Starting /dee2/code/volunteer_pipeline.sh SRR7169833 current disk space = 3052388909056 free memory = 1485143164 SRR7169833 SRAfilesize 8c784ed21f0594202f909a5ee85cc8fb SRR7169833.sra SRR7169833.sra file validated SRR7169833 is paired end SRR7169833 is conventional basespace SRR7169833 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.157 25.0 18.0 33.0 18.0 33.0 2 29.96375 31.0 28.0 33.0 27.0 33.0 3 31.433 33.0 31.0 33.0 29.0 33.0 4 31.81575 33.0 31.0 33.0 29.0 33.0 5 32.548 33.0 33.0 33.0 32.0 34.0 6 36.83725 38.0 37.0 38.0 34.0 38.0 7 37.2725 38.0 38.0 38.0 36.0 38.0 8 37.564 38.0 38.0 38.0 37.0 38.0 9 37.63575 38.0 38.0 38.0 38.0 38.0 10-14 37.426100000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.2315 38.0 38.0 38.0 36.8 38.0 20-24 37.56515 38.0 38.0 38.0 37.8 38.0 25-29 37.5707 38.0 38.0 38.0 37.8 38.0 30-34 37.34845 38.0 38.0 38.0 37.4 38.0 35-39 37.4611 38.0 38.0 38.0 37.2 38.0 40-44 37.23805 38.0 38.0 38.0 36.6 38.0 45-49 37.189499999999995 38.0 38.0 38.0 36.2 38.0 50-54 36.95309999999999 38.0 38.0 38.0 35.6 38.0 55-59 36.7692 38.0 37.8 38.0 34.8 38.0 60-64 36.9195 38.0 38.0 38.0 35.6 38.0 65-69 37.01735 38.0 38.0 38.0 36.0 38.0 70-74 36.684099999999994 38.0 37.8 38.0 34.6 38.0 75-79 36.7976 38.0 38.0 38.0 34.6 38.0 80-84 36.7525 38.0 38.0 38.0 34.6 38.0 85-89 36.68165 38.0 38.0 38.0 34.4 38.0 90-94 36.49345 38.0 37.4 38.0 34.0 38.0 95-99 36.2464 38.0 37.0 38.0 33.6 38.0 100-104 36.02315 38.0 37.0 38.0 32.8 38.0 105-109 35.30375 38.0 35.6 38.0 29.2 38.0 110-114 35.632349999999995 38.0 36.0 38.0 30.6 38.0 115-119 35.436699999999995 38.0 36.0 38.0 29.4 38.0 120-124 35.379650000000005 38.0 36.0 38.0 30.2 38.0 125-129 34.86775 38.0 35.2 38.0 28.0 38.0 130-134 34.38615 38.0 34.4 38.0 25.6 38.0 135-139 34.04275 38.0 34.2 38.0 24.0 38.0 140-144 33.012950000000004 37.6 33.2 38.0 18.8 38.0 145-149 31.99755 36.0 31.4 38.0 13.6 38.0 150-151 27.788 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 6.0 20 5.0 21 5.0 22 4.0 23 5.0 24 9.0 25 13.0 26 12.0 27 13.0 28 20.0 29 35.0 30 43.0 31 66.0 32 100.0 33 145.0 34 263.0 35 481.0 36 1297.0 37 1470.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.974999999999994 12.825000000000001 12.174999999999999 37.025000000000006 2 22.3 15.65 33.900000000000006 28.15 3 21.135567783891947 21.235617808904454 26.013006503251624 31.615807903951975 4 20.925 29.925 23.5 25.650000000000002 5 22.8 32.125 24.3 20.775 6 20.625 35.125 23.974999999999998 20.275000000000002 7 14.499999999999998 25.45 42.675000000000004 17.375 8 18.75 26.200000000000003 28.975 26.075 9 16.425 25.95 33.475 24.15 10-14 20.19 29.675 27.61 22.525000000000002 15-19 19.85 28.410000000000004 28.375 23.365 20-24 19.66 29.28 27.555000000000003 23.505000000000003 25-29 19.59 29.020000000000003 27.47 23.919999999999998 30-34 20.165 29.435 27.02 23.380000000000003 35-39 19.689999999999998 29.42 27.27 23.62 40-44 20.325 29.270000000000003 27.215 23.189999999999998 45-49 20.185 29.23 27.544999999999998 23.04 50-54 20.085 28.925 27.339999999999996 23.65 55-59 20.294999999999998 29.020000000000003 27.634999999999998 23.05 60-64 20.4 28.599999999999998 27.560000000000002 23.44 65-69 20.39 28.845 26.755000000000003 24.01 70-74 19.91 28.860000000000003 27.625 23.605 75-79 20.674999999999997 28.199999999999996 27.384999999999998 23.74 80-84 20.26 29.81 26.450000000000003 23.48 85-89 20.285 28.33 27.534999999999997 23.849999999999998 90-94 19.875 28.68 27.72 23.724999999999998 95-99 20.445 28.410000000000004 27.775 23.369999999999997 100-104 20.745 29.075 26.61 23.57 105-109 20.255000000000003 28.544999999999998 27.6 23.599999999999998 110-114 20.1 28.64 27.52 23.74 115-119 21.65 28.610000000000003 27.05 22.689999999999998 120-124 20.75 28.345 27.529999999999998 23.375 125-129 20.455000000000002 28.18 27.51 23.855 130-134 20.685000000000002 28.065 27.79 23.46 135-139 20.765 28.189999999999998 27.395000000000003 23.65 140-144 21.255 27.939999999999998 27.650000000000002 23.155 145-149 20.76 28.77 27.735 22.735 150-151 20.4875 27.3 27.3125 24.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 2.0 26 4.0 27 8.0 28 9.0 29 10.5 30 16.0 31 29.0 32 43.0 33 48.5 34 56.0 35 82.5 36 96.0 37 106.0 38 146.5 39 164.5 40 175.5 41 201.5 42 225.5 43 244.5 44 256.5 45 274.5 46 286.0 47 273.0 48 243.0 49 200.0 50 172.0 51 147.0 52 110.0 53 93.0 54 82.0 55 60.0 56 35.0 57 23.5 58 18.5 59 12.0 60 8.5 61 7.0 62 6.5 63 4.0 64 2.5 65 2.5 66 2.0 67 0.5 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.6125 0.0 0.0 0.0 0.0 118-119 1.8 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.0374999999999996 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.3375 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGGAG 10 0.006830828 145.0 5 ACCAGGC 10 0.006830828 145.0 6 >>END_MODULE SRR7169833 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169833_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26825 34.0 33.0 34.0 33.0 34.0 2 33.338 34.0 33.0 34.0 33.0 34.0 3 33.36475 34.0 33.0 34.0 33.0 34.0 4 33.34525 34.0 33.0 34.0 33.0 34.0 5 33.34225 34.0 33.0 34.0 33.0 34.0 6 37.57025 38.0 38.0 38.0 38.0 38.0 7 37.44 38.0 38.0 38.0 38.0 38.0 8 37.50725 38.0 38.0 38.0 38.0 38.0 9 37.051 38.0 38.0 38.0 37.0 38.0 10-14 37.406850000000006 38.0 38.0 38.0 37.8 38.0 15-19 37.370149999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.29425 38.0 38.0 38.0 37.4 38.0 25-29 37.1709 38.0 38.0 38.0 36.8 38.0 30-34 37.371199999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.14335 38.0 38.0 38.0 37.0 38.0 40-44 37.259699999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.23375 38.0 38.0 38.0 37.2 38.0 50-54 36.7632 38.0 38.0 38.0 35.4 38.0 55-59 37.225350000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.21319999999999 38.0 38.0 38.0 37.0 38.0 65-69 36.82405 38.0 37.8 38.0 35.2 38.0 70-74 36.2071 38.0 37.6 38.0 32.4 38.0 75-79 36.79125 38.0 38.0 38.0 35.4 38.0 80-84 36.137 38.0 37.6 38.0 32.4 38.0 85-89 36.77845 38.0 38.0 38.0 35.6 38.0 90-94 36.966899999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.81935 38.0 38.0 38.0 35.8 38.0 100-104 36.506150000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.39385 38.0 38.0 38.0 34.4 38.0 110-114 36.503249999999994 38.0 38.0 38.0 34.4 38.0 115-119 36.29565000000001 38.0 37.8 38.0 33.8 38.0 120-124 35.87265000000001 38.0 37.0 38.0 32.6 38.0 125-129 35.8569 38.0 37.0 38.0 32.6 38.0 130-134 35.72425 38.0 36.8 38.0 32.4 38.0 135-139 35.4423 38.0 36.2 38.0 31.4 38.0 140-144 35.037150000000004 38.0 36.0 38.0 30.0 38.0 145-149 34.53245 38.0 35.4 38.0 28.4 38.0 150-151 30.163875 35.5 28.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 0.0 6 0.0 7 2.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 1.0 14 1.0 15 4.0 16 2.0 17 2.0 18 4.0 19 2.0 20 9.0 21 5.0 22 6.0 23 9.0 24 6.0 25 10.0 26 13.0 27 14.0 28 13.0 29 24.0 30 33.0 31 37.0 32 49.0 33 88.0 34 138.0 35 245.0 36 622.0 37 2649.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.4 20.45 16.0 26.150000000000002 2 26.55 27.450000000000003 28.725 17.275 3 19.825 29.599999999999998 31.5 19.075 4 22.95 34.5 23.525 19.025 5 23.875 36.199999999999996 21.55 18.375 6 21.25 38.15 22.125 18.475 7 19.575 21.975 38.175 20.275000000000002 8 21.875 24.825 27.950000000000003 25.35 9 21.675 26.35 28.549999999999997 23.425 10-14 23.41 28.904999999999998 26.455000000000002 21.23 15-19 22.975 27.97 28.63 20.424999999999997 20-24 22.939999999999998 28.360000000000003 27.750000000000004 20.95 25-29 23.294999999999998 28.315 27.66 20.73 30-34 22.845 28.28 27.715 21.16 35-39 23.585 27.725 28.04 20.65 40-44 22.88 27.855 28.53 20.735 45-49 23.07 27.46 28.294999999999998 21.175 50-54 22.935 28.54 27.665 20.86 55-59 23.395 27.52 28.23 20.855 60-64 23.52 28.18 27.755000000000003 20.544999999999998 65-69 23.03 27.565 28.4 21.005 70-74 23.16 28.185 27.634999999999998 21.02 75-79 23.07 27.83 28.294999999999998 20.805 80-84 23.68 27.765 27.825 20.73 85-89 23.315 28.01 28.29 20.385 90-94 23.805 28.175 27.815 20.205000000000002 95-99 23.815 28.035 27.900000000000002 20.25 100-104 23.669999999999998 28.16 27.529999999999998 20.64 105-109 23.98 27.675 28.275 20.07 110-114 23.78 27.98 27.675 20.565 115-119 24.55 27.634999999999998 27.365000000000002 20.45 120-124 24.175 27.994999999999997 27.55 20.28 125-129 24.125 28.285 27.405 20.185 130-134 23.915 27.57 27.93 20.585 135-139 24.27 28.26 27.325 20.145 140-144 24.33 27.92 27.155 20.595 145-149 24.560000000000002 27.63 27.725 20.085 150-151 24.224999999999998 27.3625 28.7375 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 4.5 27 6.0 28 5.0 29 5.0 30 10.0 31 15.5 32 18.5 33 29.5 34 47.0 35 57.5 36 75.5 37 101.0 38 144.5 39 190.5 40 208.0 41 221.5 42 251.0 43 288.0 44 300.0 45 286.5 46 279.0 47 257.0 48 232.0 49 215.5 50 173.5 51 129.5 52 110.5 53 85.5 54 63.0 55 58.0 56 41.0 57 28.0 58 20.5 59 12.5 60 8.0 61 4.0 62 3.0 63 1.5 64 0.0 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.9750000000000001 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.6375 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.0875000000000004 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.625 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACAT 10 0.006830828 145.0 7 GCTTCAC 15 1.1411342E-4 145.0 5 CATCGTG 10 0.006830828 145.0 9 >>END_MODULE Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599454 spots for SRR7169833.sra Written 599454 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra Read 599452 spots for SRR7169833.sra Written 599452 spots for SRR7169833.sra SRR ids: ['SRR7169833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l43n2zsk SRR7169833.sra spots: 11989042 blocks: [[1, 599452], [599453, 1198904], [1198905, 1798356], [1798357, 2397808], [2397809, 2997260], [2997261, 3596712], [3596713, 4196164], [4196165, 4795616], [4795617, 5395068], [5395069, 5994520], [5994521, 6593972], [6593973, 7193424], [7193425, 7792876], [7792877, 8392328], [8392329, 8991780], [8991781, 9591232], [9591233, 10190684], [10190685, 10790136], [10790137, 11389588], [11389589, 11989042]] SRR7169833 file size 4040992 SRR7169833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169833 SRR7169833_1.fastq SRR7169833_2.fastq Input file: SRR7169833_1.fastq Paired file: SRR7169833_2.fastq trimmed: SRR7169833-trimmed-pair1.fastq, SRR7169833-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:15:11 2025 >> started Tue Feb 11 22:15:25 2025 >> done (13.512s) 11989042 read pairs processed; of these: 10717 ( 0.09%) short read pairs filtered out after trimming by size control 10644 ( 0.09%) empty read pairs filtered out after trimming by size control 11967681 (99.82%) read pairs available; of these: 4982220 (41.63%) trimmed read pairs available after processing 6985461 (58.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 0 0.00% 29 2 0.00% 30 6 0.00% 31 7 0.00% 32 7 0.00% 33 2 0.00% 34 6 0.00% 35 6 0.00% 36 7 0.00% 37 7 0.00% 38 8 0.00% 39 11 0.00% 40 16 0.00% 41 19 0.00% 42 16 0.00% 43 9 0.00% 44 11 0.00% 45 8 0.00% 46 22 0.00% 47 26 0.00% 48 23 0.00% 49 28 0.00% 50 41 0.00% 51 46 0.00% 52 47 0.00% 53 57 0.00% 54 35 0.00% 55 73 0.00% 56 74 0.00% 57 83 0.00% 58 88 0.00% 59 120 0.00% 60 141 0.00% 61 169 0.00% 62 173 0.00% 63 187 0.00% 64 220 0.00% 65 257 0.00% 66 275 0.00% 67 276 0.00% 68 342 0.00% 69 386 0.00% 70 415 0.00% 71 507 0.00% 72 557 0.00% 73 676 0.01% 74 705 0.01% 75 812 0.01% 76 872 0.01% 77 1019 0.01% 78 1070 0.01% 79 1126 0.01% 80 1310 0.01% 81 1504 0.01% 82 1734 0.01% 83 1930 0.02% 84 2522 0.02% 85 2863 0.02% 86 3051 0.03% 87 3384 0.03% 88 3468 0.03% 89 3690 0.03% 90 3807 0.03% 91 4081 0.03% 92 4440 0.04% 93 4586 0.04% 94 4965 0.04% 95 5227 0.04% 96 5651 0.05% 97 5718 0.05% 98 5940 0.05% 99 5996 0.05% 100 6241 0.05% 101 6871 0.06% 102 7204 0.06% 103 7599 0.06% 104 7990 0.07% 105 8361 0.07% 106 8545 0.07% 107 8948 0.07% 108 8892 0.07% 109 9193 0.08% 110 9553 0.08% 111 10327 0.09% 112 10790 0.09% 113 11137 0.09% 114 11661 0.10% 115 12052 0.10% 116 12542 0.10% 117 12808 0.11% 118 13308 0.11% 119 13222 0.11% 120 13598 0.11% 121 14241 0.12% 122 14528 0.12% 123 15229 0.13% 124 16309 0.14% 125 17164 0.14% 126 17778 0.15% 127 18455 0.15% 128 19204 0.16% 129 19467 0.16% 130 20675 0.17% 131 21577 0.18% 132 22885 0.19% 133 23936 0.20% 134 26115 0.22% 135 28069 0.23% 136 29689 0.25% 137 32141 0.27% 138 34966 0.29% 139 37557 0.31% 140 41275 0.34% 141 45934 0.38% 142 51738 0.43% 143 60353 0.50% 144 73073 0.61% 145 92470 0.77% 146 119212 1.00% 147 163988 1.37% 148 259152 2.17% 149 533233 4.46% 150 2813983 23.51% 151 6985461 58.37% 11967681 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.6 sequence=AAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCAGGACCACCATTGCAAGTAGCAAAGGTTGGCAAACCACATGTCATGGCCTCAACAACAGTCAATCCAAAAGCCTCATACAAAGCAGGCTGCACGAAAGCTCCCTTGGTATCACAAATGTAACGGTAGAGCTCTCCATTCCTCACGCGGTTCATCTGAGAAGAAATCCATCTGAACTGGCCATTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=269.55 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=20.2 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=38 prefix-density=0.27 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=119.90 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=14.2 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7169833 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:16:10 Started mapping on | Feb 11 22:16:11 Finished on | Feb 11 22:17:11 Mapping speed, Million of reads per hour | 718.06 Number of input reads | 11967681 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11291360 Uniquely mapped reads % | 94.35% Average mapped length | 296.15 Number of splices: Total | 10576060 Number of splices: Annotated (sjdb) | 10397767 Number of splices: GT/AG | 10421483 Number of splices: GC/AG | 123118 Number of splices: AT/AC | 8074 Number of splices: Non-canonical | 23385 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210873 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 18145 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 476483 476483 476483 N_multimapping 210873 210873 210873 N_noFeature 261479 11168549 309925 N_ambiguous 125239 891 50195 UnstrandedReadsAssigned:10904642 PositiveStrandReadsAssigned:121920 NegativeStrandReadsAssigned:10931240 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169833 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169833-trimmed-pair1.fastq SRR7169833-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,967,681 reads, 10,834,169 reads pseudoaligned [quant] estimated average fragment length: 293.877 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7169833.ke.tsv 34699 SRR7169833.se.tsv 87100 total ==> SRR7169833.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.12 175 9.44268 Potri.005G024800.1.v4.1 1035 742.123 24 3.01032 Potri.004G059700.1.v4.1 961 668.15 3 0.41795 Potri.007G009000.2.v4.1 1416 1123.12 0 0 Potri.003G141000.2.v4.1 2943 2650.12 170.027 5.97214 Potri.016G087400.1.v4.1 270 71.8642 748.553 969.588 Potri.015G069301.1.v4.1 564 280.123 0 0 Potri.010G195200.1.v4.1 1773 1480.12 30 1.88669 Potri.012G127500.1.v4.1 977 684.123 2824 384.245 ==> SRR7169833.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1402 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169833 completed mapping pipeline successfully