Starting /dee2/code/volunteer_pipeline.sh SRR7169835 current disk space = 3052564250624 free memory = 1469387860 SRR7169835 SRAfilesize 7f4e8f1d2b4fff771009355d80cbe23d SRR7169835.sra SRR7169835.sra file validated SRR7169835 is paired end SRR7169835 is conventional basespace SRR7169835 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.844 18.0 18.0 30.0 18.0 32.0 2 31.13 31.0 30.0 33.0 29.0 33.0 3 32.21825 33.0 33.0 33.0 31.0 33.0 4 32.72325 33.0 33.0 33.0 31.0 34.0 5 33.23325 33.0 33.0 34.0 33.0 34.0 6 37.3535 38.0 38.0 38.0 36.0 38.0 7 37.57875 38.0 38.0 38.0 37.0 38.0 8 37.65825 38.0 38.0 38.0 38.0 38.0 9 36.693 38.0 38.0 38.0 35.0 38.0 10-14 37.648649999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.4923 38.0 38.0 38.0 37.6 38.0 20-24 37.447950000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.57084999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.507549999999995 38.0 38.0 38.0 37.6 38.0 35-39 37.5187 38.0 38.0 38.0 37.8 38.0 40-44 37.302699999999994 38.0 38.0 38.0 36.8 38.0 45-49 37.449 38.0 38.0 38.0 37.2 38.0 50-54 37.34355 38.0 38.0 38.0 37.0 38.0 55-59 37.204299999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.14195 38.0 38.0 38.0 36.0 38.0 65-69 37.01905 38.0 38.0 38.0 36.0 38.0 70-74 36.9404 38.0 38.0 38.0 35.6 38.0 75-79 36.47895 38.0 38.0 38.0 34.2 38.0 80-84 36.08964999999999 38.0 37.6 38.0 33.4 38.0 85-89 35.49435 38.0 36.6 38.0 30.6 38.0 90-94 36.0173 38.0 37.2 38.0 33.8 38.0 95-99 35.98515 38.0 37.4 38.0 33.8 38.0 100-104 35.73835 38.0 37.0 38.0 32.2 38.0 105-109 34.705850000000005 38.0 35.4 38.0 25.6 38.0 110-114 34.596799999999995 38.0 35.2 38.0 25.6 38.0 115-119 34.87075 38.0 35.8 38.0 28.2 38.0 120-124 34.60665 38.0 35.2 38.0 27.4 38.0 125-129 33.1475 37.2 32.0 38.0 22.0 38.0 130-134 33.3478 37.6 33.2 38.0 21.6 38.0 135-139 33.561400000000006 38.0 33.4 38.0 21.8 38.0 140-144 32.648450000000004 38.0 32.2 38.0 15.8 38.0 145-149 31.2098 36.4 30.8 38.0 13.0 38.0 150-151 27.271124999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 3.0 17 7.0 18 12.0 19 42.0 20 5.0 21 4.0 22 5.0 23 11.0 24 9.0 25 9.0 26 11.0 27 17.0 28 23.0 29 30.0 30 35.0 31 59.0 32 93.0 33 157.0 34 243.0 35 514.0 36 1309.0 37 1394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.699999999999996 12.65 11.85 33.800000000000004 2 22.84784784784785 15.315315315315313 30.48048048048048 31.356356356356358 3 18.45 17.025000000000002 28.1 36.425000000000004 4 21.575 24.05 24.525 29.849999999999998 5 23.575 30.049999999999997 23.150000000000002 23.225 6 21.75 33.6 24.075 20.575 7 14.075 30.55 38.95 16.425 8 17.9 29.075 30.675 22.35 9 18.375 26.35 32.35 22.925 10-14 19.08 31.095 27.76 22.065 15-19 19.355 29.2 27.92 23.525 20-24 19.645000000000003 29.735 27.200000000000003 23.419999999999998 25-29 19.395 29.43 27.175 24.0 30-34 18.995 29.580000000000002 27.855 23.57 35-39 19.895 29.12 27.485 23.5 40-44 19.634999999999998 29.335 27.35 23.68 45-49 19.43 29.07 27.650000000000002 23.849999999999998 50-54 20.06 28.82 27.35 23.77 55-59 19.64 28.395 28.565 23.400000000000002 60-64 19.68 28.439999999999998 28.415000000000003 23.465 65-69 20.31 29.404999999999998 27.16 23.125 70-74 19.575 30.270000000000003 27.025 23.13 75-79 19.77 29.095 28.065 23.07 80-84 19.57 28.92 27.744999999999997 23.765 85-89 19.794999999999998 28.58 27.72 23.905 90-94 20.11 29.020000000000003 27.16 23.71 95-99 20.29 28.694999999999997 26.939999999999998 24.075 100-104 20.41 28.315 27.425 23.849999999999998 105-109 20.215 28.410000000000004 27.415 23.96 110-114 20.64 28.78 27.089999999999996 23.49 115-119 20.645 29.17 26.8 23.385 120-124 20.78 28.515 26.915 23.79 125-129 20.31 29.325000000000003 26.91 23.455000000000002 130-134 20.380000000000003 29.04 26.355 24.224999999999998 135-139 20.77 28.34 26.745 24.145 140-144 21.14 28.73 26.63 23.5 145-149 20.365 28.895 26.415 24.325 150-151 20.8 28.15 26.5625 24.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 2.0 22 2.0 23 2.0 24 3.5 25 5.5 26 5.0 27 6.5 28 12.5 29 19.5 30 27.0 31 33.0 32 42.0 33 58.0 34 72.5 35 85.5 36 101.5 37 119.0 38 137.0 39 154.5 40 180.5 41 199.5 42 215.0 43 239.0 44 263.0 45 272.0 46 268.0 47 255.5 48 223.0 49 193.5 50 166.0 51 138.5 52 124.5 53 106.5 54 75.0 55 50.0 56 35.5 57 27.0 58 20.5 59 16.0 60 11.0 61 4.5 62 4.5 63 6.0 64 3.0 65 1.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.33808553971487 97.55 2 0.6109979633401221 1.2 3 0.02545824847250509 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02545824847250509 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 47 1.175 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.5374999999999996 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.387499999999999 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCGT 10 0.006830828 145.0 9 AAAACCG 10 0.006830828 145.0 8 >>END_MODULE SRR7169835 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169835_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2855 34.0 33.0 34.0 33.0 34.0 2 33.30925 34.0 33.0 34.0 33.0 34.0 3 33.3555 34.0 33.0 34.0 33.0 34.0 4 33.3135 34.0 33.0 34.0 33.0 34.0 5 33.359 34.0 33.0 34.0 33.0 34.0 6 37.481 38.0 38.0 38.0 38.0 38.0 7 37.47075 38.0 38.0 38.0 38.0 38.0 8 37.406 38.0 38.0 38.0 38.0 38.0 9 37.47825 38.0 38.0 38.0 38.0 38.0 10-14 37.41625 38.0 38.0 38.0 38.0 38.0 15-19 37.41245 38.0 38.0 38.0 38.0 38.0 20-24 37.402049999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.104150000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.27635 38.0 38.0 38.0 37.8 38.0 35-39 37.142849999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.345800000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.028499999999994 38.0 38.0 38.0 36.4 38.0 50-54 37.1952 38.0 38.0 38.0 37.2 38.0 55-59 37.232299999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.12115000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.163850000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.115700000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.105199999999996 38.0 38.0 38.0 37.0 38.0 80-84 36.60985 38.0 38.0 38.0 36.0 38.0 85-89 36.53295 38.0 38.0 38.0 36.0 38.0 90-94 36.56490000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.422399999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.25425 38.0 38.0 38.0 34.8 38.0 105-109 36.1811 38.0 38.0 38.0 34.4 38.0 110-114 36.08135 38.0 38.0 38.0 34.0 38.0 115-119 35.9949 38.0 38.0 38.0 34.0 38.0 120-124 35.76895 38.0 38.0 38.0 33.4 38.0 125-129 35.197649999999996 38.0 36.6 38.0 29.4 38.0 130-134 35.357200000000006 38.0 37.0 38.0 32.2 38.0 135-139 33.990300000000005 38.0 34.6 38.0 22.2 38.0 140-144 33.74535 38.0 33.6 38.0 22.8 38.0 145-149 33.26475 38.0 33.0 38.0 18.6 38.0 150-151 29.61375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 2.0 14 4.0 15 3.0 16 3.0 17 2.0 18 5.0 19 15.0 20 35.0 21 5.0 22 9.0 23 5.0 24 5.0 25 11.0 26 13.0 27 16.0 28 11.0 29 20.0 30 24.0 31 35.0 32 54.0 33 78.0 34 119.0 35 208.0 36 622.0 37 2678.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 22.125 13.925 25.05 2 27.195396547410557 27.845884413309985 26.870152614460846 18.088566424818612 3 20.905226306576644 28.95723930982746 30.75768942235559 19.379844961240313 4 24.843632724543408 32.424318238679014 23.217413059794847 19.514635976982735 5 25.78144536134033 35.033758439609905 22.9057264316079 16.27906976744186 6 21.775 37.2 22.95 18.075 7 21.125 23.0 36.325 19.55 8 22.925 27.200000000000003 26.474999999999998 23.400000000000002 9 23.875 24.925 28.4 22.8 10-14 24.615000000000002 29.475 25.259999999999998 20.65 15-19 24.45 27.925 26.740000000000002 20.885 20-24 24.195 28.13 26.96 20.715 25-29 24.104999999999997 28.849999999999998 26.545 20.5 30-34 24.205 28.625 27.105 20.064999999999998 35-39 23.544999999999998 28.384999999999998 27.589999999999996 20.48 40-44 24.4 28.035 27.045 20.52 45-49 23.325000000000003 27.915 27.650000000000002 21.11 50-54 23.919999999999998 27.73 27.389999999999997 20.96 55-59 24.18 28.439999999999998 26.915 20.465 60-64 24.085 28.16 26.939999999999998 20.815 65-69 23.525 27.3 28.244999999999997 20.93 70-74 23.145 28.904999999999998 27.525 20.424999999999997 75-79 23.494999999999997 29.175 27.125 20.205000000000002 80-84 23.575 28.78 27.13 20.515 85-89 23.79 28.34 27.445000000000004 20.424999999999997 90-94 23.69 27.584999999999997 27.744999999999997 20.979999999999997 95-99 23.995 28.599999999999998 27.189999999999998 20.215 100-104 24.279999999999998 28.13 27.22 20.369999999999997 105-109 24.635 28.084999999999997 27.045 20.235 110-114 24.3 27.6 27.21 20.89 115-119 24.11 28.43 27.05 20.41 120-124 24.26 28.310000000000002 27.075 20.355 125-129 24.055 27.935 28.13 19.88 130-134 24.695 27.905 26.865 20.535 135-139 24.795 27.605 27.67 19.93 140-144 25.005 29.065 26.224999999999998 19.705000000000002 145-149 24.635 28.139999999999997 27.334999999999997 19.89 150-151 26.0125 27.125 28.037499999999998 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 2.0 28 4.0 29 6.5 30 10.5 31 9.5 32 7.5 33 16.5 34 29.5 35 50.0 36 80.5 37 89.0 38 113.5 39 151.0 40 182.0 41 223.5 42 260.0 43 294.0 44 313.0 45 298.5 46 302.0 47 290.0 48 245.5 49 214.0 50 167.5 51 143.5 52 127.0 53 94.5 54 70.0 55 54.0 56 40.5 57 30.0 58 23.0 59 15.5 60 9.0 61 6.0 62 3.5 63 2.5 64 2.5 65 2.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.025 4 0.075 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56863740167469 98.1 2 0.3298655163664045 0.65 3 0.07612281146917026 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025374270489723422 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 41 1.0250000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.525 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.7875 0.0 0.0 0.0 0.0 138-139 6.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572742 spots for SRR7169835.sra Written 572742 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra Read 572732 spots for SRR7169835.sra Written 572732 spots for SRR7169835.sra SRR ids: ['SRR7169835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c3_v4el1 SRR7169835.sra spots: 11454650 blocks: [[1, 572732], [572733, 1145464], [1145465, 1718196], [1718197, 2290928], [2290929, 2863660], [2863661, 3436392], [3436393, 4009124], [4009125, 4581856], [4581857, 5154588], [5154589, 5727320], [5727321, 6300052], [6300053, 6872784], [6872785, 7445516], [7445517, 8018248], [8018249, 8590980], [8590981, 9163712], [9163713, 9736444], [9736445, 10309176], [10309177, 10881908], [10881909, 11454650]] SRR7169835 file size 3859904 SRR7169835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169835 SRR7169835_1.fastq SRR7169835_2.fastq Input file: SRR7169835_1.fastq Paired file: SRR7169835_2.fastq trimmed: SRR7169835-trimmed-pair1.fastq, SRR7169835-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:54:35 2025 >> started Tue Feb 11 21:54:48 2025 >> done (12.505s) 11454650 read pairs processed; of these: 12347 ( 0.11%) short read pairs filtered out after trimming by size control 185675 ( 1.62%) empty read pairs filtered out after trimming by size control 11256628 (98.27%) read pairs available; of these: 5251133 (46.65%) trimmed read pairs available after processing 6005495 (53.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 7 0.00% 20 8 0.00% 21 11 0.00% 22 2 0.00% 23 7 0.00% 24 6 0.00% 25 2 0.00% 26 7 0.00% 27 4 0.00% 28 7 0.00% 29 7 0.00% 30 8 0.00% 31 9 0.00% 32 6 0.00% 33 6 0.00% 34 14 0.00% 35 13 0.00% 36 8 0.00% 37 20 0.00% 38 13 0.00% 39 26 0.00% 40 21 0.00% 41 28 0.00% 42 25 0.00% 43 17 0.00% 44 43 0.00% 45 43 0.00% 46 56 0.00% 47 84 0.00% 48 88 0.00% 49 88 0.00% 50 120 0.00% 51 103 0.00% 52 139 0.00% 53 132 0.00% 54 158 0.00% 55 164 0.00% 56 175 0.00% 57 201 0.00% 58 226 0.00% 59 271 0.00% 60 328 0.00% 61 390 0.00% 62 386 0.00% 63 462 0.00% 64 477 0.00% 65 574 0.01% 66 619 0.01% 67 665 0.01% 68 800 0.01% 69 845 0.01% 70 1019 0.01% 71 1082 0.01% 72 1368 0.01% 73 1561 0.01% 74 1691 0.02% 75 1930 0.02% 76 2424 0.02% 77 2593 0.02% 78 2507 0.02% 79 2679 0.02% 80 2896 0.03% 81 3320 0.03% 82 3669 0.03% 83 4169 0.04% 84 4990 0.04% 85 5870 0.05% 86 6029 0.05% 87 6569 0.06% 88 7262 0.06% 89 7362 0.07% 90 7676 0.07% 91 8082 0.07% 92 8522 0.08% 93 8986 0.08% 94 9754 0.09% 95 10552 0.09% 96 10844 0.10% 97 11110 0.10% 98 11485 0.10% 99 11633 0.10% 100 12510 0.11% 101 12442 0.11% 102 13212 0.12% 103 13299 0.12% 104 14459 0.13% 105 15292 0.14% 106 15794 0.14% 107 15935 0.14% 108 16156 0.14% 109 16707 0.15% 110 16804 0.15% 111 17212 0.15% 112 18013 0.16% 113 18611 0.17% 114 19028 0.17% 115 19711 0.18% 116 20294 0.18% 117 20539 0.18% 118 21170 0.19% 119 21375 0.19% 120 21600 0.19% 121 21634 0.19% 122 22320 0.20% 123 23412 0.21% 124 23672 0.21% 125 24326 0.22% 126 25224 0.22% 127 26496 0.24% 128 26728 0.24% 129 27450 0.24% 130 28340 0.25% 131 28694 0.25% 132 29799 0.26% 133 31355 0.28% 134 32686 0.29% 135 34321 0.30% 136 36244 0.32% 137 38515 0.34% 138 40912 0.36% 139 43677 0.39% 140 46584 0.41% 141 50894 0.45% 142 57554 0.51% 143 64302 0.57% 144 76075 0.68% 145 93513 0.83% 146 119117 1.06% 147 166205 1.48% 148 263117 2.34% 149 533459 4.74% 150 2676792 23.78% 151 6005495 53.35% 11256628 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.03 fanout-score-rank=22 prefix-density=0.25 prefix-fanout=4.2 sequence=GTTGCATCCTGGTATTGCTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=228.89 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=13.7 sequence=CCACCACCAAAACACAAATCCTAGGAAAAAAATTGAAGCCTAATAATATAGGACAAATCATCTTGAAAATACAAAAGAAACAATAGCGCCGTTTCCAATCACGTTTTGCCTCAAGTTCCATCTCTCAGTACCTGTACTGAGCAGGCTTGTATGGACCCTCGATTGGCACGTTGATGTAGTCAGCCTGGTCCTTGGAGAGCTTGGT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=2.6 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=43.47 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.2 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7169835 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:55:33 Started mapping on | Feb 11 21:55:33 Finished on | Feb 11 21:56:37 Mapping speed, Million of reads per hour | 633.19 Number of input reads | 11256628 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10702141 Uniquely mapped reads % | 95.07% Average mapped length | 293.58 Number of splices: Total | 8969129 Number of splices: Annotated (sjdb) | 8809622 Number of splices: GT/AG | 8840979 Number of splices: GC/AG | 99546 Number of splices: AT/AC | 7536 Number of splices: Non-canonical | 21068 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 189441 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 14873 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376099 376099 376099 N_multimapping 189441 189441 189441 N_noFeature 217101 10546473 263444 N_ambiguous 157686 864 47804 UnstrandedReadsAssigned:10327354 PositiveStrandReadsAssigned:154804 NegativeStrandReadsAssigned:10390893 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169835 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169835-trimmed-pair1.fastq SRR7169835-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,256,628 reads, 10,327,724 reads pseudoaligned [quant] estimated average fragment length: 253.117 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7169835.ke.tsv 34699 SRR7169835.se.tsv 87100 total ==> SRR7169835.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.88 150 7.51215 Potri.005G024800.1.v4.1 1035 782.883 20 2.25927 Potri.004G059700.1.v4.1 961 708.883 0 0 Potri.007G009000.2.v4.1 1416 1163.88 0 0 Potri.003G141000.2.v4.1 2943 2690.88 155.034 5.09527 Potri.016G087400.1.v4.1 270 78.3899 794.439 896.264 Potri.015G069301.1.v4.1 564 314.431 0 0 Potri.010G195200.1.v4.1 1773 1520.88 12.6058 0.733007 Potri.012G127500.1.v4.1 977 724.883 4729 576.948 ==> SRR7169835.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1211 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169835 completed mapping pipeline successfully