Starting /dee2/code/volunteer_pipeline.sh SRR7169832 current disk space = 3052306247680 free memory = 1572014052 SRR7169832 SRAfilesize 8843bd45042d5edae7b5c93c6e059ac3 SRR7169832.sra SRR7169832.sra file validated SRR7169832 is paired end SRR7169832 is conventional basespace SRR7169832 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.52775 25.0 18.0 33.0 18.0 33.0 2 29.70375 31.0 27.0 33.0 25.0 33.0 3 30.43925 31.0 29.0 33.0 27.0 33.0 4 30.57525 31.0 29.0 33.0 28.0 33.0 5 32.10425 33.0 31.0 33.0 31.0 33.0 6 36.239 38.0 36.0 38.0 33.0 38.0 7 36.99775 38.0 37.0 38.0 35.0 38.0 8 37.4975 38.0 38.0 38.0 37.0 38.0 9 37.417 38.0 38.0 38.0 37.0 38.0 10-14 37.544 38.0 38.0 38.0 37.0 38.0 15-19 37.5161 38.0 38.0 38.0 37.6 38.0 20-24 37.5578 38.0 38.0 38.0 38.0 38.0 25-29 37.55825 38.0 38.0 38.0 37.8 38.0 30-34 37.443799999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.1714 38.0 38.0 38.0 36.6 38.0 40-44 37.394099999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.39905 38.0 38.0 38.0 37.0 38.0 50-54 37.2808 38.0 38.0 38.0 37.0 38.0 55-59 37.14245 38.0 38.0 38.0 36.4 38.0 60-64 37.01935 38.0 38.0 38.0 36.0 38.0 65-69 36.9553 38.0 38.0 38.0 36.0 38.0 70-74 36.60115 38.0 37.8 38.0 34.6 38.0 75-79 36.289249999999996 38.0 37.2 38.0 33.2 38.0 80-84 36.6434 38.0 38.0 38.0 34.4 38.0 85-89 36.590250000000005 38.0 38.0 38.0 34.2 38.0 90-94 36.45675 38.0 37.8 38.0 34.0 38.0 95-99 36.21875 38.0 37.0 38.0 33.4 38.0 100-104 35.884750000000004 38.0 37.0 38.0 31.8 38.0 105-109 34.99915 38.0 35.6 38.0 27.2 38.0 110-114 34.8506 38.0 35.0 38.0 26.8 38.0 115-119 35.3986 38.0 35.8 38.0 29.6 38.0 120-124 35.12134999999999 38.0 35.4 38.0 28.4 38.0 125-129 34.44215 38.0 34.6 38.0 25.6 38.0 130-134 34.0862 38.0 33.6 38.0 23.6 38.0 135-139 33.0504 37.6 32.6 38.0 18.8 38.0 140-144 32.56015000000001 37.6 31.4 38.0 14.2 38.0 145-149 31.58795 36.8 31.0 38.0 10.8 38.0 150-151 26.80775 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 4.0 17 4.0 18 1.0 19 5.0 20 3.0 21 6.0 22 7.0 23 5.0 24 9.0 25 12.0 26 19.0 27 30.0 28 19.0 29 43.0 30 53.0 31 74.0 32 91.0 33 160.0 34 267.0 35 483.0 36 1266.0 37 1431.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.759689922480625 12.978244561140285 12.05301325331333 36.209052263065765 2 22.025 16.925 32.225 28.825 3 19.275000000000002 21.349999999999998 26.700000000000003 32.675 4 20.8 29.45 23.9 25.85 5 23.225 32.85 23.724999999999998 20.200000000000003 6 19.125 37.3 23.849999999999998 19.725 7 14.649999999999999 25.724999999999998 41.825 17.8 8 18.05 26.400000000000002 29.625 25.924999999999997 9 16.829942225571465 26.14920874152223 32.73046973122331 24.290379301682993 10-14 19.755 30.65 26.715 22.88 15-19 19.24 29.735 27.405 23.62 20-24 19.93 29.565 27.639999999999997 22.865 25-29 19.139999999999997 29.57 27.425 23.865 30-34 19.73 29.195 27.544999999999998 23.53 35-39 19.62 29.315 27.05 24.015 40-44 19.869999999999997 29.4 27.825 22.905 45-49 20.01 28.515 28.07 23.405 50-54 19.794999999999998 28.62 28.08 23.505000000000003 55-59 20.145 29.439999999999998 27.08 23.335 60-64 19.935 29.32 27.185 23.56 65-69 20.165 29.49 26.889999999999997 23.455000000000002 70-74 19.97 28.43 27.96 23.64 75-79 19.96 29.020000000000003 26.889999999999997 24.13 80-84 19.665 28.560000000000002 27.755000000000003 24.02 85-89 20.34 28.599999999999998 27.089999999999996 23.97 90-94 19.845 29.255 27.445000000000004 23.455000000000002 95-99 19.82 28.32 28.084999999999997 23.775 100-104 20.39 28.875 27.36 23.375 105-109 20.345 28.51 27.794999999999998 23.35 110-114 20.02 28.000000000000004 28.144999999999996 23.835 115-119 20.035 28.815 27.865000000000002 23.285 120-124 20.250125062531264 28.16408204102051 27.32866433216608 24.25712856428214 125-129 19.90082147866159 28.305950711280303 27.439390903626524 24.353836906431578 130-134 20.62 28.605000000000004 27.305 23.47 135-139 20.21 28.645 27.615000000000002 23.53 140-144 20.385 28.470000000000002 27.68 23.465 145-149 20.845 28.18 26.840000000000003 24.135 150-151 19.650000000000002 28.225 27.5625 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 3.0 23 2.5 24 2.5 25 5.0 26 8.0 27 9.0 28 10.0 29 12.5 30 18.0 31 29.0 32 43.0 33 48.5 34 52.5 35 78.0 36 100.0 37 116.0 38 137.0 39 164.5 40 200.5 41 213.0 42 235.0 43 261.0 44 275.5 45 274.0 46 259.0 47 247.5 48 228.0 49 203.5 50 165.0 51 123.0 52 109.5 53 96.0 54 68.5 55 54.5 56 40.5 57 30.0 58 18.0 59 10.5 60 7.5 61 5.0 62 5.0 63 2.5 64 2.5 65 3.5 66 2.5 67 1.5 68 1.5 69 3.0 70 3.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.475 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.05 125-129 0.18 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.47500000000000003 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7169832 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169832_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.205 34.0 33.0 34.0 33.0 34.0 2 33.258 34.0 33.0 34.0 33.0 34.0 3 33.2325 34.0 33.0 34.0 33.0 34.0 4 33.276 34.0 33.0 34.0 33.0 34.0 5 33.2985 34.0 33.0 34.0 33.0 34.0 6 37.48 38.0 38.0 38.0 38.0 38.0 7 37.4795 38.0 38.0 38.0 38.0 38.0 8 37.4585 38.0 38.0 38.0 38.0 38.0 9 37.32 38.0 38.0 38.0 38.0 38.0 10-14 37.360699999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.405049999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.06915 38.0 38.0 38.0 36.4 38.0 25-29 37.115750000000006 38.0 38.0 38.0 37.0 38.0 30-34 36.8759 38.0 38.0 38.0 35.2 38.0 35-39 37.3046 38.0 38.0 38.0 37.2 38.0 40-44 37.120099999999994 38.0 38.0 38.0 36.8 38.0 45-49 37.04605 38.0 38.0 38.0 36.4 38.0 50-54 37.176849999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.18065 38.0 38.0 38.0 37.0 38.0 60-64 37.032849999999996 38.0 38.0 38.0 36.4 38.0 65-69 37.0098 38.0 38.0 38.0 36.2 38.0 70-74 35.930899999999994 38.0 37.0 38.0 29.6 38.0 75-79 36.66775 38.0 38.0 38.0 35.2 38.0 80-84 36.870999999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.79655 38.0 38.0 38.0 36.0 38.0 90-94 36.776450000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.7205 38.0 38.0 38.0 35.6 38.0 100-104 36.48165 38.0 38.0 38.0 34.8 38.0 105-109 36.28225 38.0 38.0 38.0 34.0 38.0 110-114 35.727 38.0 37.2 38.0 30.6 38.0 115-119 36.054 38.0 37.8 38.0 33.8 38.0 120-124 35.87904999999999 38.0 37.2 38.0 32.8 38.0 125-129 35.53895 38.0 36.8 38.0 31.8 38.0 130-134 35.0706 38.0 36.0 38.0 30.4 38.0 135-139 34.798350000000006 38.0 35.6 38.0 29.4 38.0 140-144 30.294150000000002 35.2 25.4 38.0 13.6 38.0 145-149 33.2055 38.0 33.0 38.0 19.6 38.0 150-151 28.955 35.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 2.0 12 2.0 13 2.0 14 2.0 15 3.0 16 2.0 17 2.0 18 5.0 19 8.0 20 6.0 21 8.0 22 6.0 23 11.0 24 8.0 25 11.0 26 18.0 27 17.0 28 18.0 29 34.0 30 26.0 31 58.0 32 72.0 33 91.0 34 166.0 35 305.0 36 874.0 37 2230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 21.575 15.625 24.675 2 26.581645411352838 27.731932983245812 27.85696424106027 17.829457364341085 3 20.43010752688172 28.907226806701676 30.38259564891223 20.280070017504375 4 22.155538884721178 35.25881470367592 24.10602650662666 18.479619904976243 5 23.80595148787197 34.15853963490873 23.40585146286572 18.629657414353588 6 21.8 35.6 24.425 18.175 7 21.50537634408602 21.705426356589147 36.734183545886474 20.05501375343836 8 22.355588897224308 26.106526631657918 27.131782945736433 24.406101525381345 9 21.575 26.450000000000003 28.799999999999997 23.175 10-14 23.246162308115405 28.711435571778587 25.871293564678233 22.17110855542777 15-19 22.865 27.284999999999997 28.705000000000002 21.145 20-24 23.426171308565426 28.23141157057853 27.281364068203413 21.061053052652632 25-29 23.94 27.85 27.26 20.95 30-34 23.189999999999998 28.53 27.985 20.294999999999998 35-39 23.799999999999997 28.415000000000003 27.405 20.380000000000003 40-44 23.19347902185328 28.494274141121167 27.379106866029908 20.933139970995647 45-49 23.375 28.275 27.474999999999998 20.875 50-54 23.632363236323634 28.542854285428543 27.18771877187719 20.637063706370636 55-59 23.871193559677984 28.07640382019101 27.27636381819091 20.776038801940096 60-64 23.665 27.92 27.975 20.44 65-69 23.691184559227963 27.84639231961598 28.181409070453523 20.281014050702534 70-74 23.765 28.055000000000003 27.63 20.549999999999997 75-79 23.51 27.6 28.485 20.405 80-84 23.75 27.675 28.075 20.5 85-89 23.705000000000002 27.785 27.825 20.685000000000002 90-94 24.099999999999998 28.015 27.825 20.06 95-99 24.035 28.57 27.55 19.845 100-104 23.87 27.939999999999998 27.815 20.375 105-109 23.933590038505777 28.039205880882136 27.62914437165575 20.398059708956342 110-114 23.845 28.035 27.74 20.380000000000003 115-119 23.73 27.16 27.865000000000002 21.245 120-124 23.955000000000002 28.215 27.894999999999996 19.935 125-129 24.345 27.93 27.689999999999998 20.035 130-134 24.41 28.050000000000004 27.315 20.225 135-139 24.09 27.83 27.325 20.755000000000003 140-144 24.6 27.73 27.339999999999996 20.330000000000002 145-149 24.45 27.775 27.775 20.0 150-151 23.95 27.6125 27.975 20.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 1.5 27 1.0 28 3.5 29 6.0 30 9.5 31 11.5 32 16.0 33 23.5 34 35.0 35 50.0 36 78.0 37 98.5 38 114.5 39 169.0 40 215.0 41 238.5 42 256.5 43 273.0 44 318.0 45 312.0 46 283.5 47 280.5 48 245.0 49 207.0 50 177.5 51 140.0 52 114.5 53 100.0 54 72.5 55 43.5 56 26.5 57 18.5 58 12.5 59 10.5 60 7.5 61 5.0 62 4.0 63 2.0 64 3.5 65 4.5 66 2.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.025 8 0.025 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.01 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.825 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.1 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.6875 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896401 spots for SRR7169832.sra Written 896401 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra Read 896386 spots for SRR7169832.sra Written 896386 spots for SRR7169832.sra SRR ids: ['SRR7169832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dscqclh7 SRR7169832.sra spots: 17927735 blocks: [[1, 896386], [896387, 1792772], [1792773, 2689158], [2689159, 3585544], [3585545, 4481930], [4481931, 5378316], [5378317, 6274702], [6274703, 7171088], [7171089, 8067474], [8067475, 8963860], [8963861, 9860246], [9860247, 10756632], [10756633, 11653018], [11653019, 12549404], [12549405, 13445790], [13445791, 14342176], [14342177, 15238562], [15238563, 16134948], [16134949, 17031334], [17031335, 17927735]] SRR7169832 file size 6053420 SRR7169832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169832 SRR7169832_1.fastq SRR7169832_2.fastq Input file: SRR7169832_1.fastq Paired file: SRR7169832_2.fastq trimmed: SRR7169832-trimmed-pair1.fastq, SRR7169832-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:25:41 2025 >> started Tue Feb 11 22:26:01 2025 >> done (19.790s) 17927735 read pairs processed; of these: 21252 ( 0.12%) short read pairs filtered out after trimming by size control 16720 ( 0.09%) empty read pairs filtered out after trimming by size control 17889763 (99.79%) read pairs available; of these: 8289306 (46.34%) trimmed read pairs available after processing 9600457 (53.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 7 0.00% 28 8 0.00% 29 5 0.00% 30 7 0.00% 31 7 0.00% 32 6 0.00% 33 4 0.00% 34 10 0.00% 35 12 0.00% 36 12 0.00% 37 15 0.00% 38 17 0.00% 39 11 0.00% 40 12 0.00% 41 26 0.00% 42 15 0.00% 43 17 0.00% 44 25 0.00% 45 34 0.00% 46 23 0.00% 47 43 0.00% 48 50 0.00% 49 39 0.00% 50 56 0.00% 51 63 0.00% 52 84 0.00% 53 89 0.00% 54 95 0.00% 55 127 0.00% 56 152 0.00% 57 115 0.00% 58 168 0.00% 59 186 0.00% 60 259 0.00% 61 298 0.00% 62 297 0.00% 63 337 0.00% 64 379 0.00% 65 423 0.00% 66 473 0.00% 67 525 0.00% 68 610 0.00% 69 627 0.00% 70 757 0.00% 71 890 0.00% 72 1020 0.01% 73 1216 0.01% 74 1251 0.01% 75 1495 0.01% 76 1626 0.01% 77 1802 0.01% 78 1799 0.01% 79 2037 0.01% 80 2362 0.01% 81 2638 0.01% 82 2957 0.02% 83 3452 0.02% 84 4457 0.02% 85 5138 0.03% 86 5346 0.03% 87 5703 0.03% 88 5870 0.03% 89 6340 0.04% 90 6752 0.04% 91 6942 0.04% 92 7254 0.04% 93 7919 0.04% 94 8227 0.05% 95 8832 0.05% 96 9205 0.05% 97 9225 0.05% 98 9619 0.05% 99 10042 0.06% 100 10404 0.06% 101 10981 0.06% 102 11597 0.06% 103 12252 0.07% 104 12888 0.07% 105 13831 0.08% 106 13892 0.08% 107 14216 0.08% 108 14547 0.08% 109 14905 0.08% 110 15263 0.09% 111 15864 0.09% 112 16624 0.09% 113 17368 0.10% 114 17913 0.10% 115 18420 0.10% 116 19321 0.11% 117 19881 0.11% 118 20106 0.11% 119 20439 0.11% 120 21034 0.12% 121 21475 0.12% 122 22378 0.13% 123 23875 0.13% 124 24895 0.14% 125 26005 0.15% 126 27760 0.16% 127 28539 0.16% 128 29316 0.16% 129 30892 0.17% 130 32174 0.18% 131 33889 0.19% 132 36002 0.20% 133 38092 0.21% 134 40971 0.23% 135 43980 0.25% 136 48006 0.27% 137 52303 0.29% 138 56480 0.32% 139 61609 0.34% 140 68946 0.39% 141 78025 0.44% 142 91256 0.51% 143 114537 0.64% 144 129521 0.72% 145 168608 0.94% 146 209578 1.17% 147 299565 1.67% 148 492657 2.75% 149 1004526 5.62% 150 4473737 25.01% 151 9600457 53.66% 17889763 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=37 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=329.36 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=19.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=44 fanout-score=135.90 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=14.4 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169832 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:26:44 Started mapping on | Feb 11 22:26:45 Finished on | Feb 11 22:28:15 Mapping speed, Million of reads per hour | 715.59 Number of input reads | 17889763 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16683479 Uniquely mapped reads % | 93.26% Average mapped length | 295.52 Number of splices: Total | 15621997 Number of splices: Annotated (sjdb) | 15364892 Number of splices: GT/AG | 15396119 Number of splices: GC/AG | 180039 Number of splices: AT/AC | 11641 Number of splices: Non-canonical | 34198 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307581 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 11613 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 918544 918544 918544 N_multimapping 307581 307581 307581 N_noFeature 338601 16482353 399288 N_ambiguous 208433 966 67434 UnstrandedReadsAssigned:16136445 PositiveStrandReadsAssigned:200160 NegativeStrandReadsAssigned:16216757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169832 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169832-trimmed-pair1.fastq SRR7169832-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,889,763 reads, 16,067,747 reads pseudoaligned [quant] estimated average fragment length: 288.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7169832.ke.tsv 34699 SRR7169832.se.tsv 87100 total ==> SRR7169832.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.76 307 10.1212 Potri.005G024800.1.v4.1 1035 747.755 36 2.74708 Potri.004G059700.1.v4.1 961 673.773 7 0.592807 Potri.007G009000.2.v4.1 1416 1128.76 0 0 Potri.003G141000.2.v4.1 2943 2655.76 283.07 6.08184 Potri.016G087400.1.v4.1 270 71.4895 2024 1615.46 Potri.015G069301.1.v4.1 564 283.935 0 0 Potri.010G195200.1.v4.1 1773 1485.76 40 1.53618 Potri.012G127500.1.v4.1 977 689.767 6088 503.618 ==> SRR7169832.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1297 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 357 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169832 completed mapping pipeline successfully