Starting /dee2/code/volunteer_pipeline.sh SRR7169834 current disk space = 3052610752512 free memory = 1370237888 SRR7169834 SRAfilesize 95bbf63dbded9593ebc416d6feddf45b SRR7169834.sra SRR7169834.sra file validated SRR7169834 is paired end SRR7169834 is conventional basespace SRR7169834 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169834_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.5375 25.0 18.0 33.0 18.0 33.0 2 27.48175 29.0 25.0 31.0 18.0 33.0 3 30.585 31.0 29.0 33.0 27.0 33.0 4 31.09175 33.0 31.0 33.0 29.0 33.0 5 32.131 33.0 33.0 33.0 31.0 33.0 6 36.62175 38.0 37.0 38.0 34.0 38.0 7 37.3145 38.0 38.0 38.0 36.0 38.0 8 37.603 38.0 38.0 38.0 37.0 38.0 9 37.6295 38.0 38.0 38.0 38.0 38.0 10-14 37.58565 38.0 38.0 38.0 37.6 38.0 15-19 37.54875 38.0 38.0 38.0 38.0 38.0 20-24 37.55475 38.0 38.0 38.0 37.8 38.0 25-29 37.49065 38.0 38.0 38.0 37.6 38.0 30-34 37.41885 38.0 38.0 38.0 37.4 38.0 35-39 37.4593 38.0 38.0 38.0 37.6 38.0 40-44 37.3883 38.0 38.0 38.0 37.0 38.0 45-49 37.38415 38.0 38.0 38.0 37.0 38.0 50-54 37.1887 38.0 38.0 38.0 36.6 38.0 55-59 37.03320000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.78985 38.0 38.0 38.0 35.4 38.0 65-69 36.423449999999995 38.0 37.6 38.0 33.4 38.0 70-74 36.603500000000004 38.0 38.0 38.0 34.2 38.0 75-79 36.09185 38.0 38.0 38.0 34.0 38.0 80-84 35.72865 38.0 37.4 38.0 32.8 38.0 85-89 35.372699999999995 38.0 36.8 38.0 30.0 38.0 90-94 35.44885000000001 38.0 37.0 38.0 31.2 38.0 95-99 35.3768 38.0 37.0 38.0 30.8 38.0 100-104 34.91335 38.0 36.2 38.0 28.8 38.0 105-109 34.4804 38.0 35.6 38.0 26.0 38.0 110-114 34.152 38.0 35.0 38.0 22.2 38.0 115-119 33.31269999999999 37.6 33.4 38.0 21.0 38.0 120-124 32.6794 37.4 32.4 38.0 16.2 38.0 125-129 31.481449999999995 36.6 29.2 38.0 14.6 38.0 130-134 31.9558 36.8 31.0 38.0 15.0 38.0 135-139 31.5302 36.6 30.4 38.0 13.0 38.0 140-144 30.63915 36.4 28.6 38.0 12.0 38.0 145-149 28.6586 35.4 24.8 38.0 2.0 38.0 150-151 22.03775 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 3.0 12 3.0 13 3.0 14 1.0 15 1.0 16 4.0 17 8.0 18 19.0 19 52.0 20 11.0 21 9.0 22 9.0 23 11.0 24 11.0 25 16.0 26 23.0 27 31.0 28 35.0 29 57.0 30 52.0 31 96.0 32 126.0 33 204.0 34 358.0 35 709.0 36 1245.0 37 898.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.68293910417715 14.167086059386008 12.128837443381983 34.02113739305486 2 21.425 19.0 31.175000000000004 28.4 3 19.425 19.925 29.325000000000003 31.324999999999996 4 20.65 26.8 23.95 28.599999999999998 5 21.975 29.875 26.55 21.6 6 22.15 33.800000000000004 25.674999999999997 18.375 7 13.450000000000001 29.275000000000002 40.45 16.825000000000003 8 17.65 29.525000000000002 29.75 23.075000000000003 9 18.55 26.025 33.35 22.075 10-14 18.75 31.215 27.47 22.564999999999998 15-19 19.49 30.14 27.395000000000003 22.975 20-24 19.05 30.895 27.034999999999997 23.02 25-29 19.48 29.985 27.07 23.465 30-34 18.515 30.925000000000004 26.950000000000003 23.61 35-39 19.37 30.064999999999998 26.855 23.71 40-44 18.995 30.620000000000005 27.455000000000002 22.93 45-49 19.57 29.310000000000002 27.884999999999998 23.235 50-54 20.005 29.175 27.105 23.715 55-59 19.0 29.03 28.050000000000004 23.919999999999998 60-64 19.18 29.244999999999997 28.12 23.455000000000002 65-69 19.28 30.545 26.58 23.595 70-74 19.23 30.34 27.150000000000002 23.28 75-79 19.525000000000002 30.214999999999996 26.669999999999998 23.59 80-84 19.625 30.470000000000002 26.424999999999997 23.48 85-89 19.830000000000002 30.12 26.66 23.39 90-94 20.185 29.080000000000002 26.8 23.935000000000002 95-99 19.755 29.315 27.250000000000004 23.68 100-104 20.135 28.88 27.265 23.72 105-109 20.13 29.044999999999998 27.505000000000003 23.32 110-114 19.99099054006707 28.46989338805746 27.408779218179085 24.13033685369638 115-119 20.431561029338138 29.598478021427855 26.689696605587265 23.280264343646742 120-124 20.639607627245883 29.072618988038634 26.655322556428608 23.63245082828687 125-129 20.463301145744733 29.379096412668233 26.71736628808726 23.440236153499775 130-134 19.86 29.535 26.974999999999998 23.630000000000003 135-139 20.465 28.985 27.215 23.335 140-144 20.22 29.04 26.595000000000002 24.145 145-149 20.215 29.544999999999998 26.334999999999997 23.905 150-151 20.7 30.175 26.187500000000004 22.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 1.5 19 1.5 20 0.5 21 1.0 22 3.0 23 4.5 24 4.5 25 7.0 26 12.5 27 13.5 28 12.5 29 19.0 30 31.0 31 46.5 32 59.5 33 67.0 34 77.5 35 98.5 36 117.0 37 136.5 38 159.0 39 162.0 40 175.0 41 207.5 42 250.5 43 257.5 44 245.5 45 248.0 46 223.5 47 208.5 48 203.5 49 180.0 50 150.5 51 123.5 52 106.0 53 91.5 54 67.5 55 50.5 56 39.5 57 29.5 58 25.0 59 19.0 60 14.0 61 12.5 62 9.0 63 5.0 64 6.0 65 4.0 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.105 115-119 0.13 120-124 0.095 125-129 0.065 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2057391749936 96.8 2 0.6661542403279528 1.3 3 0.05124263387138099 0.15 4 0.025621316935690495 0.1 5 0.0 0.0 6 0.025621316935690495 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025621316935690495 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 60 1.5 TruSeq Adapter, Index 13 (97% over 38bp) CATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 6 0.15 TruSeq Adapter, Index 27 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.0250000000000004 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 3.8499999999999996 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACAGT 10 0.006830828 145.0 1 TATTTGA 10 0.006830828 145.0 2 CTATTTG 10 0.006830828 145.0 1 >>END_MODULE SRR7169834 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169834_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1935 34.0 33.0 34.0 33.0 34.0 2 33.26875 34.0 33.0 34.0 33.0 34.0 3 33.2505 34.0 33.0 34.0 33.0 34.0 4 33.2565 34.0 33.0 34.0 33.0 34.0 5 33.174 34.0 33.0 34.0 33.0 34.0 6 37.41375 38.0 38.0 38.0 38.0 38.0 7 37.3005 38.0 38.0 38.0 38.0 38.0 8 37.36075 38.0 38.0 38.0 38.0 38.0 9 37.246 38.0 38.0 38.0 38.0 38.0 10-14 36.93525 38.0 38.0 38.0 36.4 38.0 15-19 37.26075 38.0 38.0 38.0 37.8 38.0 20-24 37.04275 38.0 38.0 38.0 36.8 38.0 25-29 37.203 38.0 38.0 38.0 37.4 38.0 30-34 37.21945 38.0 38.0 38.0 37.2 38.0 35-39 36.93435000000001 38.0 38.0 38.0 36.4 38.0 40-44 37.1246 38.0 38.0 38.0 36.8 38.0 45-49 37.16755 38.0 38.0 38.0 37.0 38.0 50-54 37.080200000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.0555 38.0 38.0 38.0 36.8 38.0 60-64 36.99785 38.0 38.0 38.0 36.6 38.0 65-69 36.630700000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.8645 38.0 38.0 38.0 36.0 38.0 75-79 36.8896 38.0 38.0 38.0 36.0 38.0 80-84 36.122150000000005 38.0 38.0 38.0 34.8 38.0 85-89 35.76175 38.0 37.8 38.0 33.2 38.0 90-94 35.80595 38.0 38.0 38.0 33.4 38.0 95-99 35.772850000000005 38.0 38.0 38.0 33.6 38.0 100-104 34.43295 38.0 35.8 38.0 24.2 38.0 105-109 34.948350000000005 38.0 36.6 38.0 28.0 38.0 110-114 34.795550000000006 38.0 36.4 38.0 26.6 38.0 115-119 33.862199999999994 38.0 34.4 38.0 20.8 38.0 120-124 33.950599999999994 38.0 34.8 38.0 23.0 38.0 125-129 32.9356 38.0 32.4 38.0 18.4 38.0 130-134 32.27235 37.8 31.2 38.0 15.2 38.0 135-139 32.317 38.0 32.6 38.0 13.2 38.0 140-144 31.862599999999997 37.6 32.0 38.0 12.6 38.0 145-149 29.8772 36.4 28.2 38.0 2.0 38.0 150-151 24.411125 31.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 1.0 5 2.0 6 2.0 7 1.0 8 2.0 9 0.0 10 0.0 11 3.0 12 2.0 13 3.0 14 3.0 15 1.0 16 7.0 17 6.0 18 11.0 19 10.0 20 59.0 21 11.0 22 8.0 23 15.0 24 7.0 25 15.0 26 26.0 27 32.0 28 26.0 29 43.0 30 45.0 31 53.0 32 92.0 33 130.0 34 231.0 35 428.0 36 992.0 37 1719.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 20.075000000000003 15.2 24.95 2 26.950000000000003 28.975 26.924999999999997 17.150000000000002 3 21.175 29.125 30.25 19.45 4 24.75 33.25 22.175 19.825 5 26.700000000000003 35.875 20.349999999999998 17.075000000000003 6 22.400000000000002 36.5 23.35 17.75 7 21.425 23.974999999999998 36.325 18.275 8 21.925 28.475 24.9 24.7 9 23.375 26.950000000000003 27.650000000000002 22.025 10-14 24.605 28.475 25.46 21.46 15-19 24.215 27.87 26.790000000000003 21.125 20-24 24.33 28.585 26.205000000000002 20.880000000000003 25-29 24.295 28.46 26.634999999999998 20.61 30-34 23.625 27.875 27.865000000000002 20.635 35-39 23.76 27.455000000000002 27.605 21.18 40-44 24.795 27.700000000000003 26.945000000000004 20.560000000000002 45-49 23.97 28.15 26.840000000000003 21.04 50-54 23.794999999999998 27.22 27.79 21.195 55-59 24.435000000000002 27.42 27.29 20.855 60-64 23.34 27.775 27.750000000000004 21.135 65-69 23.43 28.22 27.88 20.47 70-74 23.395 29.065 27.095000000000002 20.445 75-79 22.900000000000002 29.635 27.235 20.23 80-84 23.215 28.675 27.55 20.560000000000002 85-89 24.0 28.975 27.200000000000003 19.825 90-94 24.695 28.244999999999997 27.13 19.93 95-99 24.085 28.144999999999996 27.815 19.955000000000002 100-104 24.325 27.700000000000003 28.110000000000003 19.865 105-109 24.195 28.275 27.445000000000004 20.085 110-114 24.055 27.894999999999996 27.625 20.424999999999997 115-119 24.310000000000002 28.375 27.26 20.055 120-124 23.849999999999998 28.110000000000003 27.750000000000004 20.29 125-129 23.857157147144143 28.68860658197459 26.878063419025704 20.576172851855556 130-134 23.98 27.975 27.834999999999997 20.21 135-139 25.2 27.735 27.034999999999997 20.03 140-144 24.765 28.07 27.07 20.095 145-149 23.95 28.134999999999998 27.405 20.51 150-151 25.7625 28.000000000000004 25.7 20.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 2.5 26 3.5 27 4.0 28 4.0 29 3.5 30 6.5 31 14.0 32 18.0 33 21.5 34 29.0 35 39.5 36 55.0 37 89.0 38 118.5 39 138.0 40 183.0 41 239.5 42 257.0 43 268.5 44 302.0 45 329.5 46 320.5 47 282.5 48 253.0 49 214.0 50 169.0 51 143.0 52 117.0 53 96.0 54 74.5 55 52.5 56 40.5 57 32.0 58 24.0 59 11.0 60 7.5 61 5.5 62 7.0 63 6.0 64 2.0 65 2.0 66 3.0 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.03 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.79084126575765 96.0 2 1.0547980447646 2.0500000000000003 3 0.10290712631849756 0.3 4 0.02572678157962439 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02572678157962439 1.55 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 62 1.55 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.4625000000000004 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.35 0.0 0.0 0.0 0.0 130-131 3.5375 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 3.9000000000000004 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459019 spots for SRR7169834.sra Written 459019 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra Read 459006 spots for SRR7169834.sra Written 459006 spots for SRR7169834.sra SRR ids: ['SRR7169834.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__uvb_gvh SRR7169834.sra spots: 9180133 blocks: [[1, 459006], [459007, 918012], [918013, 1377018], [1377019, 1836024], [1836025, 2295030], [2295031, 2754036], [2754037, 3213042], [3213043, 3672048], [3672049, 4131054], [4131055, 4590060], [4590061, 5049066], [5049067, 5508072], [5508073, 5967078], [5967079, 6426084], [6426085, 6885090], [6885091, 7344096], [7344097, 7803102], [7803103, 8262108], [8262109, 8721114], [8721115, 9180133]] SRR7169834 file size 3090746 SRR7169834 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169834 SRR7169834_1.fastq SRR7169834_2.fastq Input file: SRR7169834_1.fastq Paired file: SRR7169834_2.fastq trimmed: SRR7169834-trimmed-pair1.fastq, SRR7169834-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:31:52 2025 >> started Tue Feb 11 21:32:02 2025 >> done (10.318s) 9180133 read pairs processed; of these: 15710 ( 0.17%) short read pairs filtered out after trimming by size control 178835 ( 1.95%) empty read pairs filtered out after trimming by size control 8985588 (97.88%) read pairs available; of these: 4564377 (50.80%) trimmed read pairs available after processing 4421211 (49.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 11 0.00% 21 14 0.00% 22 8 0.00% 23 10 0.00% 24 11 0.00% 25 14 0.00% 26 7 0.00% 27 12 0.00% 28 10 0.00% 29 16 0.00% 30 13 0.00% 31 72 0.00% 32 28 0.00% 33 25 0.00% 34 15 0.00% 35 10 0.00% 36 25 0.00% 37 20 0.00% 38 31 0.00% 39 18 0.00% 40 20 0.00% 41 30 0.00% 42 35 0.00% 43 26 0.00% 44 43 0.00% 45 42 0.00% 46 69 0.00% 47 69 0.00% 48 59 0.00% 49 64 0.00% 50 73 0.00% 51 78 0.00% 52 80 0.00% 53 98 0.00% 54 91 0.00% 55 107 0.00% 56 127 0.00% 57 142 0.00% 58 136 0.00% 59 179 0.00% 60 203 0.00% 61 247 0.00% 62 262 0.00% 63 300 0.00% 64 271 0.00% 65 347 0.00% 66 361 0.00% 67 384 0.00% 68 398 0.00% 69 491 0.01% 70 511 0.01% 71 621 0.01% 72 867 0.01% 73 915 0.01% 74 923 0.01% 75 1130 0.01% 76 1521 0.02% 77 1808 0.02% 78 1376 0.02% 79 1465 0.02% 80 1690 0.02% 81 1800 0.02% 82 2035 0.02% 83 2416 0.03% 84 3239 0.04% 85 3971 0.04% 86 4219 0.05% 87 4788 0.05% 88 5024 0.06% 89 5176 0.06% 90 5243 0.06% 91 5325 0.06% 92 5462 0.06% 93 5974 0.07% 94 6069 0.07% 95 6285 0.07% 96 6550 0.07% 97 6591 0.07% 98 6731 0.07% 99 6935 0.08% 100 7432 0.08% 101 7449 0.08% 102 7945 0.09% 103 8073 0.09% 104 8549 0.10% 105 9147 0.10% 106 9471 0.11% 107 9705 0.11% 108 10008 0.11% 109 10387 0.12% 110 10587 0.12% 111 10821 0.12% 112 11292 0.13% 113 11916 0.13% 114 12771 0.14% 115 13040 0.15% 116 13369 0.15% 117 13695 0.15% 118 13393 0.15% 119 13558 0.15% 120 14226 0.16% 121 14302 0.16% 122 14907 0.17% 123 15579 0.17% 124 16077 0.18% 125 16679 0.19% 126 17725 0.20% 127 18344 0.20% 128 19028 0.21% 129 20002 0.22% 130 20827 0.23% 131 21647 0.24% 132 22987 0.26% 133 24204 0.27% 134 25965 0.29% 135 28211 0.31% 136 29816 0.33% 137 32888 0.37% 138 35627 0.40% 139 38399 0.43% 140 41966 0.47% 141 46972 0.52% 142 52988 0.59% 143 60906 0.68% 144 72881 0.81% 145 90097 1.00% 146 117103 1.30% 147 164802 1.83% 148 259999 2.89% 149 527640 5.87% 150 2357096 26.23% 151 4421211 49.20% 8985588 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=124.81 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.9 sequence=TCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=8.14 fanout-score-rank=14 prefix-density=0.48 prefix-fanout=3.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=111.57 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAAGGAGAAAGAAAAGGAGAGTGCTTCCCAGTAGGGCAGCAGGCAGTATTCTTGTGTTCTATAGAACGGTGATGATGATGCTTGATGTGTGGCTTGTTTGGTTATGTCCATCTACTGTTTTTCTTCCTTTTTAGAAAAAAAAGCTCGGTTTACTGCAAATATTACAA SRR7169834 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:33:12 Started mapping on | Feb 11 21:33:12 Finished on | Feb 11 21:34:43 Mapping speed, Million of reads per hour | 355.47 Number of input reads | 8985588 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8116035 Uniquely mapped reads % | 90.32% Average mapped length | 294.41 Number of splices: Total | 7177816 Number of splices: Annotated (sjdb) | 7052226 Number of splices: GT/AG | 7069645 Number of splices: GC/AG | 86583 Number of splices: AT/AC | 5688 Number of splices: Non-canonical | 15900 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167980 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 28762 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.42% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718094 718094 718094 N_multimapping 167980 167980 167980 N_noFeature 161767 8016890 197361 N_ambiguous 99402 518 35549 UnstrandedReadsAssigned:7854866 PositiveStrandReadsAssigned:98627 NegativeStrandReadsAssigned:7883125 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169834 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169834-trimmed-pair1.fastq SRR7169834-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,985,588 reads, 7,864,748 reads pseudoaligned [quant] estimated average fragment length: 274.004 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7169834.ke.tsv 34699 SRR7169834.se.tsv 87100 total ==> SRR7169834.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745 130 7.82733 Potri.005G024800.1.v4.1 1035 761.996 25 3.44709 Potri.004G059700.1.v4.1 961 688.007 3 0.458134 Potri.007G009000.2.v4.1 1416 1143 0 0 Potri.003G141000.2.v4.1 2943 2670 129 5.07626 Potri.016G087400.1.v4.1 270 73.214 974.831 1398.94 Potri.015G069301.1.v4.1 564 295.865 0 0 Potri.010G195200.1.v4.1 1773 1500 10 0.700446 Potri.012G127500.1.v4.1 977 704.007 4126 615.767 ==> SRR7169834.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 622 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169834 completed mapping pipeline successfully