TGCTGCC 10 0.006830828 145.0 1 >>END_MODULE SRR7169829 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169829_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.244 34.0 33.0 34.0 33.0 34.0 2 33.305 34.0 33.0 34.0 33.0 34.0 3 33.369 34.0 33.0 34.0 33.0 34.0 4 33.351 34.0 33.0 34.0 33.0 34.0 5 33.3425 34.0 33.0 34.0 33.0 34.0 6 37.391 38.0 38.0 38.0 38.0 38.0 7 37.43675 38.0 38.0 38.0 38.0 38.0 8 37.458 38.0 38.0 38.0 38.0 38.0 9 37.4525 38.0 38.0 38.0 38.0 38.0 10-14 37.46365 38.0 38.0 38.0 38.0 38.0 15-19 37.439600000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.228899999999996 38.0 38.0 38.0 37.2 38.0 25-29 36.852 38.0 37.8 38.0 35.0 38.0 30-34 36.47605 38.0 37.8 38.0 33.8 38.0 35-39 37.1573 38.0 38.0 38.0 36.6 38.0 40-44 37.03555 38.0 38.0 38.0 36.4 38.0 45-49 36.966750000000005 38.0 38.0 38.0 36.0 38.0 50-54 37.22025 38.0 38.0 38.0 36.8 38.0 55-59 37.2635 38.0 38.0 38.0 37.0 38.0 60-64 37.14235 38.0 38.0 38.0 37.0 38.0 65-69 37.1806 38.0 38.0 38.0 37.0 38.0 70-74 37.14319999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.1135 38.0 38.0 38.0 37.0 38.0 80-84 36.92635 38.0 38.0 38.0 36.0 38.0 85-89 36.84765 38.0 38.0 38.0 36.0 38.0 90-94 36.886399999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.742850000000004 38.0 38.0 38.0 35.6 38.0 100-104 36.58655 38.0 38.0 38.0 35.0 38.0 105-109 36.589749999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.498349999999995 38.0 38.0 38.0 34.4 38.0 115-119 36.25165 38.0 38.0 38.0 34.0 38.0 120-124 36.0378 38.0 38.0 38.0 33.4 38.0 125-129 35.954699999999995 38.0 37.6 38.0 33.0 38.0 130-134 35.674549999999996 38.0 37.0 38.0 32.0 38.0 135-139 35.376450000000006 38.0 36.0 38.0 31.4 38.0 140-144 35.1632 38.0 36.0 38.0 30.2 38.0 145-149 34.61585 38.0 35.4 38.0 28.0 38.0 150-151 30.724249999999998 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 4.0 11 0.0 12 1.0 13 0.0 14 0.0 15 4.0 16 5.0 17 4.0 18 3.0 19 8.0 20 3.0 21 3.0 22 5.0 23 9.0 24 10.0 25 8.0 26 12.0 27 16.0 28 27.0 29 29.0 30 32.0 31 32.0 32 53.0 33 67.0 34 129.0 35 230.0 36 528.0 37 2773.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 20.150000000000002 14.524999999999999 26.5 2 26.625 26.200000000000003 29.599999999999998 17.575 3 21.2 27.650000000000002 30.575000000000003 20.575 4 23.925 33.7 23.0 19.375 5 23.95 36.675000000000004 21.475 17.9 6 20.674999999999997 37.675 22.75 18.9 7 19.7 22.1 38.6 19.6 8 21.5 24.875 28.325 25.3 9 21.725 24.474999999999998 30.275000000000002 23.525 10-14 22.994999999999997 28.999999999999996 26.674999999999997 21.33 15-19 22.675 28.26 28.075 20.990000000000002 20-24 22.685 27.85 28.139999999999997 21.325 25-29 22.955000000000002 27.865000000000002 27.900000000000002 21.279999999999998 30-34 22.869999999999997 28.08 27.875 21.175 35-39 22.37 28.215 27.915 21.5 40-44 23.575 28.139999999999997 27.725 20.560000000000002 45-49 23.64 27.705000000000002 28.13 20.525 50-54 22.71 28.315 28.02 20.955 55-59 23.14 27.794999999999998 28.265 20.8 60-64 22.75 27.785 28.28 21.185000000000002 65-69 23.505000000000003 28.044999999999998 27.860000000000003 20.59 70-74 23.125 27.750000000000004 28.525 20.599999999999998 75-79 23.26 27.939999999999998 27.810000000000002 20.990000000000002 80-84 23.215 27.61 28.375 20.8 85-89 23.44 27.775 27.865000000000002 20.919999999999998 90-94 23.49 27.21 28.405 20.895 95-99 23.630000000000003 27.634999999999998 28.299999999999997 20.435 100-104 23.494999999999997 28.384999999999998 27.325 20.794999999999998 105-109 23.9 27.485 28.485 20.13 110-114 23.935000000000002 27.939999999999998 27.694999999999997 20.43 115-119 23.830000000000002 28.03 27.92 20.22 120-124 23.49 27.750000000000004 28.425 20.335 125-129 23.93 28.599999999999998 27.465 20.005 130-134 23.76 27.935 27.35 20.955 135-139 23.96 28.084999999999997 27.779999999999998 20.175 140-144 24.38 27.875 27.265 20.48 145-149 23.72 27.689999999999998 27.565 21.025 150-151 23.7375 27.975 27.450000000000003 20.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 5.0 29 11.5 30 18.5 31 21.0 32 24.0 33 36.5 34 50.0 35 60.0 36 77.5 37 101.5 38 130.0 39 156.5 40 171.5 41 221.5 42 289.0 43 301.5 44 290.5 45 288.5 46 274.5 47 252.5 48 235.5 49 219.5 50 178.0 51 137.0 52 111.0 53 79.5 54 63.5 55 52.5 56 33.5 57 23.5 58 22.5 59 18.0 60 10.5 61 5.5 62 5.5 63 5.5 64 4.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.6749999999999998 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra Read 661872 spots for SRR7169829.sra Written 661872 spots for SRR7169829.sra Read 661855 spots for SRR7169829.sra Written 661855 spots for SRR7169829.sra SRR ids: ['SRR7169829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwvuuld7 SRR7169829.sra spots: 13237117 blocks: [[1, 661855], [661856, 1323710], [1323711, 1985565], [1985566, 2647420], [2647421, 3309275], [3309276, 3971130], [3971131, 4632985], [4632986, 5294840], [5294841, 5956695], [5956696, 6618550], [6618551, 7280405], [7280406, 7942260], [7942261, 8604115], [8604116, 9265970], [9265971, 9927825], [9927826, 10589680], [10589681, 11251535], [11251536, 11913390], [11913391, 12575245], [12575246, 13237117]] SRR7169829 file size 4463924 SRR7169829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169829 SRR7169829_1.fastq SRR7169829_2.fastq Input file: SRR7169829_1.fastq Paired file: SRR7169829_2.fastq trimmed: SRR7169829-trimmed-pair1.fastq, SRR7169829-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:00:44 2025 >> started Tue Feb 11 22:00:58 2025 >> done (14.411s) 13237117 read pairs processed; of these: 8384 ( 0.06%) short read pairs filtered out after trimming by size control 6323 ( 0.05%) empty read pairs filtered out after trimming by size control 13222410 (99.89%) read pairs available; of these: 5837113 (44.15%) trimmed read pairs available after processing 7385297 (55.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 1 0.00% 31 1 0.00% 32 6 0.00% 33 6 0.00% 34 2 0.00% 35 5 0.00% 36 3 0.00% 37 5 0.00% 38 9 0.00% 39 10 0.00% 40 10 0.00% 41 7 0.00% 42 9 0.00% 43 8 0.00% 44 9 0.00% 45 12 0.00% 46 14 0.00% 47 14 0.00% 48 18 0.00% 49 20 0.00% 50 31 0.00% 51 32 0.00% 52 36 0.00% 53 37 0.00% 54 58 0.00% 55 46 0.00% 56 47 0.00% 57 62 0.00% 58 62 0.00% 59 100 0.00% 60 93 0.00% 61 132 0.00% 62 126 0.00% 63 140 0.00% 64 156 0.00% 65 152 0.00% 66 197 0.00% 67 204 0.00% 68 249 0.00% 69 275 0.00% 70 331 0.00% 71 377 0.00% 72 392 0.00% 73 459 0.00% 74 498 0.00% 75 618 0.00% 76 687 0.01% 77 752 0.01% 78 844 0.01% 79 938 0.01% 80 975 0.01% 81 1043 0.01% 82 1326 0.01% 83 1479 0.01% 84 1847 0.01% 85 2258 0.02% 86 2384 0.02% 87 2657 0.02% 88 2896 0.02% 89 3024 0.02% 90 3156 0.02% 91 3344 0.03% 92 3609 0.03% 93 3733 0.03% 94 3879 0.03% 95 4304 0.03% 96 4506 0.03% 97 4697 0.04% 98 4729 0.04% 99 5038 0.04% 100 5449 0.04% 101 5804 0.04% 102 6105 0.05% 103 6391 0.05% 104 6552 0.05% 105 7037 0.05% 106 7331 0.06% 107 7624 0.06% 108 7909 0.06% 109 8269 0.06% 110 8625 0.07% 111 8985 0.07% 112 9429 0.07% 113 10101 0.08% 114 10684 0.08% 115 11044 0.08% 116 11503 0.09% 117 12140 0.09% 118 12521 0.09% 119 12797 0.10% 120 13071 0.10% 121 13424 0.10% 122 14101 0.11% 123 15163 0.11% 124 16023 0.12% 125 16699 0.13% 126 17601 0.13% 127 18572 0.14% 128 19444 0.15% 129 20399 0.15% 130 21826 0.17% 131 22963 0.17% 132 24350 0.18% 133 26124 0.20% 134 27388 0.21% 135 29860 0.23% 136 32268 0.24% 137 35079 0.27% 138 39176 0.30% 139 42652 0.32% 140 47500 0.36% 141 53529 0.40% 142 61422 0.46% 143 71188 0.54% 144 86499 0.65% 145 110135 0.83% 146 144881 1.10% 147 206123 1.56% 148 333524 2.52% 149 697920 5.28% 150 3312690 25.05% 151 7385297 55.85% 13222410 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=296.36 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.42 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=275.49 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.9 sequence=AAGAAGAAGAAA SRR7169829 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:01:56 Started mapping on | Feb 11 22:01:56 Finished on | Feb 11 22:03:07 Mapping speed, Million of reads per hour | 670.43 Number of input reads | 13222410 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12627160 Uniquely mapped reads % | 95.50% Average mapped length | 296.72 Number of splices: Total | 12228213 Number of splices: Annotated (sjdb) | 12036363 Number of splices: GT/AG | 12049066 Number of splices: GC/AG | 143598 Number of splices: AT/AC | 9473 Number of splices: Non-canonical | 26076 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222970 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 12393 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 380268 380268 380268 N_multimapping 222970 222970 222970 N_noFeature 298342 12516242 346471 N_ambiguous 117146 496 54111 UnstrandedReadsAssigned:12211672 PositiveStrandReadsAssigned:110422 NegativeStrandReadsAssigned:12226578 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169829 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169829-trimmed-pair1.fastq SRR7169829-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,222,410 reads, 12,124,095 reads pseudoaligned [quant] estimated average fragment length: 281.654 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7169829.ke.tsv 34699 SRR7169829.se.tsv 87100 total ==> SRR7169829.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.35 199 9.69549 Potri.005G024800.1.v4.1 1035 754.346 35 3.92736 Potri.004G059700.1.v4.1 961 680.38 0 0 Potri.007G009000.2.v4.1 1416 1135.35 0 0 Potri.003G141000.2.v4.1 2943 2662.35 253 8.04376 Potri.016G087400.1.v4.1 270 67.5431 856 1072.74 Potri.015G069301.1.v4.1 564 290.039 0 0 Potri.010G195200.1.v4.1 1773 1492.35 11 0.623916 Potri.012G127500.1.v4.1 977 696.364 4725 574.34 ==> SRR7169829.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 595 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169829 completed mapping pipeline successfully