Starting /dee2/code/volunteer_pipeline.sh SRR7169837 current disk space = 3052606742528 free memory = 1457198752 SRR7169837 SRAfilesize 515470f5bc3f1dffc51f95fa2d977bb3 SRR7169837.sra SRR7169837.sra file validated SRR7169837 is paired end SRR7169837 is conventional basespace SRR7169837 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.11175 32.0 25.0 33.0 18.0 34.0 2 30.9465 31.0 30.0 33.0 27.0 34.0 3 32.38025 33.0 33.0 33.0 31.0 34.0 4 32.88575 33.0 33.0 34.0 33.0 34.0 5 33.30275 34.0 33.0 34.0 33.0 34.0 6 37.0855 38.0 37.0 38.0 36.0 38.0 7 36.8155 38.0 38.0 38.0 35.0 38.0 8 37.42925 38.0 38.0 38.0 37.0 38.0 9 37.6175 38.0 38.0 38.0 38.0 38.0 10-14 37.667699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.659650000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.5558 38.0 38.0 38.0 37.8 38.0 25-29 37.63869999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5791 38.0 38.0 38.0 38.0 38.0 35-39 37.568549999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.467 38.0 38.0 38.0 37.8 38.0 45-49 37.54459999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.4162 38.0 38.0 38.0 37.2 38.0 55-59 37.31565 38.0 38.0 38.0 37.0 38.0 60-64 37.284000000000006 38.0 38.0 38.0 36.8 38.0 65-69 37.219899999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.182900000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.037400000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.96735 38.0 38.0 38.0 35.8 38.0 85-89 36.776050000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.4448 38.0 37.6 38.0 33.4 38.0 95-99 36.54475000000001 38.0 38.0 38.0 34.2 38.0 100-104 35.46545 38.0 36.4 38.0 29.2 38.0 105-109 36.210049999999995 38.0 37.2 38.0 33.6 38.0 110-114 36.1252 38.0 37.2 38.0 33.4 38.0 115-119 35.79449999999999 38.0 36.6 38.0 31.4 38.0 120-124 35.00565 38.0 35.4 38.0 26.4 38.0 125-129 35.42585 38.0 36.0 38.0 30.4 38.0 130-134 34.179050000000004 37.8 34.0 38.0 24.2 38.0 135-139 34.936099999999996 38.0 35.4 38.0 28.8 38.0 140-144 34.0239 38.0 34.6 38.0 23.6 38.0 145-149 32.6558 37.2 32.4 38.0 18.8 38.0 150-151 29.479374999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 4.0 19 1.0 20 4.0 21 8.0 22 3.0 23 8.0 24 11.0 25 8.0 26 10.0 27 13.0 28 18.0 29 30.0 30 33.0 31 39.0 32 69.0 33 100.0 34 189.0 35 371.0 36 1072.0 37 2002.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.875 11.200000000000001 9.9 35.025 2 23.325000000000003 13.8 34.475 28.4 3 19.8 20.65 28.325 31.225 4 22.325 27.474999999999998 25.025 25.174999999999997 5 22.725 32.475 25.25 19.55 6 19.925 34.449999999999996 25.575 20.05 7 14.899999999999999 25.5 42.275 17.325 8 18.099999999999998 25.324999999999996 31.275 25.3 9 17.0 24.425 34.75 23.825 10-14 20.47 29.425 27.095000000000002 23.01 15-19 20.395 29.304999999999996 27.195000000000004 23.105 20-24 20.66 28.555000000000003 27.61 23.175 25-29 20.665 28.560000000000002 27.529999999999998 23.244999999999997 30-34 20.365 29.25 27.310000000000002 23.075000000000003 35-39 20.86 28.975 27.12 23.044999999999998 40-44 20.03 28.765 28.38 22.825 45-49 20.135 29.060000000000002 26.950000000000003 23.855 50-54 20.625 28.63 27.62 23.125 55-59 20.385 28.73 27.384999999999998 23.5 60-64 20.465 28.765 27.779999999999998 22.99 65-69 20.3 28.32 27.334999999999997 24.044999999999998 70-74 20.4 28.645 27.47 23.485 75-79 20.375 28.58 27.595 23.45 80-84 20.755000000000003 28.565 27.51 23.169999999999998 85-89 20.695 28.725 27.544999999999998 23.035 90-94 20.515 28.904999999999998 26.845000000000002 23.735 95-99 20.330000000000002 28.54 27.73 23.400000000000002 100-104 20.565 28.055000000000003 27.41 23.97 105-109 20.315 28.665000000000003 27.465 23.555 110-114 21.785 28.04 26.724999999999998 23.45 115-119 20.905 28.865000000000002 26.805 23.425 120-124 20.9 29.37 26.85 22.88 125-129 20.57 28.16 27.435 23.835 130-134 20.805 28.439999999999998 27.485 23.27 135-139 20.61 28.410000000000004 27.365000000000002 23.615 140-144 20.91 27.900000000000002 27.57 23.62 145-149 20.86 28.57 27.05 23.52 150-151 21.212500000000002 28.225 27.212500000000002 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.5 24 1.5 25 3.5 26 7.5 27 10.0 28 10.5 29 16.0 30 22.0 31 27.0 32 37.5 33 48.5 34 52.5 35 65.0 36 80.5 37 94.0 38 134.5 39 167.0 40 179.0 41 200.0 42 230.0 43 265.5 44 275.5 45 254.0 46 245.5 47 256.5 48 255.0 49 223.0 50 185.0 51 152.5 52 121.0 53 94.0 54 70.5 55 54.0 56 43.0 57 28.5 58 18.5 59 14.5 60 8.5 61 8.0 62 7.0 63 5.0 64 5.0 65 4.0 66 2.5 67 2.0 68 1.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTTA 10 0.006830828 145.0 9 >>END_MODULE SRR7169837 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169837_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.193 34.0 33.0 34.0 33.0 34.0 2 33.3015 34.0 33.0 34.0 33.0 34.0 3 33.34375 34.0 33.0 34.0 33.0 34.0 4 33.27325 34.0 33.0 34.0 33.0 34.0 5 33.2695 34.0 33.0 34.0 33.0 34.0 6 37.38725 38.0 38.0 38.0 38.0 38.0 7 37.41075 38.0 38.0 38.0 38.0 38.0 8 37.425 38.0 38.0 38.0 38.0 38.0 9 37.47425 38.0 38.0 38.0 38.0 38.0 10-14 37.47315 38.0 38.0 38.0 38.0 38.0 15-19 37.429449999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.244150000000005 38.0 38.0 38.0 36.8 38.0 25-29 36.79705 38.0 37.8 38.0 35.0 38.0 30-34 36.42495 38.0 37.8 38.0 33.6 38.0 35-39 37.09590000000001 38.0 38.0 38.0 36.2 38.0 40-44 37.02515 38.0 38.0 38.0 35.8 38.0 45-49 36.987849999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.19365 38.0 38.0 38.0 36.8 38.0 55-59 37.2411 38.0 38.0 38.0 37.0 38.0 60-64 37.133500000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.10955 38.0 38.0 38.0 37.0 38.0 70-74 37.13695 38.0 38.0 38.0 37.0 38.0 75-79 37.1793 38.0 38.0 38.0 36.6 38.0 80-84 36.95555 38.0 38.0 38.0 36.0 38.0 85-89 36.901599999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.89845 38.0 38.0 38.0 36.0 38.0 95-99 36.736599999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.646950000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.63869999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.558749999999996 38.0 38.0 38.0 34.8 38.0 115-119 36.29415 38.0 37.8 38.0 34.2 38.0 120-124 36.03435 38.0 37.4 38.0 33.4 38.0 125-129 35.944849999999995 38.0 37.2 38.0 33.2 38.0 130-134 35.6904 38.0 36.6 38.0 32.2 38.0 135-139 35.27755 38.0 36.0 38.0 30.6 38.0 140-144 35.05115000000001 38.0 35.8 38.0 29.2 38.0 145-149 34.430600000000005 38.0 35.2 38.0 26.8 38.0 150-151 30.26925 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 3.0 14 3.0 15 4.0 16 1.0 17 2.0 18 8.0 19 2.0 20 5.0 21 2.0 22 8.0 23 5.0 24 12.0 25 9.0 26 13.0 27 18.0 28 24.0 29 28.0 30 18.0 31 34.0 32 72.0 33 85.0 34 104.0 35 262.0 36 562.0 37 2711.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.375 21.4 13.675 25.55 2 27.25681420355089 25.206301575393848 30.23255813953488 17.30432608152038 3 20.75 27.675 31.65 19.925 4 22.355588897224308 34.93373343335834 23.50587646911728 19.204801200300075 5 23.5 36.725 22.325 17.45 6 20.5 37.325 23.9 18.275 7 20.125 22.1 37.425000000000004 20.349999999999998 8 21.825 23.799999999999997 28.175 26.200000000000003 9 22.525000000000002 25.324999999999996 27.200000000000003 24.95 10-14 23.62 28.144999999999996 26.484999999999996 21.75 15-19 23.405 27.32 28.04 21.235 20-24 22.585 27.965 27.985 21.465 25-29 22.745 28.475 27.279999999999998 21.5 30-34 22.994999999999997 27.765 28.13 21.11 35-39 22.73 28.07 27.815 21.385 40-44 23.11 28.645 28.03 20.215 45-49 23.055 28.515 27.815 20.615 50-54 22.93 28.155 27.675 21.240000000000002 55-59 23.1 28.08 27.839999999999996 20.979999999999997 60-64 23.1 27.785 28.28 20.835 65-69 23.355 27.85 27.99 20.805 70-74 23.35 27.439999999999998 28.384999999999998 20.825 75-79 22.63 27.925 28.005000000000003 21.44 80-84 23.1 27.76 27.860000000000003 21.279999999999998 85-89 23.155 27.450000000000003 28.46 20.935000000000002 90-94 23.225 27.825 28.075 20.875 95-99 23.799999999999997 27.615000000000002 28.1 20.485 100-104 23.665 28.215 27.33 20.79 105-109 22.915 27.68 28.225 21.18 110-114 23.395 27.705000000000002 27.575 21.325 115-119 23.91 27.26 27.785 21.044999999999998 120-124 23.71 27.655 27.860000000000003 20.775 125-129 23.375 28.000000000000004 28.035 20.59 130-134 24.15 27.41 27.765 20.674999999999997 135-139 24.255 27.495000000000005 27.76 20.49 140-144 23.93 27.445000000000004 27.834999999999997 20.79 145-149 23.585 28.294999999999998 28.194999999999997 19.925 150-151 24.6 28.287499999999998 26.887499999999996 20.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 2.5 26 4.5 27 6.0 28 7.5 29 7.0 30 11.0 31 13.0 32 20.0 33 32.5 34 38.0 35 50.5 36 68.0 37 90.5 38 128.0 39 179.5 40 213.5 41 236.5 42 266.5 43 270.5 44 285.0 45 280.5 46 271.0 47 270.5 48 247.5 49 215.0 50 181.0 51 156.0 52 120.5 53 92.5 54 71.5 55 46.0 56 31.5 57 24.0 58 16.5 59 14.0 60 9.5 61 5.5 62 4.5 63 4.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.2125000000000004 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696485 spots for SRR7169837.sra Written 696485 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra Read 696476 spots for SRR7169837.sra Written 696476 spots for SRR7169837.sra SRR ids: ['SRR7169837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p3mds0gy SRR7169837.sra spots: 13929529 blocks: [[1, 696476], [696477, 1392952], [1392953, 2089428], [2089429, 2785904], [2785905, 3482380], [3482381, 4178856], [4178857, 4875332], [4875333, 5571808], [5571809, 6268284], [6268285, 6964760], [6964761, 7661236], [7661237, 8357712], [8357713, 9054188], [9054189, 9750664], [9750665, 10447140], [10447141, 11143616], [11143617, 11840092], [11840093, 12536568], [12536569, 13233044], [13233045, 13929529]] SRR7169837 file size 4698559 SRR7169837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169837 SRR7169837_1.fastq SRR7169837_2.fastq Input file: SRR7169837_1.fastq Paired file: SRR7169837_2.fastq trimmed: SRR7169837-trimmed-pair1.fastq, SRR7169837-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:45:24 2025 >> started Tue Feb 11 21:45:47 2025 >> done (23.117s) 13929529 read pairs processed; of these: 11846 ( 0.09%) short read pairs filtered out after trimming by size control 8276 ( 0.06%) empty read pairs filtered out after trimming by size control 13909407 (99.86%) read pairs available; of these: 5956960 (42.83%) trimmed read pairs available after processing 7952447 (57.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 7 0.00% 25 4 0.00% 26 4 0.00% 27 4 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 8 0.00% 32 10 0.00% 33 7 0.00% 34 12 0.00% 35 14 0.00% 36 8 0.00% 37 12 0.00% 38 15 0.00% 39 24 0.00% 40 28 0.00% 41 29 0.00% 42 27 0.00% 43 25 0.00% 44 22 0.00% 45 23 0.00% 46 35 0.00% 47 49 0.00% 48 58 0.00% 49 95 0.00% 50 96 0.00% 51 83 0.00% 52 110 0.00% 53 115 0.00% 54 112 0.00% 55 122 0.00% 56 142 0.00% 57 168 0.00% 58 216 0.00% 59 224 0.00% 60 284 0.00% 61 350 0.00% 62 373 0.00% 63 440 0.00% 64 471 0.00% 65 517 0.00% 66 531 0.00% 67 577 0.00% 68 693 0.00% 69 737 0.01% 70 888 0.01% 71 988 0.01% 72 1147 0.01% 73 1342 0.01% 74 1444 0.01% 75 1566 0.01% 76 1742 0.01% 77 1803 0.01% 78 1970 0.01% 79 2189 0.02% 80 2351 0.02% 81 2662 0.02% 82 3158 0.02% 83 3541 0.03% 84 4175 0.03% 85 4732 0.03% 86 4961 0.04% 87 5248 0.04% 88 5434 0.04% 89 5673 0.04% 90 6192 0.04% 91 6500 0.05% 92 7084 0.05% 93 7522 0.05% 94 7794 0.06% 95 8020 0.06% 96 8459 0.06% 97 8472 0.06% 98 8719 0.06% 99 8992 0.06% 100 9625 0.07% 101 9870 0.07% 102 10459 0.08% 103 11393 0.08% 104 11556 0.08% 105 11982 0.09% 106 12254 0.09% 107 12542 0.09% 108 12992 0.09% 109 13084 0.09% 110 13515 0.10% 111 13671 0.10% 112 14491 0.10% 113 15266 0.11% 114 15827 0.11% 115 16923 0.12% 116 16825 0.12% 117 17396 0.13% 118 17698 0.13% 119 17433 0.13% 120 18051 0.13% 121 18577 0.13% 122 19263 0.14% 123 20060 0.14% 124 21188 0.15% 125 22339 0.16% 126 22973 0.17% 127 23602 0.17% 128 24568 0.18% 129 25562 0.18% 130 26620 0.19% 131 27648 0.20% 132 29292 0.21% 133 31002 0.22% 134 33260 0.24% 135 35527 0.26% 136 37786 0.27% 137 40399 0.29% 138 44319 0.32% 139 47965 0.34% 140 52020 0.37% 141 57674 0.41% 142 65209 0.47% 143 74878 0.54% 144 89863 0.65% 145 110933 0.80% 146 143917 1.03% 147 196709 1.41% 148 310871 2.23% 149 638360 4.59% 150 3230041 23.22% 151 7952447 57.17% 13909407 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.16 sequence-density-rank=8 fanout-score=74.60 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=16.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=33 prefix-density=0.33 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.15 sequence-density-rank=11 fanout-score=41.07 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.6 sequence=TGTTGGTGGTGG SRR7169837 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:46:33 Started mapping on | Feb 11 21:46:33 Finished on | Feb 11 21:47:48 Mapping speed, Million of reads per hour | 667.65 Number of input reads | 13909407 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13007324 Uniquely mapped reads % | 93.51% Average mapped length | 295.21 Number of splices: Total | 12200517 Number of splices: Annotated (sjdb) | 12003452 Number of splices: GT/AG | 12030822 Number of splices: GC/AG | 135942 Number of splices: AT/AC | 8915 Number of splices: Non-canonical | 24838 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237609 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 29549 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.53% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 676104 676104 676104 N_multimapping 237609 237609 237609 N_noFeature 295810 12862221 357212 N_ambiguous 140804 864 56440 UnstrandedReadsAssigned:12570710 PositiveStrandReadsAssigned:144239 NegativeStrandReadsAssigned:12593672 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169837 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169837-trimmed-pair1.fastq SRR7169837-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,909,407 reads, 12,509,764 reads pseudoaligned [quant] estimated average fragment length: 287.087 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR7169837.ke.tsv 34699 SRR7169837.se.tsv 87100 total ==> SRR7169837.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.91 276 13.1387 Potri.005G024800.1.v4.1 1035 748.913 19 2.09166 Potri.004G059700.1.v4.1 961 674.949 5 0.610755 Potri.007G009000.2.v4.1 1416 1129.91 0 0 Potri.003G141000.2.v4.1 2943 2656.91 207.074 6.42563 Potri.016G087400.1.v4.1 270 75.7694 848 922.72 Potri.015G069301.1.v4.1 564 286.245 0 0 Potri.010G195200.1.v4.1 1773 1486.91 16 0.887161 Potri.012G127500.1.v4.1 977 690.943 3544 422.883 ==> SRR7169837.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1270 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169837 completed mapping pipeline successfully