Starting /dee2/code/volunteer_pipeline.sh SRR7169831 current disk space = 3052903596032 free memory = 1372482624 SRR7169831 SRAfilesize 3620096e66dec5f532248fcdef40e4e7 SRR7169831.sra SRR7169831.sra file validated SRR7169831 is paired end SRR7169831 is conventional basespace SRR7169831 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.574 25.0 18.0 33.0 18.0 33.0 2 30.33125 31.0 29.0 33.0 27.0 33.0 3 31.5705 33.0 31.0 33.0 29.0 33.0 4 31.90075 33.0 31.0 33.0 29.0 33.0 5 32.68175 33.0 33.0 33.0 32.0 34.0 6 36.95675 38.0 37.0 38.0 35.0 38.0 7 37.38275 38.0 38.0 38.0 36.0 38.0 8 37.666 38.0 38.0 38.0 38.0 38.0 9 37.67175 38.0 38.0 38.0 38.0 38.0 10-14 37.493900000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.206849999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.60665 38.0 38.0 38.0 37.8 38.0 25-29 37.5925 38.0 38.0 38.0 38.0 38.0 30-34 37.418949999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.48905 38.0 38.0 38.0 37.4 38.0 40-44 37.335 38.0 38.0 38.0 37.0 38.0 45-49 37.29415 38.0 38.0 38.0 36.8 38.0 50-54 37.038850000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.86925 38.0 37.8 38.0 35.0 38.0 60-64 37.1014 38.0 38.0 38.0 35.8 38.0 65-69 37.17465 38.0 38.0 38.0 36.0 38.0 70-74 36.8346 38.0 37.8 38.0 35.0 38.0 75-79 36.9716 38.0 38.0 38.0 35.6 38.0 80-84 36.890699999999995 38.0 38.0 38.0 35.2 38.0 85-89 36.825849999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.691050000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.425349999999995 38.0 37.4 38.0 34.0 38.0 100-104 36.26285 38.0 37.2 38.0 33.6 38.0 105-109 35.47189999999999 38.0 36.0 38.0 29.6 38.0 110-114 35.947 38.0 36.8 38.0 32.6 38.0 115-119 35.746500000000005 38.0 36.2 38.0 31.2 38.0 120-124 35.721000000000004 38.0 36.0 38.0 31.2 38.0 125-129 35.300149999999995 38.0 35.8 38.0 29.4 38.0 130-134 34.8113 38.0 35.0 38.0 27.6 38.0 135-139 34.52875 38.0 35.0 38.0 25.6 38.0 140-144 33.495450000000005 37.6 33.2 38.0 21.4 38.0 145-149 32.39185 37.6 31.6 38.0 15.6 38.0 150-151 28.06775 34.0 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 3.0 19 2.0 20 3.0 21 2.0 22 8.0 23 1.0 24 7.0 25 13.0 26 11.0 27 15.0 28 19.0 29 25.0 30 37.0 31 63.0 32 98.0 33 134.0 34 204.0 35 432.0 36 1208.0 37 1712.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.199999999999996 11.65 8.75 38.4 2 21.05 15.45 34.2 29.299999999999997 3 18.659329664832416 19.259629814907452 28.789394697348676 33.291645822911455 4 22.75 27.500000000000004 23.674999999999997 26.075 5 23.325000000000003 32.925 23.425 20.325 6 19.45 35.15 25.525 19.875 7 15.425 26.474999999999998 41.9 16.2 8 18.3 26.450000000000003 29.425 25.825 9 16.75 24.349999999999998 33.95 24.95 10-14 19.580000000000002 30.73 26.605 23.085 15-19 19.985 29.12 27.62 23.275000000000002 20-24 20.57 29.62 26.465 23.345 25-29 19.66 29.475 27.334999999999997 23.53 30-34 20.315 28.475 27.965 23.244999999999997 35-39 20.165 28.775000000000002 26.919999999999998 24.14 40-44 20.055 29.360000000000003 26.995 23.59 45-49 20.294999999999998 28.494999999999997 27.66 23.549999999999997 50-54 20.44 28.515 27.435 23.61 55-59 20.380000000000003 28.57 27.994999999999997 23.055 60-64 20.26 28.975 27.125 23.64 65-69 20.73 27.834999999999997 27.845 23.59 70-74 20.65 28.945 27.05 23.355 75-79 20.424999999999997 28.735 27.35 23.49 80-84 20.395 28.095 27.685 23.825 85-89 20.385 28.610000000000003 27.515 23.49 90-94 20.695 28.439999999999998 27.32 23.544999999999998 95-99 20.495 28.465 27.48 23.56 100-104 20.835 28.199999999999996 27.55 23.415 105-109 20.68 28.07 27.965 23.285 110-114 20.544999999999998 28.720000000000002 27.139999999999997 23.595 115-119 21.175 28.689999999999998 27.195000000000004 22.939999999999998 120-124 20.369999999999997 28.285 27.16 24.185000000000002 125-129 20.755000000000003 28.610000000000003 27.57 23.064999999999998 130-134 20.86 28.425 27.365000000000002 23.35 135-139 20.4 28.785 27.245 23.57 140-144 20.525 27.82 27.55 24.104999999999997 145-149 21.240000000000002 27.605 27.46 23.695 150-151 21.224999999999998 27.712500000000002 27.975 23.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 1.0 23 3.0 24 3.5 25 2.0 26 3.5 27 6.0 28 7.5 29 10.5 30 17.5 31 21.5 32 33.0 33 46.5 34 54.0 35 63.5 36 78.5 37 100.5 38 118.0 39 147.5 40 185.0 41 221.0 42 267.0 43 282.5 44 289.0 45 268.0 46 250.0 47 262.0 48 231.0 49 195.5 50 176.0 51 154.0 52 127.0 53 95.5 54 66.5 55 55.5 56 41.5 57 25.0 58 17.0 59 13.5 60 10.5 61 8.5 62 9.0 63 5.5 64 3.0 65 2.5 66 4.0 67 5.5 68 2.5 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.225 0.0 0.0 0.0 0.0 132-133 3.4749999999999996 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 3.9000000000000004 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCATA 10 0.006830828 145.0 1 >>END_MODULE SRR7169831 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169831_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22525 34.0 33.0 34.0 33.0 34.0 2 33.29125 34.0 33.0 34.0 33.0 34.0 3 33.32725 34.0 33.0 34.0 33.0 34.0 4 33.295 34.0 33.0 34.0 33.0 34.0 5 33.25425 34.0 33.0 34.0 33.0 34.0 6 37.43475 38.0 38.0 38.0 38.0 38.0 7 37.405 38.0 38.0 38.0 38.0 38.0 8 37.42625 38.0 38.0 38.0 38.0 38.0 9 36.91775 38.0 38.0 38.0 36.0 38.0 10-14 37.3002 38.0 38.0 38.0 37.2 38.0 15-19 37.31545 38.0 38.0 38.0 37.4 38.0 20-24 37.2093 38.0 38.0 38.0 37.0 38.0 25-29 37.0311 38.0 38.0 38.0 36.4 38.0 30-34 37.277499999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.05434999999999 38.0 38.0 38.0 36.2 38.0 40-44 37.17274999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.1556 38.0 38.0 38.0 36.6 38.0 50-54 36.633950000000006 38.0 38.0 38.0 34.6 38.0 55-59 37.129000000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.13005 38.0 38.0 38.0 37.0 38.0 65-69 36.73825 38.0 38.0 38.0 35.2 38.0 70-74 36.04035 38.0 37.2 38.0 31.0 38.0 75-79 36.62045 38.0 38.0 38.0 34.8 38.0 80-84 36.019949999999994 38.0 37.4 38.0 31.4 38.0 85-89 36.676100000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.7762 38.0 38.0 38.0 35.8 38.0 95-99 36.7832 38.0 38.0 38.0 35.6 38.0 100-104 36.38674999999999 38.0 38.0 38.0 34.2 38.0 105-109 36.225649999999995 38.0 38.0 38.0 33.6 38.0 110-114 36.3159 38.0 38.0 38.0 34.0 38.0 115-119 36.1002 38.0 37.8 38.0 33.6 38.0 120-124 35.78015 38.0 36.8 38.0 32.4 38.0 125-129 35.6339 38.0 36.6 38.0 31.4 38.0 130-134 35.478300000000004 38.0 36.2 38.0 31.2 38.0 135-139 35.090700000000005 38.0 36.0 38.0 28.6 38.0 140-144 34.777750000000005 38.0 35.4 38.0 28.2 38.0 145-149 34.24920000000001 38.0 34.2 38.0 26.8 38.0 150-151 29.780625 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 3.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 3.0 12 0.0 13 1.0 14 3.0 15 2.0 16 2.0 17 2.0 18 5.0 19 5.0 20 4.0 21 4.0 22 12.0 23 6.0 24 13.0 25 12.0 26 9.0 27 18.0 28 16.0 29 26.0 30 35.0 31 54.0 32 70.0 33 103.0 34 143.0 35 247.0 36 644.0 37 2550.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 23.0 13.25 26.474999999999998 2 26.625 27.150000000000002 30.525000000000002 15.7 3 20.375 30.325000000000003 31.674999999999997 17.625 4 23.275000000000002 33.675 24.0 19.05 5 23.200000000000003 35.425000000000004 22.725 18.65 6 20.625 38.675 22.75 17.95 7 20.125 21.4 38.975 19.5 8 23.025000000000002 25.6 26.05 25.324999999999996 9 20.549999999999997 26.25 28.625 24.575 10-14 22.845 28.76 26.38 22.015 15-19 22.75 27.794999999999998 27.224999999999998 22.23 20-24 22.97 27.839999999999996 28.060000000000002 21.13 25-29 22.605 28.02 28.000000000000004 21.375 30-34 22.770000000000003 27.815 28.055000000000003 21.36 35-39 22.165000000000003 28.21 28.1 21.525 40-44 23.22 27.744999999999997 27.48 21.555 45-49 22.79 28.315 27.875 21.02 50-54 22.24 28.310000000000002 28.18 21.27 55-59 22.67 28.1 28.000000000000004 21.23 60-64 22.585 27.92 27.96 21.535 65-69 22.965 27.54 28.82 20.674999999999997 70-74 23.505000000000003 27.325 28.720000000000002 20.45 75-79 23.56 27.644999999999996 27.87 20.925 80-84 22.935 27.975 28.1 20.990000000000002 85-89 23.215 28.155 27.87 20.76 90-94 23.1 27.779999999999998 27.805000000000003 21.315 95-99 23.215 28.435 27.275 21.075 100-104 23.03 28.43 27.66 20.880000000000003 105-109 23.294999999999998 27.529999999999998 27.845 21.33 110-114 23.825 27.750000000000004 27.76 20.665 115-119 23.799999999999997 27.439999999999998 28.12 20.64 120-124 24.145 27.655 27.575 20.625 125-129 23.925 27.894999999999996 27.58 20.599999999999998 130-134 23.785 27.839999999999996 28.050000000000004 20.325 135-139 23.655 27.584999999999997 28.060000000000002 20.7 140-144 23.599999999999998 28.365000000000002 27.750000000000004 20.285 145-149 23.82 27.075 28.155 20.95 150-151 24.099999999999998 27.3875 27.900000000000002 20.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 2.5 27 2.0 28 2.0 29 5.5 30 9.5 31 18.0 32 25.0 33 31.5 34 48.0 35 59.5 36 80.5 37 103.0 38 124.5 39 162.5 40 196.5 41 241.0 42 275.0 43 275.0 44 284.0 45 296.0 46 297.5 47 280.0 48 239.5 49 201.0 50 165.0 51 136.0 52 116.0 53 86.5 54 58.0 55 47.0 56 36.0 57 23.0 58 16.0 59 17.0 60 12.5 61 6.0 62 4.0 63 2.0 64 1.5 65 1.5 66 2.5 67 1.0 68 0.0 69 0.0 70 1.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0125 0.0 104-105 1.1749999999999998 0.0 0.0 0.025 0.0 106-107 1.3250000000000002 0.0 0.0 0.025 0.0 108-109 1.4375 0.0 0.0 0.025 0.0 110-111 1.5750000000000002 0.0 0.0 0.025 0.0 112-113 1.6875 0.0 0.0 0.025 0.0 114-115 1.7625 0.0 0.0 0.025 0.0 116-117 1.9125 0.0 0.0 0.025 0.0 118-119 2.0999999999999996 0.0 0.0 0.025 0.0 120-121 2.2625 0.0 0.0 0.025 0.0 122-123 2.5625 0.0 0.0 0.025 0.0 124-125 2.9000000000000004 0.0 0.0 0.025 0.0 126-127 2.9625000000000004 0.0 0.0 0.025 0.0 128-129 3.1125 0.0 0.0 0.025 0.0 130-131 3.2 0.0 0.0 0.025 0.0 132-133 3.425 0.0 0.0 0.025 0.0 134-135 3.6 0.0 0.0 0.025 0.0 136-137 3.8499999999999996 0.0 0.0 0.037500000000000006 0.0 138-139 4.075 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTTA 10 0.006830828 145.0 4 >>END_MODULE Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565513 spots for SRR7169831.sra Written 565513 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra Read 565504 spots for SRR7169831.sra Written 565504 spots for SRR7169831.sra SRR ids: ['SRR7169831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1yupdxum SRR7169831.sra spots: 11310089 blocks: [[1, 565504], [565505, 1131008], [1131009, 1696512], [1696513, 2262016], [2262017, 2827520], [2827521, 3393024], [3393025, 3958528], [3958529, 4524032], [4524033, 5089536], [5089537, 5655040], [5655041, 6220544], [6220545, 6786048], [6786049, 7351552], [7351553, 7917056], [7917057, 8482560], [8482561, 9048064], [9048065, 9613568], [9613569, 10179072], [10179073, 10744576], [10744577, 11310089]] SRR7169831 file size 3810917 SRR7169831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169831 SRR7169831_1.fastq SRR7169831_2.fastq Input file: SRR7169831_1.fastq Paired file: SRR7169831_2.fastq trimmed: SRR7169831-trimmed-pair1.fastq, SRR7169831-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:15:45 2025 >> started Tue Feb 11 21:15:57 2025 >> done (12.705s) 11310089 read pairs processed; of these: 8091 ( 0.07%) short read pairs filtered out after trimming by size control 6030 ( 0.05%) empty read pairs filtered out after trimming by size control 11295968 (99.88%) read pairs available; of these: 4722439 (41.81%) trimmed read pairs available after processing 6573529 (58.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 6 0.00% 25 0 0.00% 26 5 0.00% 27 4 0.00% 28 1 0.00% 29 5 0.00% 30 2 0.00% 31 2 0.00% 32 5 0.00% 33 2 0.00% 34 5 0.00% 35 4 0.00% 36 3 0.00% 37 4 0.00% 38 4 0.00% 39 11 0.00% 40 11 0.00% 41 13 0.00% 42 15 0.00% 43 15 0.00% 44 21 0.00% 45 15 0.00% 46 18 0.00% 47 27 0.00% 48 30 0.00% 49 35 0.00% 50 28 0.00% 51 41 0.00% 52 52 0.00% 53 66 0.00% 54 71 0.00% 55 66 0.00% 56 75 0.00% 57 102 0.00% 58 103 0.00% 59 122 0.00% 60 147 0.00% 61 166 0.00% 62 190 0.00% 63 233 0.00% 64 238 0.00% 65 265 0.00% 66 264 0.00% 67 332 0.00% 68 355 0.00% 69 398 0.00% 70 497 0.00% 71 543 0.00% 72 672 0.01% 73 676 0.01% 74 803 0.01% 75 922 0.01% 76 988 0.01% 77 1031 0.01% 78 1172 0.01% 79 1251 0.01% 80 1400 0.01% 81 1605 0.01% 82 1832 0.02% 83 2097 0.02% 84 2528 0.02% 85 3051 0.03% 86 3281 0.03% 87 3489 0.03% 88 3822 0.03% 89 3915 0.03% 90 4152 0.04% 91 4220 0.04% 92 4753 0.04% 93 5150 0.05% 94 5336 0.05% 95 5724 0.05% 96 5987 0.05% 97 5996 0.05% 98 6438 0.06% 99 6366 0.06% 100 6782 0.06% 101 7203 0.06% 102 7532 0.07% 103 8012 0.07% 104 8459 0.07% 105 8976 0.08% 106 9273 0.08% 107 9223 0.08% 108 9543 0.08% 109 9662 0.09% 110 9974 0.09% 111 10399 0.09% 112 10810 0.10% 113 11475 0.10% 114 11855 0.10% 115 12353 0.11% 116 12868 0.11% 117 12988 0.11% 118 13312 0.12% 119 13164 0.12% 120 13674 0.12% 121 14405 0.13% 122 14574 0.13% 123 15309 0.14% 124 16192 0.14% 125 16534 0.15% 126 17266 0.15% 127 18391 0.16% 128 19008 0.17% 129 19505 0.17% 130 20546 0.18% 131 21570 0.19% 132 22505 0.20% 133 23814 0.21% 134 25562 0.23% 135 27305 0.24% 136 29243 0.26% 137 31716 0.28% 138 34033 0.30% 139 37400 0.33% 140 40999 0.36% 141 45446 0.40% 142 50309 0.45% 143 58788 0.52% 144 70637 0.63% 145 89098 0.79% 146 114387 1.01% 147 156152 1.38% 148 243916 2.16% 149 498601 4.41% 150 2618402 23.18% 151 6573529 58.19% 11295968 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=11.55 fanout-score-rank=8 prefix-density=0.37 prefix-fanout=6.0 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=269.08 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=37 prefix-density=0.37 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=141.37 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=15.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169831 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:17:14 Started mapping on | Feb 11 21:17:15 Finished on | Feb 11 21:18:20 Mapping speed, Million of reads per hour | 625.62 Number of input reads | 11295968 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10657779 Uniquely mapped reads % | 94.35% Average mapped length | 295.88 Number of splices: Total | 10374492 Number of splices: Annotated (sjdb) | 10214077 Number of splices: GT/AG | 10226851 Number of splices: GC/AG | 118934 Number of splices: AT/AC | 7479 Number of splices: Non-canonical | 21228 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201043 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 15232 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446209 446209 446209 N_multimapping 201043 201043 201043 N_noFeature 212130 10553426 255350 N_ambiguous 107824 692 46177 UnstrandedReadsAssigned:10337825 PositiveStrandReadsAssigned:103661 NegativeStrandReadsAssigned:10356252 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169831 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169831-trimmed-pair1.fastq SRR7169831-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,295,968 reads, 10,251,659 reads pseudoaligned [quant] estimated average fragment length: 305.142 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR7169831.ke.tsv 34699 SRR7169831.se.tsv 87100 total ==> SRR7169831.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1713.86 231 13.7515 Potri.005G024800.1.v4.1 1035 730.858 30 4.18794 Potri.004G059700.1.v4.1 961 656.949 1 0.155303 Potri.007G009000.2.v4.1 1416 1111.86 0 0 Potri.003G141000.2.v4.1 2943 2638.86 221.033 8.54579 Potri.016G087400.1.v4.1 270 76.3415 766 1023.72 Potri.015G069301.1.v4.1 564 271.271 0 0 Potri.010G195200.1.v4.1 1773 1468.86 23 1.59757 Potri.012G127500.1.v4.1 977 672.88 3510 532.208 ==> SRR7169831.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 765 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169831 completed mapping pipeline successfully