Starting /dee2/code/volunteer_pipeline.sh SRR7169830 current disk space = 2810367041536 free memory = 1581365584 SRR7169830 SRAfilesize bd542c92fdcd780580d4707e5e077624 SRR7169830.sra SRR7169830.sra file validated SRR7169830 is paired end SRR7169830 is conventional basespace SRR7169830 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169830_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.327 30.0 18.0 33.0 18.0 34.0 2 31.016 33.0 29.0 33.0 27.0 34.0 3 30.9 31.0 31.0 33.0 27.0 33.0 4 30.84875 33.0 31.0 33.0 28.0 33.0 5 32.507 33.0 33.0 33.0 32.0 34.0 6 36.8225 38.0 37.0 38.0 35.0 38.0 7 37.31525 38.0 38.0 38.0 36.0 38.0 8 37.60525 38.0 38.0 38.0 37.0 38.0 9 37.57825 38.0 38.0 38.0 38.0 38.0 10-14 37.60205 38.0 38.0 38.0 38.0 38.0 15-19 37.57035 38.0 38.0 38.0 38.0 38.0 20-24 37.59095 38.0 38.0 38.0 38.0 38.0 25-29 37.60915 38.0 38.0 38.0 38.0 38.0 30-34 37.591449999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.52735 38.0 38.0 38.0 38.0 38.0 40-44 37.5259 38.0 38.0 38.0 38.0 38.0 45-49 37.523 38.0 38.0 38.0 38.0 38.0 50-54 37.42715 38.0 38.0 38.0 37.0 38.0 55-59 37.3615 38.0 38.0 38.0 37.0 38.0 60-64 37.3421 38.0 38.0 38.0 37.0 38.0 65-69 37.28775 38.0 38.0 38.0 37.0 38.0 70-74 37.18095 38.0 38.0 38.0 36.4 38.0 75-79 37.14489999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.01335 38.0 38.0 38.0 36.0 38.0 85-89 36.9673 38.0 38.0 38.0 36.0 38.0 90-94 36.91105 38.0 38.0 38.0 35.4 38.0 95-99 36.771550000000005 38.0 38.0 38.0 35.2 38.0 100-104 36.542 38.0 38.0 38.0 34.0 38.0 105-109 36.3854 38.0 38.0 38.0 34.0 38.0 110-114 36.25305 38.0 38.0 38.0 34.0 38.0 115-119 36.12435000000001 38.0 37.6 38.0 33.6 38.0 120-124 35.850350000000006 38.0 37.0 38.0 32.6 38.0 125-129 35.5491 38.0 36.4 38.0 31.0 38.0 130-134 35.355599999999995 38.0 36.0 38.0 30.2 38.0 135-139 35.195299999999996 38.0 36.0 38.0 29.2 38.0 140-144 34.708800000000004 38.0 35.0 38.0 27.8 38.0 145-149 34.2956 38.0 35.0 38.0 26.6 38.0 150-151 31.132875 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 8.0 20 5.0 21 3.0 22 5.0 23 5.0 24 11.0 25 9.0 26 8.0 27 12.0 28 17.0 29 37.0 30 41.0 31 46.0 32 68.0 33 91.0 34 138.0 35 258.0 36 652.0 37 2581.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.700715015321755 11.695607763023494 8.55464759959142 38.04902962206333 2 22.6 14.85 32.525 30.025000000000002 3 19.650000000000002 19.725 27.075 33.550000000000004 4 22.725 27.450000000000003 23.425 26.400000000000002 5 22.15 31.85 23.65 22.35 6 20.45 35.125 24.675 19.75 7 13.4 27.825 42.275 16.5 8 17.275 26.375 31.45 24.9 9 17.2 24.474999999999998 34.425 23.9 10-14 19.525000000000002 29.78 27.229999999999997 23.465 15-19 19.24 29.035 27.855 23.87 20-24 19.34 29.5 27.515 23.645 25-29 19.34 29.654999999999998 27.82 23.185 30-34 19.535 29.645 27.384999999999998 23.435 35-39 19.71 28.999999999999996 27.305 23.985 40-44 19.185 29.675 27.750000000000004 23.39 45-49 20.015 28.975 26.8 24.21 50-54 19.81 28.865000000000002 27.834999999999997 23.49 55-59 20.105 29.165000000000003 27.060000000000002 23.669999999999998 60-64 19.97 29.134999999999998 26.8 24.095 65-69 20.22 29.01 27.22 23.549999999999997 70-74 20.169999999999998 28.499999999999996 27.095000000000002 24.235 75-79 20.335 28.93 26.93 23.805 80-84 19.759999999999998 28.849999999999998 27.084999999999997 24.305 85-89 20.13 28.794999999999998 27.26 23.815 90-94 20.555 28.49 27.785 23.169999999999998 95-99 20.485 28.485 27.205000000000002 23.825 100-104 19.99 28.77 26.855 24.385 105-109 20.150000000000002 29.005 27.18 23.665 110-114 19.905 29.32 26.905 23.87 115-119 20.31 28.37 27.310000000000002 24.01 120-124 20.29 28.525 26.924999999999997 24.26 125-129 20.150000000000002 28.610000000000003 27.139999999999997 24.099999999999998 130-134 20.630000000000003 27.834999999999997 27.644999999999996 23.89 135-139 20.97 27.61 27.345000000000002 24.075 140-144 20.71 28.48 26.939999999999998 23.87 145-149 20.794999999999998 28.345 26.985 23.875 150-151 21.337500000000002 28.675 26.05 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 3.0 25 3.0 26 4.0 27 10.0 28 10.5 29 12.0 30 21.0 31 29.0 32 38.5 33 47.5 34 62.0 35 77.0 36 98.5 37 108.5 38 117.0 39 157.5 40 189.5 41 217.5 42 244.0 43 258.0 44 272.0 45 272.0 46 260.5 47 236.0 48 218.5 49 207.5 50 180.5 51 150.0 52 116.0 53 80.0 54 69.5 55 57.5 56 36.5 57 36.0 58 31.5 59 20.5 60 10.5 61 5.0 62 6.5 63 7.5 64 4.0 65 1.5 66 1.0 67 1.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.7999999999999998 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.225 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.8499999999999996 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTAT 10 0.006830828 145.0 9 CCCACAA 10 0.006830828 145.0 1 >>END_MODULE SRR7169830 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169830_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6775 33.0 33.0 34.0 32.0 34.0 2 32.7405 33.0 33.0 34.0 32.0 34.0 3 32.75675 34.0 33.0 34.0 32.0 34.0 4 32.68375 34.0 33.0 34.0 32.0 34.0 5 32.66175 34.0 33.0 34.0 32.0 34.0 6 36.902 38.0 38.0 38.0 36.0 38.0 7 36.8895 38.0 38.0 38.0 37.0 38.0 8 36.94525 38.0 38.0 38.0 36.0 38.0 9 36.82675 38.0 38.0 38.0 36.0 38.0 10-14 36.867 38.0 38.0 38.0 36.6 38.0 15-19 36.820550000000004 38.0 38.0 38.0 36.4 38.0 20-24 36.8258 38.0 38.0 38.0 36.2 38.0 25-29 36.80605 38.0 38.0 38.0 36.2 38.0 30-34 36.792500000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.7393 38.0 38.0 38.0 36.0 38.0 40-44 36.78189999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.75965 38.0 38.0 38.0 36.0 38.0 50-54 36.72295 38.0 38.0 38.0 36.0 38.0 55-59 36.638149999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.60725 38.0 38.0 38.0 35.6 38.0 65-69 36.44735 38.0 38.0 38.0 34.6 38.0 70-74 36.33055 38.0 38.0 38.0 34.4 38.0 75-79 36.22015 38.0 38.0 38.0 34.0 38.0 80-84 36.228100000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.16415 38.0 38.0 38.0 34.0 38.0 90-94 36.041700000000006 38.0 38.0 38.0 33.4 38.0 95-99 36.065200000000004 38.0 38.0 38.0 33.8 38.0 100-104 35.9544 38.0 38.0 38.0 33.8 38.0 105-109 35.7237 38.0 37.6 38.0 31.8 38.0 110-114 35.599900000000005 38.0 37.4 38.0 31.0 38.0 115-119 35.46015 38.0 37.0 38.0 31.0 38.0 120-124 35.14115 38.0 37.0 38.0 28.8 38.0 125-129 34.92379999999999 38.0 36.2 38.0 28.0 38.0 130-134 34.66139999999999 38.0 36.0 38.0 27.2 38.0 135-139 34.29455 38.0 35.4 38.0 24.8 38.0 140-144 33.970150000000004 38.0 35.0 38.0 22.6 38.0 145-149 33.21315 38.0 34.8 38.0 18.0 38.0 150-151 28.9645 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 4.0 4 2.0 5 0.0 6 0.0 7 4.0 8 2.0 9 1.0 10 3.0 11 0.0 12 2.0 13 1.0 14 4.0 15 3.0 16 4.0 17 8.0 18 9.0 19 6.0 20 11.0 21 13.0 22 11.0 23 12.0 24 15.0 25 15.0 26 25.0 27 27.0 28 35.0 29 36.0 30 47.0 31 62.0 32 77.0 33 95.0 34 126.0 35 212.0 36 475.0 37 2628.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.64532266133066 21.510755377688845 12.456228114057028 25.387693846923458 2 27.6424805423048 26.58799899573186 27.592267135325134 18.177253326638212 3 20.9442491210447 28.252134605725765 30.88900050226017 19.914615770969363 4 23.38608389851796 34.086912835970864 22.43154986184376 20.09545340366742 5 24.08942476764632 35.87038432554635 22.130118060788746 17.910072846018586 6 21.43574297188755 37.34939759036144 22.289156626506024 18.925702811244978 7 20.908634538152608 23.09236947791165 36.82228915662651 19.176706827309236 8 21.61144578313253 26.80722891566265 25.903614457831324 25.67771084337349 9 21.03413654618474 25.903614457831324 29.794176706827308 23.268072289156628 10-14 23.691211162977464 29.29779651658887 25.648747678562465 21.362244641871204 15-19 23.649598393574298 27.766064257028113 27.65060240963855 20.933734939759034 20-24 23.39859437751004 28.498995983935743 27.113453815261046 20.988955823293175 25-29 23.589357429718877 28.263052208835344 27.454819277108435 20.69277108433735 30-34 22.771084337349397 28.739959839357432 27.690763052208833 20.798192771084338 35-39 23.53413654618474 27.941767068273094 28.012048192771083 20.512048192771086 40-44 22.991967871485944 27.68072289156627 28.253012048192772 21.07429718875502 45-49 23.049502962144793 28.0299226830003 27.809016969575257 21.111557385279646 50-54 23.758598182457195 27.996184164281768 27.96605914545363 20.279158507807402 55-59 24.072493599076257 27.72729554696521 27.717254882273206 20.482955971685328 60-64 23.41867469879518 28.187751004016064 27.786144578313255 20.6074297188755 65-69 23.35191042827735 27.875684088969223 27.835517397198373 20.936888085555054 70-74 23.88771718389073 27.503264035352014 28.196243848548757 20.412774932208496 75-79 23.631615948578887 28.39208596966958 27.538415185296778 20.437882896454756 80-84 24.079746899010697 28.06207000451966 27.288705870536834 20.569477225932808 85-89 24.128578603716726 27.513812154696133 28.45303867403315 19.904570567553993 90-94 24.251707513057454 28.41000401767778 27.516070711128965 19.8222177581358 95-99 24.136199276817997 28.540578545600642 27.259943752511052 20.063278425070312 100-104 24.69489227060419 27.713324293104314 27.773592486565214 19.818190949726283 105-109 24.63462407714329 27.43207272362011 28.019687609863897 19.913615589372707 110-114 24.32568185242855 27.464965593450195 27.796473956502084 20.412878597619166 115-119 24.109699131046263 27.384599929680043 27.95218243005676 20.553518509216936 120-124 24.043002109916607 28.19250477243042 27.59971867778559 20.16477443986738 125-129 24.07435317759357 27.581009796533536 27.817131374026626 20.52750565184627 130-134 24.496256469524145 27.973468669916084 27.69207577508668 19.83819908547309 135-139 24.18730844596292 27.95558458523841 27.36773350751143 20.489373461287244 140-144 24.41083362645093 27.958394050550222 27.42575749962313 20.205014823375713 145-149 24.409488390793044 28.21891647401749 27.736455925218618 19.635139209970852 150-151 24.993720170811354 26.337603617181614 28.07083647324793 20.597839738759106 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 8.0 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 2.5 27 5.5 28 8.0 29 7.5 30 9.5 31 18.5 32 24.5 33 32.0 34 49.0 35 57.5 36 64.0 37 89.5 38 116.0 39 152.0 40 202.5 41 230.5 42 255.5 43 279.5 44 285.5 45 289.0 46 282.5 47 265.5 48 244.0 49 208.5 50 176.5 51 152.5 52 117.5 53 93.5 54 73.5 55 51.0 56 36.5 57 25.0 58 18.5 59 13.0 60 10.0 61 7.5 62 4.5 63 5.5 64 4.5 65 1.0 66 1.0 67 2.0 68 3.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.42500000000000004 3 0.44999999999999996 4 0.475 5 0.475 6 0.4 7 0.4 8 0.4 9 0.4 10-14 0.385 15-19 0.4 20-24 0.4 25-29 0.4 30-34 0.4 35-39 0.4 40-44 0.4 45-49 0.41000000000000003 50-54 0.415 55-59 0.40499999999999997 60-64 0.4 65-69 0.415 70-74 0.43 75-79 0.43 80-84 0.43499999999999994 85-89 0.44999999999999996 90-94 0.44 95-99 0.44 100-104 0.445 105-109 0.445 110-114 0.455 115-119 0.455 120-124 0.47000000000000003 125-129 0.475 130-134 0.49500000000000005 135-139 0.485 140-144 0.49500000000000005 145-149 0.51 150-151 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62292609351434 99.075 2 0.32679738562091504 0.65 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025138260432378077 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 4.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAA 10 0.006830828 145.0 6 CTGCAAC 10 0.006830828 145.0 7 >>END_MODULE Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732583 spots for SRR7169830.sra Written 732583 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra Read 732564 spots for SRR7169830.sra Written 732564 spots for SRR7169830.sra SRR ids: ['SRR7169830.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_prs46ryr SRR7169830.sra spots: 14651299 blocks: [[1, 732564], [732565, 1465128], [1465129, 2197692], [2197693, 2930256], [2930257, 3662820], [3662821, 4395384], [4395385, 5127948], [5127949, 5860512], [5860513, 6593076], [6593077, 7325640], [7325641, 8058204], [8058205, 8790768], [8790769, 9523332], [9523333, 10255896], [10255897, 10988460], [10988461, 11721024], [11721025, 12453588], [12453589, 13186152], [13186153, 13918716], [13918717, 14651299]] SRR7169830 file size 4943144 SRR7169830 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169830 SRR7169830_1.fastq SRR7169830_2.fastq Input file: SRR7169830_1.fastq Paired file: SRR7169830_2.fastq trimmed: SRR7169830-trimmed-pair1.fastq, SRR7169830-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:14:00 2025 >> started Fri Apr 11 12:14:15 2025 >> done (15.632s) 14651299 read pairs processed; of these: 31495 ( 0.21%) short read pairs filtered out after trimming by size control 63906 ( 0.44%) empty read pairs filtered out after trimming by size control 14555898 (99.35%) read pairs available; of these: 6015816 (41.33%) trimmed read pairs available after processing 8540082 (58.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 3 0.00% 24 7 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 6 0.00% 29 11 0.00% 30 8 0.00% 31 5 0.00% 32 8 0.00% 33 4 0.00% 34 12 0.00% 35 9 0.00% 36 9 0.00% 37 14 0.00% 38 19 0.00% 39 22 0.00% 40 30 0.00% 41 28 0.00% 42 34 0.00% 43 45 0.00% 44 26 0.00% 45 41 0.00% 46 40 0.00% 47 55 0.00% 48 65 0.00% 49 85 0.00% 50 92 0.00% 51 112 0.00% 52 112 0.00% 53 133 0.00% 54 166 0.00% 55 174 0.00% 56 193 0.00% 57 210 0.00% 58 239 0.00% 59 284 0.00% 60 320 0.00% 61 420 0.00% 62 453 0.00% 63 491 0.00% 64 556 0.00% 65 602 0.00% 66 678 0.00% 67 794 0.01% 68 807 0.01% 69 988 0.01% 70 1096 0.01% 71 1309 0.01% 72 1530 0.01% 73 1671 0.01% 74 1769 0.01% 75 2097 0.01% 76 2284 0.02% 77 2314 0.02% 78 2626 0.02% 79 2861 0.02% 80 3083 0.02% 81 3558 0.02% 82 4050 0.03% 83 4520 0.03% 84 5735 0.04% 85 6624 0.05% 86 6884 0.05% 87 7389 0.05% 88 7645 0.05% 89 7789 0.05% 90 8346 0.06% 91 8950 0.06% 92 9473 0.07% 93 10116 0.07% 94 10452 0.07% 95 11172 0.08% 96 11886 0.08% 97 11887 0.08% 98 12214 0.08% 99 12888 0.09% 100 13107 0.09% 101 13541 0.09% 102 14409 0.10% 103 14979 0.10% 104 15809 0.11% 105 16408 0.11% 106 16931 0.12% 107 17470 0.12% 108 17804 0.12% 109 17999 0.12% 110 18321 0.13% 111 18637 0.13% 112 19421 0.13% 113 20515 0.14% 114 21317 0.15% 115 22294 0.15% 116 22994 0.16% 117 23793 0.16% 118 23975 0.16% 119 24332 0.17% 120 25121 0.17% 121 25593 0.18% 122 26453 0.18% 123 27396 0.19% 124 28851 0.20% 125 30081 0.21% 126 31338 0.22% 127 32164 0.22% 128 33102 0.23% 129 34151 0.23% 130 35058 0.24% 131 36343 0.25% 132 38398 0.26% 133 40106 0.28% 134 42257 0.29% 135 45017 0.31% 136 47256 0.32% 137 49659 0.34% 138 53612 0.37% 139 57347 0.39% 140 61372 0.42% 141 66811 0.46% 142 73307 0.50% 143 81855 0.56% 144 94733 0.65% 145 111943 0.77% 146 138748 0.95% 147 185481 1.27% 148 277561 1.91% 149 588963 4.05% 150 3029031 20.81% 151 8540082 58.67% 14555898 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=271.96 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=40 prefix-density=0.27 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=284.33 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=28.2 sequence=AAGAAGAAGAAA SRR7169830 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:14:55 Started mapping on | Apr 11 12:14:55 Finished on | Apr 11 12:16:03 Mapping speed, Million of reads per hour | 770.61 Number of input reads | 14555898 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13726952 Uniquely mapped reads % | 94.31% Average mapped length | 294.00 Number of splices: Total | 12708991 Number of splices: Annotated (sjdb) | 12493227 Number of splices: GT/AG | 12514373 Number of splices: GC/AG | 153510 Number of splices: AT/AC | 10215 Number of splices: Non-canonical | 30893 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255933 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 54083 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 589528 589528 589528 N_multimapping 255933 255933 255933 N_noFeature 335428 13579840 391353 N_ambiguous 147979 657 56412 UnstrandedReadsAssigned:13243545 PositiveStrandReadsAssigned:146455 NegativeStrandReadsAssigned:13279187 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169830 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169830-trimmed-pair1.fastq SRR7169830-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,555,898 reads, 13,203,206 reads pseudoaligned [quant] estimated average fragment length: 265.156 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7169830.ke.tsv 34699 SRR7169830.se.tsv 87100 total ==> SRR7169830.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.84 174 7.19196 Potri.005G024800.1.v4.1 1035 770.844 49 4.60807 Potri.004G059700.1.v4.1 961 696.857 2 0.208054 Potri.007G009000.2.v4.1 1416 1151.84 0 0 Potri.003G141000.2.v4.1 2943 2678.84 301.118 8.1485 Potri.016G087400.1.v4.1 270 78.2603 1347 1247.71 Potri.015G069301.1.v4.1 564 306.014 0 0 Potri.010G195200.1.v4.1 1773 1508.84 12 0.576536 Potri.012G127500.1.v4.1 977 712.851 7306 742.968 ==> SRR7169830.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1245 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169830 completed mapping pipeline successfully