Starting /dee2/code/volunteer_pipeline.sh SRR7169838 current disk space = 3052290433024 free memory = 1509903820 SRR7169838 SRAfilesize 0b4e8cfd92263847d70b526e86b5ad47 SRR7169838.sra SRR7169838.sra file validated SRR7169838 is paired end SRR7169838 is conventional basespace SRR7169838 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.86925 32.0 28.0 33.0 18.0 33.0 2 32.1735 33.0 33.0 33.0 30.0 33.0 3 32.2945 33.0 33.0 33.0 31.0 34.0 4 32.653 33.0 33.0 33.0 31.0 34.0 5 33.13875 33.0 33.0 34.0 33.0 34.0 6 36.869 38.0 37.0 38.0 35.0 38.0 7 37.21275 38.0 38.0 38.0 36.0 38.0 8 37.4775 38.0 38.0 38.0 37.0 38.0 9 37.5325 38.0 38.0 38.0 37.0 38.0 10-14 37.496849999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.475049999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.47855 38.0 38.0 38.0 37.2 38.0 25-29 37.519000000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.46635 38.0 38.0 38.0 37.4 38.0 35-39 37.39375 38.0 38.0 38.0 37.0 38.0 40-44 37.36025 38.0 38.0 38.0 37.0 38.0 45-49 37.367749999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.21900000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.13765 38.0 38.0 38.0 36.0 38.0 60-64 37.13985 38.0 38.0 38.0 36.0 38.0 65-69 37.0609 38.0 38.0 38.0 36.0 38.0 70-74 36.93465 38.0 38.0 38.0 35.8 38.0 75-79 36.92675 38.0 38.0 38.0 35.2 38.0 80-84 36.695350000000005 38.0 38.0 38.0 34.6 38.0 85-89 36.6753 38.0 38.0 38.0 34.2 38.0 90-94 36.6086 38.0 38.0 38.0 34.4 38.0 95-99 36.42465 38.0 37.6 38.0 34.0 38.0 100-104 36.1793 38.0 37.0 38.0 33.4 38.0 105-109 35.95185 38.0 37.0 38.0 32.2 38.0 110-114 35.800149999999995 38.0 37.0 38.0 31.8 38.0 115-119 35.7153 38.0 37.0 38.0 31.0 38.0 120-124 35.26765 38.0 36.0 38.0 28.8 38.0 125-129 34.79475 38.0 35.2 38.0 27.4 38.0 130-134 34.69285 38.0 35.0 38.0 27.4 38.0 135-139 34.5809 38.0 35.0 38.0 27.2 38.0 140-144 33.94175 38.0 35.0 38.0 22.8 38.0 145-149 33.5697 38.0 34.6 38.0 21.0 38.0 150-151 29.8125 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 4.0 17 1.0 18 2.0 19 5.0 20 2.0 21 5.0 22 6.0 23 9.0 24 12.0 25 13.0 26 18.0 27 20.0 28 24.0 29 35.0 30 38.0 31 50.0 32 90.0 33 103.0 34 188.0 35 316.0 36 812.0 37 2241.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.387055512918906 12.432847275518036 9.00486057815298 35.17523663341008 2 22.125 15.475 34.1 28.299999999999997 3 18.825 21.2 27.35 32.625 4 23.275000000000002 27.950000000000003 23.849999999999998 24.925 5 22.8 33.475 23.075000000000003 20.65 6 19.375 36.675000000000004 24.7 19.25 7 14.05 26.85 40.300000000000004 18.8 8 16.950000000000003 26.650000000000002 30.15 26.25 9 17.675 25.224999999999998 31.95 25.15 10-14 19.935 29.94 26.889999999999997 23.235 15-19 20.195 28.49 27.715 23.599999999999998 20-24 20.46 28.475 27.810000000000002 23.255 25-29 19.72 29.189999999999998 27.715 23.375 30-34 19.900000000000002 28.785 27.605 23.71 35-39 19.665 28.625 27.800000000000004 23.91 40-44 20.025000000000002 28.625 27.345000000000002 24.005000000000003 45-49 19.77 28.305000000000003 28.435 23.49 50-54 19.885 28.82 27.67 23.625 55-59 19.994999999999997 28.52 27.065 24.42 60-64 19.99 28.525 27.715 23.77 65-69 20.169999999999998 27.750000000000004 28.025 24.055 70-74 19.994999999999997 29.09 27.034999999999997 23.880000000000003 75-79 19.57 28.645 27.884999999999998 23.9 80-84 20.4 28.42 27.29 23.89 85-89 20.665 28.43 27.33 23.575 90-94 20.03 28.51 27.37 24.09 95-99 20.5 28.1 27.47 23.93 100-104 20.255000000000003 28.194999999999997 27.51 24.04 105-109 20.49 27.97 27.755000000000003 23.785 110-114 20.25 28.754999999999995 27.3 23.695 115-119 20.380000000000003 28.449999999999996 27.455000000000002 23.715 120-124 20.424999999999997 28.68 27.32 23.575 125-129 20.705000000000002 28.08 27.36 23.855 130-134 20.985 28.355000000000004 27.139999999999997 23.52 135-139 20.965 27.810000000000002 27.284999999999997 23.94 140-144 20.345 28.175 27.195000000000004 24.285 145-149 20.69 27.845 27.345000000000002 24.12 150-151 20.974999999999998 28.625 26.3625 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.0 25 2.0 26 4.0 27 5.5 28 11.0 29 14.0 30 18.0 31 24.0 32 29.5 33 43.5 34 58.0 35 73.5 36 77.5 37 105.5 38 135.0 39 156.0 40 175.5 41 192.0 42 232.0 43 270.0 44 285.5 45 265.5 46 262.5 47 273.0 48 252.0 49 212.5 50 186.0 51 165.0 52 120.5 53 89.0 54 66.5 55 45.5 56 40.0 57 31.5 58 21.0 59 13.0 60 10.0 61 7.0 62 6.5 63 4.5 64 2.5 65 3.0 66 2.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.225 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACAAA 10 0.006830828 145.0 1 >>END_MODULE SRR7169838 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169838_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.736 33.0 33.0 34.0 32.0 34.0 2 32.84825 34.0 33.0 34.0 32.0 34.0 3 32.9095 34.0 33.0 34.0 32.0 34.0 4 32.80675 34.0 33.0 34.0 32.0 34.0 5 32.85 34.0 33.0 34.0 32.0 34.0 6 37.03225 38.0 38.0 38.0 37.0 38.0 7 37.061 38.0 38.0 38.0 37.0 38.0 8 37.06225 38.0 38.0 38.0 37.0 38.0 9 37.026 38.0 38.0 38.0 37.0 38.0 10-14 37.0128 38.0 38.0 38.0 37.0 38.0 15-19 36.92875 38.0 38.0 38.0 37.0 38.0 20-24 36.93085 38.0 38.0 38.0 37.0 38.0 25-29 36.916199999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.86215 38.0 38.0 38.0 37.0 38.0 35-39 36.843149999999994 38.0 38.0 38.0 36.8 38.0 40-44 36.75935 38.0 38.0 38.0 36.2 38.0 45-49 36.77625 38.0 38.0 38.0 36.0 38.0 50-54 36.774350000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.691199999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.6214 38.0 38.0 38.0 35.8 38.0 65-69 36.52535 38.0 38.0 38.0 35.4 38.0 70-74 36.42535 38.0 38.0 38.0 35.2 38.0 75-79 36.4105 38.0 38.0 38.0 34.8 38.0 80-84 36.33965 38.0 38.0 38.0 34.8 38.0 85-89 36.2759 38.0 38.0 38.0 34.0 38.0 90-94 36.2187 38.0 38.0 38.0 34.2 38.0 95-99 36.1209 38.0 38.0 38.0 34.0 38.0 100-104 35.9634 38.0 38.0 38.0 34.0 38.0 105-109 35.817699999999995 38.0 38.0 38.0 33.2 38.0 110-114 35.674400000000006 38.0 38.0 38.0 33.0 38.0 115-119 35.48485 38.0 37.2 38.0 31.4 38.0 120-124 35.31765 38.0 37.0 38.0 31.0 38.0 125-129 35.0459 38.0 36.6 38.0 29.2 38.0 130-134 34.786150000000006 38.0 36.0 38.0 28.0 38.0 135-139 34.45595 38.0 35.6 38.0 26.0 38.0 140-144 33.95575 38.0 35.0 38.0 22.6 38.0 145-149 33.41924999999999 38.0 35.0 38.0 18.6 38.0 150-151 29.183 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 11.0 4 2.0 5 3.0 6 3.0 7 3.0 8 0.0 9 2.0 10 2.0 11 5.0 12 3.0 13 4.0 14 3.0 15 3.0 16 3.0 17 4.0 18 3.0 19 3.0 20 8.0 21 4.0 22 8.0 23 6.0 24 10.0 25 13.0 26 17.0 27 22.0 28 25.0 29 30.0 30 45.0 31 49.0 32 78.0 33 81.0 34 126.0 35 203.0 36 507.0 37 2681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.854891168376284 21.491118338754063 12.83462596947711 25.819364523392547 2 25.753768844221103 25.27638190954774 30.829145728643216 18.140703517587937 3 20.809248554913296 28.02211610957527 31.79190751445087 19.37672782106057 4 22.699849170437407 33.98692810457516 23.17747611865259 20.13574660633484 5 24.157868275515334 36.85268979386627 21.769733534439418 17.219708396178984 6 20.125628140703515 38.14070351758794 23.919597989949747 17.814070351758794 7 19.844260236121578 22.582265762371264 37.3775433308214 20.195930670685758 8 22.43154986184376 26.375282592313486 25.295151971866364 25.898015573976384 9 20.427135678391963 26.532663316582916 30.100502512562816 22.939698492462313 10-14 22.96292575102984 28.37837837837838 26.936602029538832 21.72209384105295 15-19 22.386335091685506 28.28937452901281 27.962823411203214 21.361466968098465 20-24 22.778196433057023 27.97287113790505 28.37980406932931 20.869128359708615 25-29 23.345892991710627 28.158754081888972 27.500627982918864 20.99472494348154 30-34 22.6525998492841 28.48530519969857 28.133634765134392 20.728460185882945 35-39 23.230344134639537 28.244159758854558 27.31474503893494 21.210751067570964 40-44 22.812923973669665 28.727199638209132 27.47600623084267 20.983870157278528 45-49 23.118279569892472 28.198171038086624 27.97206310923525 20.71148628278565 50-54 23.286432160804022 27.95979899497488 28.020100502512562 20.73366834170854 55-59 24.375659514597256 27.631777297623234 27.26998643284257 20.722576754936938 60-64 23.110932475884244 27.632636655948552 28.8133038585209 20.443127009646304 65-69 23.623115577889447 27.79899497487437 28.17085427135678 20.407035175879397 70-74 23.332830795517363 28.70998542640334 27.38831097040052 20.56887280767878 75-79 23.337856173677068 27.58430071862908 28.81049298959747 20.267350118096385 80-84 23.756156397627905 27.766609709518548 27.897276108151576 20.57995778470198 85-89 23.964616003216726 27.61861680739847 27.915158825894654 20.50160836349015 90-94 23.596522088757098 28.180127657435794 27.903704075991353 20.319646177815752 95-99 23.75973862779593 27.212867554661972 27.896456396079415 21.13093742146268 100-104 24.112976178510404 28.389787918383757 27.69122524876872 19.80601065433712 105-109 24.247298316159842 27.625031414928376 27.579793918069868 20.54787635084192 110-114 23.686723973256925 27.959583773186548 27.562459156487208 20.79123309706932 115-119 24.14417131654351 27.92942240989293 27.61775498919218 20.308651284371386 120-124 24.303670186023126 27.96882855706385 27.682252388134742 20.04524886877828 125-129 24.399195575666162 27.86827551533434 27.290095525389642 20.442433383609853 130-134 24.44064558298557 27.904872039821004 27.643420986474936 20.01106139071849 135-139 24.16289592760181 27.737556561085974 28.024132730015083 20.075414781297134 140-144 24.962292609351433 28.29059829059829 26.907993966817497 19.83911513323278 145-149 24.19549477071601 28.54987932421561 27.67497988736927 19.579646017699115 150-151 24.824032176973354 27.21216691804927 27.99145299145299 19.972347913524384 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 9.0 2 5.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 3.0 23 3.5 24 2.5 25 4.0 26 5.5 27 5.0 28 5.5 29 11.0 30 11.0 31 10.5 32 21.0 33 35.0 34 42.0 35 45.5 36 66.5 37 98.5 38 122.0 39 152.5 40 189.0 41 211.0 42 260.0 43 315.0 44 330.5 45 310.0 46 297.0 47 273.5 48 228.5 49 204.5 50 173.5 51 133.5 52 105.0 53 81.0 54 56.5 55 47.5 56 36.5 57 23.0 58 14.5 59 7.0 60 8.5 61 8.0 62 3.0 63 3.5 64 4.0 65 3.0 66 3.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.5 3 0.525 4 0.5499999999999999 5 0.5499999999999999 6 0.5 7 0.475 8 0.475 9 0.5 10-14 0.47000000000000003 15-19 0.475 20-24 0.475 25-29 0.475 30-34 0.475 35-39 0.475 40-44 0.49500000000000005 45-49 0.49 50-54 0.5 55-59 0.49500000000000005 60-64 0.48 65-69 0.5 70-74 0.505 75-79 0.505 80-84 0.51 85-89 0.52 90-94 0.515 95-99 0.525 100-104 0.51 105-109 0.525 110-114 0.5349999999999999 115-119 0.5349999999999999 120-124 0.5499999999999999 125-129 0.5499999999999999 130-134 0.555 135-139 0.5499999999999999 140-144 0.5499999999999999 145-149 0.5599999999999999 150-151 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52128999748048 98.75 2 0.327538422776518 0.65 3 0.10078105316200556 0.3 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02519526329050139 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.225 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.15 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702693 spots for SRR7169838.sra Written 702693 spots for SRR7169838.sra Read 702698 spots for SRR7169838.sra Written 702698 spots for SRR7169838.sra SRR ids: ['SRR7169838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7fayszef SRR7169838.sra spots: 14053865 blocks: [[1, 702693], [702694, 1405386], [1405387, 2108079], [2108080, 2810772], [2810773, 3513465], [3513466, 4216158], [4216159, 4918851], [4918852, 5621544], [5621545, 6324237], [6324238, 7026930], [7026931, 7729623], [7729624, 8432316], [8432317, 9135009], [9135010, 9837702], [9837703, 10540395], [10540396, 11243088], [11243089, 11945781], [11945782, 12648474], [12648475, 13351167], [13351168, 14053865]] SRR7169838 file size 4740693 SRR7169838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169838 SRR7169838_1.fastq SRR7169838_2.fastq Input file: SRR7169838_1.fastq Paired file: SRR7169838_2.fastq trimmed: SRR7169838-trimmed-pair1.fastq, SRR7169838-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:24:04 2025 >> started Tue Feb 11 22:24:18 2025 >> done (14.317s) 14053865 read pairs processed; of these: 31988 ( 0.23%) short read pairs filtered out after trimming by size control 58222 ( 0.41%) empty read pairs filtered out after trimming by size control 13963655 (99.36%) read pairs available; of these: 5826962 (41.73%) trimmed read pairs available after processing 8136693 (58.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 7 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 3 0.00% 30 8 0.00% 31 4 0.00% 32 5 0.00% 33 10 0.00% 34 4 0.00% 35 9 0.00% 36 11 0.00% 37 12 0.00% 38 13 0.00% 39 20 0.00% 40 17 0.00% 41 21 0.00% 42 26 0.00% 43 21 0.00% 44 21 0.00% 45 32 0.00% 46 43 0.00% 47 46 0.00% 48 52 0.00% 49 56 0.00% 50 62 0.00% 51 89 0.00% 52 89 0.00% 53 82 0.00% 54 101 0.00% 55 103 0.00% 56 101 0.00% 57 135 0.00% 58 165 0.00% 59 194 0.00% 60 225 0.00% 61 260 0.00% 62 337 0.00% 63 320 0.00% 64 378 0.00% 65 399 0.00% 66 455 0.00% 67 553 0.00% 68 559 0.00% 69 614 0.00% 70 842 0.01% 71 932 0.01% 72 1040 0.01% 73 1205 0.01% 74 1245 0.01% 75 1452 0.01% 76 1547 0.01% 77 1686 0.01% 78 1875 0.01% 79 2114 0.02% 80 2277 0.02% 81 2633 0.02% 82 2927 0.02% 83 3309 0.02% 84 4443 0.03% 85 5199 0.04% 86 5351 0.04% 87 5545 0.04% 88 5757 0.04% 89 5955 0.04% 90 6392 0.05% 91 6775 0.05% 92 7135 0.05% 93 7708 0.06% 94 7882 0.06% 95 8283 0.06% 96 8551 0.06% 97 8756 0.06% 98 9145 0.07% 99 9343 0.07% 100 9867 0.07% 101 10069 0.07% 102 10863 0.08% 103 11040 0.08% 104 11531 0.08% 105 12403 0.09% 106 12518 0.09% 107 13084 0.09% 108 13358 0.10% 109 13195 0.09% 110 13688 0.10% 111 14254 0.10% 112 14956 0.11% 113 15613 0.11% 114 16312 0.12% 115 16842 0.12% 116 17415 0.12% 117 18153 0.13% 118 18359 0.13% 119 18590 0.13% 120 19033 0.14% 121 19834 0.14% 122 20267 0.15% 123 21521 0.15% 124 22765 0.16% 125 23609 0.17% 126 24750 0.18% 127 25276 0.18% 128 26284 0.19% 129 26764 0.19% 130 28221 0.20% 131 29535 0.21% 132 31010 0.22% 133 32977 0.24% 134 35494 0.25% 135 37484 0.27% 136 39702 0.28% 137 42513 0.30% 138 45570 0.33% 139 49469 0.35% 140 53343 0.38% 141 60402 0.43% 142 67287 0.48% 143 76324 0.55% 144 89241 0.64% 145 108208 0.77% 146 137943 0.99% 147 188947 1.35% 148 292679 2.10% 149 628057 4.50% 150 3097340 22.18% 151 8136693 58.27% 13963655 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=8 fanout-score=104.90 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=20.8 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=39 prefix-density=0.34 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=264.13 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=29.1 sequence=AAGAAGAAGAAA SRR7169838 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:25:01 Started mapping on | Feb 11 22:25:02 Finished on | Feb 11 22:26:11 Mapping speed, Million of reads per hour | 728.54 Number of input reads | 13963655 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13189328 Uniquely mapped reads % | 94.45% Average mapped length | 295.14 Number of splices: Total | 12874292 Number of splices: Annotated (sjdb) | 12677209 Number of splices: GT/AG | 12686425 Number of splices: GC/AG | 151953 Number of splices: AT/AC | 9993 Number of splices: Non-canonical | 25921 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236730 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 15623 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 555009 555009 555009 N_multimapping 236730 236730 236730 N_noFeature 267518 13058836 326131 N_ambiguous 130282 897 57729 UnstrandedReadsAssigned:12791528 PositiveStrandReadsAssigned:129595 NegativeStrandReadsAssigned:12805468 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169838 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169838-trimmed-pair1.fastq SRR7169838-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,963,655 reads, 12,690,903 reads pseudoaligned [quant] estimated average fragment length: 290.396 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7169838.ke.tsv 34699 SRR7169838.se.tsv 87100 total ==> SRR7169838.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.6 309 14.9093 Potri.005G024800.1.v4.1 1035 745.604 53 5.92872 Potri.004G059700.1.v4.1 961 671.661 2 0.248355 Potri.007G009000.2.v4.1 1416 1126.6 0 0 Potri.003G141000.2.v4.1 2943 2653.6 259.034 8.14167 Potri.016G087400.1.v4.1 270 75.0466 1010 1122.49 Potri.015G069301.1.v4.1 564 285.698 0 0 Potri.010G195200.1.v4.1 1773 1483.6 39 2.1925 Potri.012G127500.1.v4.1 977 687.627 5118 620.784 ==> SRR7169838.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 802 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169838 completed mapping pipeline successfully