Starting /dee2/code/volunteer_pipeline.sh SRR7169836 current disk space = 3052646830080 free memory = 1253794496 SRR7169836 SRAfilesize 13013e780dd63df289fe56c76fc7f8f8 SRR7169836.sra SRR7169836.sra file validated SRR7169836 is paired end SRR7169836 is conventional basespace SRR7169836 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169836_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.92675 25.0 18.0 33.0 18.0 33.0 2 29.746 31.0 28.0 33.0 27.0 33.0 3 30.92875 31.0 30.0 33.0 28.0 33.0 4 31.139 33.0 31.0 33.0 29.0 33.0 5 32.3055 33.0 33.0 33.0 31.0 33.0 6 36.66775 38.0 37.0 38.0 34.0 38.0 7 37.26475 38.0 38.0 38.0 36.0 38.0 8 37.5285 38.0 38.0 38.0 37.0 38.0 9 36.7215 38.0 38.0 38.0 35.0 38.0 10-14 37.54905000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.375 38.0 38.0 38.0 37.4 38.0 20-24 37.37065 38.0 38.0 38.0 36.8 38.0 25-29 37.545049999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.503 38.0 38.0 38.0 37.8 38.0 35-39 37.46145 38.0 38.0 38.0 37.2 38.0 40-44 37.2949 38.0 38.0 38.0 36.8 38.0 45-49 37.4427 38.0 38.0 38.0 37.0 38.0 50-54 37.420500000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.26610000000001 38.0 38.0 38.0 36.4 38.0 60-64 37.17 38.0 38.0 38.0 36.0 38.0 65-69 37.0784 38.0 38.0 38.0 36.0 38.0 70-74 37.0223 38.0 38.0 38.0 36.0 38.0 75-79 36.94855 38.0 38.0 38.0 35.6 38.0 80-84 36.7156 38.0 37.8 38.0 35.0 38.0 85-89 36.17405 38.0 37.0 38.0 33.2 38.0 90-94 36.5 38.0 38.0 38.0 34.0 38.0 95-99 36.4458 38.0 38.0 38.0 34.0 38.0 100-104 36.172250000000005 38.0 37.2 38.0 33.4 38.0 105-109 35.0844 38.0 35.4 38.0 26.4 38.0 110-114 35.0942 38.0 35.6 38.0 26.4 38.0 115-119 35.47705 38.0 35.8 38.0 30.0 38.0 120-124 35.324400000000004 38.0 35.8 38.0 29.4 38.0 125-129 33.59905 37.4 31.8 38.0 22.6 38.0 130-134 33.86345 37.8 33.8 38.0 23.4 38.0 135-139 34.174 38.0 33.6 38.0 25.2 38.0 140-144 33.0778 38.0 32.4 38.0 20.2 38.0 145-149 31.740949999999998 36.4 31.4 38.0 13.2 38.0 150-151 27.4605 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 5.0 18 1.0 19 2.0 20 5.0 21 5.0 22 3.0 23 6.0 24 8.0 25 9.0 26 11.0 27 19.0 28 20.0 29 40.0 30 37.0 31 69.0 32 115.0 33 161.0 34 252.0 35 499.0 36 1337.0 37 1391.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 12.4 11.325000000000001 38.15 2 21.46073036518259 15.632816408204103 33.291645822911455 29.61480740370185 3 19.675 21.7 27.250000000000004 31.374999999999996 4 22.45 27.775 22.575 27.200000000000003 5 21.8 31.574999999999996 25.55 21.075 6 20.674999999999997 34.175 25.474999999999998 19.675 7 14.625 26.625 40.125 18.625 8 19.225 27.1 29.125 24.55 9 17.125 24.175 33.725 24.975 10-14 19.955000000000002 29.439999999999998 27.115000000000002 23.49 15-19 19.509999999999998 29.2 27.694999999999997 23.595 20-24 19.62 28.935 27.595 23.849999999999998 25-29 19.975 28.794999999999998 27.295 23.935000000000002 30-34 20.19 28.560000000000002 27.589999999999996 23.66 35-39 19.71 28.62 27.839999999999996 23.830000000000002 40-44 20.22 29.21 27.095000000000002 23.474999999999998 45-49 20.18 28.01 28.04 23.77 50-54 20.5 28.860000000000003 26.729999999999997 23.91 55-59 20.025000000000002 28.465 27.68 23.830000000000002 60-64 19.965 28.655 27.18 24.2 65-69 19.34 28.27 27.87 24.52 70-74 20.055 28.055000000000003 27.93 23.96 75-79 20.13 28.18 27.435 24.255 80-84 20.43 28.265 26.97 24.335 85-89 19.845 28.54 27.155 24.46 90-94 20.105 29.005 27.245 23.645 95-99 19.939999999999998 27.525 28.15 24.385 100-104 20.535 28.46 27.055 23.95 105-109 20.18 28.355000000000004 27.325 24.14 110-114 20.895 28.38 26.655 24.07 115-119 20.549999999999997 28.02 27.534999999999997 23.895 120-124 20.5 28.144999999999996 27.334999999999997 24.02 125-129 20.62 28.075 27.73 23.575 130-134 20.785 28.26 27.150000000000002 23.805 135-139 20.105 27.955000000000002 27.555000000000003 24.385 140-144 20.544999999999998 27.810000000000002 27.55 24.095 145-149 20.91 27.875 27.229999999999997 23.985 150-151 21.15 27.3875 27.3625 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 2.0 24 4.5 25 6.0 26 5.5 27 6.5 28 13.0 29 13.5 30 23.0 31 27.5 32 28.0 33 41.0 34 53.5 35 76.0 36 91.5 37 102.0 38 115.0 39 147.0 40 178.5 41 201.0 42 236.0 43 251.0 44 261.5 45 268.5 46 262.0 47 250.0 48 224.0 49 210.5 50 188.0 51 156.5 52 135.0 53 106.0 54 87.0 55 66.0 56 37.5 57 26.5 58 22.0 59 16.5 60 14.0 61 8.5 62 6.5 63 5.5 64 3.0 65 3.5 66 6.0 67 4.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.3375000000000004 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTCA 10 0.006830828 145.0 3 TTTTCAA 10 0.006830828 145.0 4 TTTCAAC 10 0.006830828 145.0 5 >>END_MODULE SRR7169836 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169836_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1285 34.0 33.0 34.0 33.0 34.0 2 33.18125 34.0 33.0 34.0 33.0 34.0 3 33.232 34.0 33.0 34.0 33.0 34.0 4 33.22475 34.0 33.0 34.0 33.0 34.0 5 33.2435 34.0 33.0 34.0 33.0 34.0 6 37.2945 38.0 38.0 38.0 37.0 38.0 7 37.41625 38.0 38.0 38.0 38.0 38.0 8 37.19875 38.0 38.0 38.0 37.0 38.0 9 37.23875 38.0 38.0 38.0 37.0 38.0 10-14 37.1983 38.0 38.0 38.0 37.0 38.0 15-19 37.23425 38.0 38.0 38.0 37.0 38.0 20-24 37.21835 38.0 38.0 38.0 37.0 38.0 25-29 36.85825 38.0 38.0 38.0 36.0 38.0 30-34 37.20115 38.0 38.0 38.0 37.0 38.0 35-39 36.89874999999999 38.0 38.0 38.0 36.0 38.0 40-44 37.13405 38.0 38.0 38.0 37.0 38.0 45-49 36.74294999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.95855 38.0 38.0 38.0 36.2 38.0 55-59 36.99385 38.0 38.0 38.0 36.2 38.0 60-64 36.876349999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.90345 38.0 38.0 38.0 36.0 38.0 70-74 36.9082 38.0 38.0 38.0 36.0 38.0 75-79 36.9357 38.0 38.0 38.0 36.0 38.0 80-84 36.6978 38.0 38.0 38.0 35.4 38.0 85-89 36.59295000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.66835 38.0 38.0 38.0 35.0 38.0 95-99 36.5499 38.0 38.0 38.0 34.6 38.0 100-104 36.350300000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.31615 38.0 38.0 38.0 34.0 38.0 110-114 36.2957 38.0 38.0 38.0 34.0 38.0 115-119 36.1096 38.0 37.6 38.0 33.6 38.0 120-124 35.73785 38.0 37.0 38.0 32.0 38.0 125-129 35.13135 38.0 35.8 38.0 28.2 38.0 130-134 35.41145 38.0 36.0 38.0 30.8 38.0 135-139 34.033049999999996 38.0 34.0 38.0 22.4 38.0 140-144 33.62820000000001 38.0 33.0 38.0 21.8 38.0 145-149 32.78830000000001 38.0 32.6 38.0 16.6 38.0 150-151 28.802500000000002 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 2.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 3.0 19 7.0 20 10.0 21 3.0 22 8.0 23 13.0 24 8.0 25 16.0 26 13.0 27 30.0 28 35.0 29 16.0 30 52.0 31 51.0 32 70.0 33 74.0 34 155.0 35 295.0 36 743.0 37 2377.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75 22.125 15.725 24.4 2 27.68192048012003 27.656914228557138 27.831957989497376 16.829207301825456 3 22.73068267066767 28.68217054263566 29.75743935983996 18.829707426856714 4 23.080770192548137 34.68367091772943 23.455863965991497 18.779694923730933 5 24.656164041010253 36.48412103025757 21.705426356589147 17.154288572143038 6 21.475 37.15 22.875 18.5 7 21.099999999999998 22.5 37.675 18.725 8 24.075 24.8 25.575 25.55 9 21.025 26.3 29.175 23.5 10-14 23.995 28.955 25.965 21.085 15-19 23.44 27.68 27.47 21.41 20-24 23.31 28.345 27.544999999999998 20.8 25-29 23.635 28.565 26.939999999999998 20.86 30-34 23.145 28.845 27.284999999999997 20.724999999999998 35-39 23.7 27.97 27.195000000000004 21.135 40-44 23.095 28.04 27.87 20.995 45-49 23.59 28.315 27.1 20.995 50-54 23.62 29.054999999999996 26.55 20.775 55-59 24.2 28.27 27.275 20.255000000000003 60-64 23.599999999999998 28.610000000000003 27.27 20.52 65-69 23.86 27.834999999999997 27.52 20.785 70-74 24.325 28.18 26.924999999999997 20.57 75-79 23.48 27.67 27.794999999999998 21.055 80-84 23.905 27.785 27.79 20.52 85-89 23.630000000000003 27.66 27.355 21.355 90-94 23.66 27.785 27.43 21.125 95-99 24.4 27.98 27.265 20.355 100-104 23.965 27.87 27.400000000000002 20.765 105-109 23.805 28.315 27.125 20.755000000000003 110-114 24.5 26.924999999999997 27.634999999999998 20.94 115-119 24.265 27.38 27.205000000000002 21.15 120-124 23.96 27.88 27.41 20.75 125-129 24.57 27.765 27.11 20.555 130-134 24.425 27.200000000000003 27.375 21.0 135-139 24.425 27.765 27.04 20.77 140-144 24.25 28.28 27.01 20.46 145-149 24.39 27.815 27.87 19.925 150-151 25.275 26.937499999999996 27.700000000000003 20.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 3.0 28 2.0 29 3.5 30 9.0 31 12.0 32 15.5 33 28.0 34 40.5 35 44.0 36 61.5 37 84.5 38 117.0 39 162.0 40 204.5 41 243.5 42 261.5 43 287.5 44 308.5 45 289.5 46 269.0 47 265.5 48 241.0 49 204.5 50 185.0 51 153.0 52 118.0 53 103.5 54 77.0 55 51.0 56 37.0 57 30.5 58 27.5 59 13.5 60 6.5 61 5.5 62 6.5 63 7.0 64 5.0 65 2.5 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 1.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAGCA 10 0.006830828 145.0 145 ATCATTA 10 0.006830828 145.0 2 GGGATGA 10 0.006830828 145.0 4 >>END_MODULE Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631380 spots for SRR7169836.sra Written 631380 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra Read 631377 spots for SRR7169836.sra Written 631377 spots for SRR7169836.sra SRR ids: ['SRR7169836.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cw1m5uwp SRR7169836.sra spots: 12627543 blocks: [[1, 631377], [631378, 1262754], [1262755, 1894131], [1894132, 2525508], [2525509, 3156885], [3156886, 3788262], [3788263, 4419639], [4419640, 5051016], [5051017, 5682393], [5682394, 6313770], [6313771, 6945147], [6945148, 7576524], [7576525, 8207901], [8207902, 8839278], [8839279, 9470655], [9470656, 10102032], [10102033, 10733409], [10733410, 11364786], [11364787, 11996163], [11996164, 12627543]] SRR7169836 file size 4257359 SRR7169836 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169836 SRR7169836_1.fastq SRR7169836_2.fastq Input file: SRR7169836_1.fastq Paired file: SRR7169836_2.fastq trimmed: SRR7169836-trimmed-pair1.fastq, SRR7169836-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:57:03 2025 >> started Tue Feb 11 21:57:16 2025 >> done (13.442s) 12627543 read pairs processed; of these: 12159 ( 0.10%) short read pairs filtered out after trimming by size control 11332 ( 0.09%) empty read pairs filtered out after trimming by size control 12604052 (99.81%) read pairs available; of these: 5730315 (45.46%) trimmed read pairs available after processing 6873737 (54.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 1 0.00% 24 1 0.00% 25 3 0.00% 26 4 0.00% 27 5 0.00% 28 2 0.00% 29 0 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 4 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 6 0.00% 38 11 0.00% 39 2 0.00% 40 6 0.00% 41 10 0.00% 42 9 0.00% 43 14 0.00% 44 18 0.00% 45 17 0.00% 46 9 0.00% 47 14 0.00% 48 18 0.00% 49 24 0.00% 50 29 0.00% 51 35 0.00% 52 41 0.00% 53 37 0.00% 54 52 0.00% 55 60 0.00% 56 58 0.00% 57 61 0.00% 58 90 0.00% 59 93 0.00% 60 102 0.00% 61 147 0.00% 62 148 0.00% 63 188 0.00% 64 181 0.00% 65 206 0.00% 66 240 0.00% 67 254 0.00% 68 296 0.00% 69 345 0.00% 70 381 0.00% 71 534 0.00% 72 544 0.00% 73 598 0.00% 74 707 0.01% 75 792 0.01% 76 878 0.01% 77 1046 0.01% 78 1035 0.01% 79 1196 0.01% 80 1269 0.01% 81 1430 0.01% 82 1691 0.01% 83 1875 0.01% 84 2642 0.02% 85 3020 0.02% 86 3210 0.03% 87 3405 0.03% 88 3735 0.03% 89 3800 0.03% 90 4090 0.03% 91 4354 0.03% 92 4415 0.04% 93 4867 0.04% 94 5171 0.04% 95 5333 0.04% 96 5820 0.05% 97 5962 0.05% 98 5970 0.05% 99 6261 0.05% 100 6636 0.05% 101 6929 0.05% 102 7272 0.06% 103 7813 0.06% 104 8273 0.07% 105 8650 0.07% 106 8921 0.07% 107 9319 0.07% 108 9536 0.08% 109 9782 0.08% 110 10013 0.08% 111 10573 0.08% 112 11152 0.09% 113 11581 0.09% 114 12166 0.10% 115 12726 0.10% 116 13249 0.11% 117 13496 0.11% 118 14151 0.11% 119 14342 0.11% 120 14647 0.12% 121 15111 0.12% 122 15707 0.12% 123 16512 0.13% 124 17482 0.14% 125 18352 0.15% 126 19126 0.15% 127 20296 0.16% 128 20890 0.17% 129 21717 0.17% 130 22948 0.18% 131 24176 0.19% 132 25575 0.20% 133 27804 0.22% 134 29644 0.24% 135 32045 0.25% 136 34348 0.27% 137 37527 0.30% 138 41017 0.33% 139 44443 0.35% 140 48825 0.39% 141 55211 0.44% 142 63169 0.50% 143 74120 0.59% 144 89269 0.71% 145 112878 0.90% 146 147876 1.17% 147 208332 1.65% 148 332727 2.64% 149 668140 5.30% 150 3134914 24.87% 151 6873737 54.54% 12604052 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=8.68 fanout-score-rank=19 prefix-density=0.24 prefix-fanout=5.5 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=285.10 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=157.74 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=15.7 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7169836 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:58:03 Started mapping on | Feb 11 21:58:03 Finished on | Feb 11 21:59:09 Mapping speed, Million of reads per hour | 687.49 Number of input reads | 12604052 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11741763 Uniquely mapped reads % | 93.16% Average mapped length | 296.00 Number of splices: Total | 11141813 Number of splices: Annotated (sjdb) | 10958167 Number of splices: GT/AG | 10970763 Number of splices: GC/AG | 137766 Number of splices: AT/AC | 8330 Number of splices: Non-canonical | 24954 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231997 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 77535 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642895 642895 642895 N_multimapping 231997 231997 231997 N_noFeature 244491 11621869 288401 N_ambiguous 130252 683 53856 UnstrandedReadsAssigned:11367020 PositiveStrandReadsAssigned:119211 NegativeStrandReadsAssigned:11399506 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169836 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169836-trimmed-pair1.fastq SRR7169836-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,604,052 reads, 11,367,265 reads pseudoaligned [quant] estimated average fragment length: 295.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7169836.ke.tsv 34699 SRR7169836.se.tsv 87100 total ==> SRR7169836.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.97 262 12.6448 Potri.005G024800.1.v4.1 1035 740.971 43 4.82844 Potri.004G059700.1.v4.1 961 667.007 0 0 Potri.007G009000.2.v4.1 1416 1121.97 0 0 Potri.003G141000.2.v4.1 2943 2648.97 233 7.31844 Potri.016G087400.1.v4.1 270 71.1419 1048 1225.67 Potri.015G069301.1.v4.1 564 277.93 0 0 Potri.010G195200.1.v4.1 1773 1478.97 70 3.93802 Potri.012G127500.1.v4.1 977 682.99 5884 716.8 ==> SRR7169836.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1690 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169836 completed mapping pipeline successfully