Starting /dee2/code/volunteer_pipeline.sh SRR7169839 current disk space = 3052279631872 free memory = 1490741080 SRR7169839 SRAfilesize 2ce5ce2522f6c8f78251415450e8c74c SRR7169839.sra SRR7169839.sra file validated SRR7169839 is paired end SRR7169839 is conventional basespace SRR7169839 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169839_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.7955 25.0 18.0 33.0 18.0 33.0 2 26.92525 27.0 25.0 31.0 18.0 33.0 3 29.81475 31.0 28.0 33.0 27.0 33.0 4 31.66075 33.0 31.0 33.0 29.0 33.0 5 32.477 33.0 33.0 33.0 31.0 33.0 6 36.68725 38.0 37.0 38.0 34.0 38.0 7 36.99125 38.0 37.0 38.0 35.0 38.0 8 37.33575 38.0 38.0 38.0 36.0 38.0 9 37.42725 38.0 38.0 38.0 37.0 38.0 10-14 37.563 38.0 38.0 38.0 37.6 38.0 15-19 37.5606 38.0 38.0 38.0 37.8 38.0 20-24 37.59635000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.561350000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.5192 38.0 38.0 38.0 37.6 38.0 35-39 37.538799999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.54825 38.0 38.0 38.0 37.6 38.0 45-49 37.49835 38.0 38.0 38.0 37.2 38.0 50-54 37.32325 38.0 38.0 38.0 37.0 38.0 55-59 37.2112 38.0 38.0 38.0 36.0 38.0 60-64 36.99135 38.0 38.0 38.0 35.8 38.0 65-69 36.483000000000004 38.0 37.6 38.0 33.4 38.0 70-74 36.85315 38.0 38.0 38.0 35.0 38.0 75-79 36.819399999999995 38.0 38.0 38.0 34.8 38.0 80-84 36.58 38.0 37.8 38.0 34.2 38.0 85-89 36.1126 38.0 36.8 38.0 32.2 38.0 90-94 36.25705 38.0 37.0 38.0 33.6 38.0 95-99 36.295100000000005 38.0 37.0 38.0 34.0 38.0 100-104 35.864 38.0 36.8 38.0 31.6 38.0 105-109 35.28535 38.0 36.0 38.0 28.6 38.0 110-114 35.19035 38.0 36.0 38.0 28.6 38.0 115-119 34.031949999999995 37.6 33.8 38.0 23.8 38.0 120-124 33.9687 38.0 33.6 38.0 23.2 38.0 125-129 32.00805 36.6 29.4 38.0 16.2 38.0 130-134 32.75405 37.2 32.0 38.0 19.8 38.0 135-139 32.66995000000001 37.8 32.0 38.0 16.6 38.0 140-144 31.5588 37.0 30.2 38.0 13.4 38.0 145-149 29.37235 35.8 27.2 38.0 4.0 38.0 150-151 23.657625000000003 31.0 10.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 3.0 18 3.0 19 4.0 20 2.0 21 7.0 22 3.0 23 12.0 24 14.0 25 20.0 26 21.0 27 27.0 28 31.0 29 49.0 30 50.0 31 82.0 32 154.0 33 204.0 34 358.0 35 672.0 36 1342.0 37 937.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.57124842370744 10.517023959646911 9.205548549810844 40.7061790668348 2 19.3 14.2 30.325000000000003 36.175000000000004 3 18.75 17.925 28.275 35.05 4 22.35 25.7 23.225 28.725 5 23.974999999999998 30.725 24.725 20.575 6 19.625 34.5 25.75 20.125 7 15.325 27.275 40.65 16.75 8 17.925 26.6 32.324999999999996 23.150000000000002 9 18.65 24.85 33.975 22.525000000000002 10-14 19.645000000000003 30.5 27.58 22.275 15-19 19.665 29.494999999999997 27.905 22.935 20-24 19.950000000000003 29.29 27.935 22.825 25-29 20.06 28.76 27.794999999999998 23.385 30-34 19.965 29.085 27.48 23.47 35-39 19.939999999999998 29.265 27.555000000000003 23.24 40-44 19.72 29.43 27.939999999999998 22.91 45-49 19.75 28.99 27.634999999999998 23.625 50-54 19.485 29.09 27.775 23.65 55-59 19.509999999999998 29.195 27.860000000000003 23.435 60-64 20.44 28.99 27.465 23.105 65-69 19.105 29.645 27.425 23.825 70-74 19.505 29.265 27.465 23.765 75-79 19.88 28.585 27.860000000000003 23.674999999999997 80-84 19.84 28.79 27.625 23.745 85-89 19.88 29.035 27.735 23.35 90-94 19.814999999999998 29.794999999999998 27.400000000000002 22.99 95-99 19.78 28.810000000000002 27.889999999999997 23.52 100-104 19.935 28.804999999999996 27.865000000000002 23.395 105-109 19.77 28.845 27.88 23.505000000000003 110-114 20.431777198958127 28.406131035864558 28.095572029653376 23.066519735523944 115-119 20.17640573318633 29.342487721760047 27.65861481407237 22.822491730981255 120-124 19.932889267291028 28.59217709220213 27.835929283317473 23.639004357189364 125-129 20.22730686426676 28.858959595453864 27.396985931006864 23.516747609272517 130-134 20.445 28.67 27.455000000000002 23.43 135-139 20.805 28.51 27.36 23.325000000000003 140-144 20.369999999999997 28.999999999999996 27.455000000000002 23.175 145-149 20.715 28.599999999999998 27.235 23.45 150-151 20.05 29.75 27.6125 22.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.0 23 1.5 24 3.0 25 2.5 26 3.5 27 7.5 28 9.5 29 11.0 30 14.5 31 21.0 32 37.5 33 49.0 34 60.5 35 77.5 36 93.5 37 110.0 38 129.0 39 170.5 40 194.0 41 214.5 42 252.5 43 283.0 44 299.5 45 292.5 46 288.5 47 279.5 48 249.5 49 218.0 50 158.5 51 111.5 52 99.0 53 74.5 54 49.0 55 32.5 56 27.0 57 21.0 58 16.0 59 12.0 60 6.5 61 3.5 62 3.0 63 2.5 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.18 115-119 0.22999999999999998 120-124 0.165 125-129 0.135 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.4749999999999996 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.0625 0.0 0.0 0.0 0.0 138-139 4.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169839 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169839_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.30875 34.0 33.0 34.0 33.0 34.0 2 33.412 34.0 33.0 34.0 33.0 34.0 3 33.42675 34.0 33.0 34.0 33.0 34.0 4 33.37425 34.0 33.0 34.0 33.0 34.0 5 33.35825 34.0 33.0 34.0 33.0 34.0 6 37.6315 38.0 38.0 38.0 38.0 38.0 7 37.5155 38.0 38.0 38.0 38.0 38.0 8 37.55125 38.0 38.0 38.0 38.0 38.0 9 37.487 38.0 38.0 38.0 38.0 38.0 10-14 37.0072 38.0 38.0 38.0 36.0 38.0 15-19 37.46745 38.0 38.0 38.0 37.8 38.0 20-24 37.31695 38.0 38.0 38.0 37.0 38.0 25-29 37.42655 38.0 38.0 38.0 37.8 38.0 30-34 37.47265 38.0 38.0 38.0 38.0 38.0 35-39 37.2008 38.0 38.0 38.0 36.6 38.0 40-44 37.3186 38.0 38.0 38.0 37.0 38.0 45-49 37.40345000000001 38.0 38.0 38.0 37.2 38.0 50-54 37.33795 38.0 38.0 38.0 37.0 38.0 55-59 37.29565 38.0 38.0 38.0 37.0 38.0 60-64 37.18405 38.0 38.0 38.0 36.8 38.0 65-69 36.71995 38.0 38.0 38.0 34.4 38.0 70-74 37.07190000000001 38.0 38.0 38.0 36.2 38.0 75-79 37.10855 38.0 38.0 38.0 36.0 38.0 80-84 36.92985 38.0 38.0 38.0 36.0 38.0 85-89 36.49475 38.0 37.8 38.0 33.8 38.0 90-94 36.605450000000005 38.0 37.8 38.0 34.4 38.0 95-99 36.642100000000006 38.0 38.0 38.0 34.6 38.0 100-104 35.1875 38.0 35.8 38.0 27.8 38.0 105-109 35.75215 38.0 36.6 38.0 31.0 38.0 110-114 35.76645 38.0 36.6 38.0 31.6 38.0 115-119 34.47565 38.0 34.8 38.0 23.4 38.0 120-124 34.671200000000006 38.0 35.0 38.0 26.6 38.0 125-129 33.3185 37.8 32.2 38.0 21.0 38.0 130-134 32.48610000000001 37.6 30.4 38.0 18.2 38.0 135-139 32.90365 38.0 33.0 38.0 18.4 38.0 140-144 32.32695 37.6 31.4 38.0 16.8 38.0 145-149 30.312350000000002 36.2 28.6 38.0 7.8 38.0 150-151 25.021749999999997 32.0 16.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 7.0 17 4.0 18 2.0 19 6.0 20 9.0 21 11.0 22 7.0 23 10.0 24 10.0 25 8.0 26 16.0 27 27.0 28 32.0 29 35.0 30 48.0 31 73.0 32 99.0 33 170.0 34 278.0 35 463.0 36 1046.0 37 1633.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 19.975 14.575 26.825 2 26.525 26.275 31.225 15.975 3 19.975 28.825 31.25 19.950000000000003 4 23.775 33.2 23.375 19.650000000000002 5 24.025 35.3 23.025000000000002 17.65 6 20.474999999999998 38.875 24.15 16.5 7 20.775 21.65 40.1 17.474999999999998 8 22.175 26.375 27.375 24.075 9 21.525 26.400000000000002 29.7 22.375 10-14 23.47 28.955 26.415 21.16 15-19 22.665 28.26 28.205000000000002 20.87 20-24 23.025000000000002 28.435 27.794999999999998 20.745 25-29 22.335 28.64 27.755000000000003 21.27 30-34 23.16 28.139999999999997 28.16 20.54 35-39 23.064999999999998 27.79 28.275 20.87 40-44 23.055 28.675 27.889999999999997 20.380000000000003 45-49 22.505 28.384999999999998 28.24 20.87 50-54 23.425 28.005000000000003 28.51 20.06 55-59 23.23 27.93 27.939999999999998 20.9 60-64 22.64 28.29 28.754999999999995 20.315 65-69 22.945 27.755000000000003 28.82 20.48 70-74 23.385 27.965 28.494999999999997 20.155 75-79 23.03 28.27 28.110000000000003 20.59 80-84 23.044999999999998 28.18 28.405 20.369999999999997 85-89 22.825 28.055000000000003 28.395 20.724999999999998 90-94 22.88 28.515 28.87 19.735 95-99 23.73 27.38 28.735 20.155 100-104 23.505000000000003 28.65 27.215 20.630000000000003 105-109 23.76 28.425 27.67 20.145 110-114 23.395 28.345 28.125 20.135 115-119 23.97 28.17 27.97 19.89 120-124 24.14 27.975 27.98 19.905 125-129 24.284570742445467 28.211927156293775 27.896738042825696 19.60676405843506 130-134 24.279999999999998 28.470000000000002 27.705000000000002 19.545 135-139 24.335 27.779999999999998 27.97 19.915 140-144 24.16 28.065 27.99 19.785 145-149 24.279999999999998 28.294999999999998 27.375 20.05 150-151 25.0375 28.499999999999996 27.2625 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.0 24 2.0 25 3.5 26 2.0 27 2.5 28 4.0 29 5.5 30 11.0 31 21.0 32 26.0 33 32.5 34 51.5 35 77.0 36 95.5 37 118.5 38 141.5 39 175.0 40 222.5 41 259.5 42 278.5 43 281.5 44 286.5 45 289.0 46 283.5 47 248.5 48 229.5 49 200.5 50 152.0 51 132.0 52 104.0 53 73.0 54 48.0 55 36.0 56 31.5 57 26.0 58 18.0 59 10.0 60 6.5 61 2.5 62 1.0 63 1.0 64 0.5 65 0.5 66 0.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.06 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14249684741489 98.275 2 0.832282471626734 1.6500000000000001 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6749999999999998 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.1 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra Read 641967 spots for SRR7169839.sra Written 641967 spots for SRR7169839.sra Read 641958 spots for SRR7169839.sra Written 641958 spots for SRR7169839.sra SRR ids: ['SRR7169839.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__3v1pqzt SRR7169839.sra spots: 12839169 blocks: [[1, 641958], [641959, 1283916], [1283917, 1925874], [1925875, 2567832], [2567833, 3209790], [3209791, 3851748], [3851749, 4493706], [4493707, 5135664], [5135665, 5777622], [5777623, 6419580], [6419581, 7061538], [7061539, 7703496], [7703497, 8345454], [8345455, 8987412], [8987413, 9629370], [9629371, 10271328], [10271329, 10913286], [10913287, 11555244], [11555245, 12197202], [12197203, 12839169]] SRR7169839 file size 4329072 SRR7169839 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169839 SRR7169839_1.fastq SRR7169839_2.fastq Input file: SRR7169839_1.fastq Paired file: SRR7169839_2.fastq trimmed: SRR7169839-trimmed-pair1.fastq, SRR7169839-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:27:14 2025 >> started Tue Feb 11 22:27:29 2025 >> done (14.813s) 12839169 read pairs processed; of these: 6804 ( 0.05%) short read pairs filtered out after trimming by size control 8142 ( 0.06%) empty read pairs filtered out after trimming by size control 12824223 (99.88%) read pairs available; of these: 6338625 (49.43%) trimmed read pairs available after processing 6485598 (50.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 4 0.00% 26 8 0.00% 27 4 0.00% 28 5 0.00% 29 3 0.00% 30 4 0.00% 31 5 0.00% 32 11 0.00% 33 10 0.00% 34 6 0.00% 35 4 0.00% 36 11 0.00% 37 16 0.00% 38 9 0.00% 39 12 0.00% 40 21 0.00% 41 17 0.00% 42 20 0.00% 43 32 0.00% 44 20 0.00% 45 28 0.00% 46 30 0.00% 47 40 0.00% 48 45 0.00% 49 60 0.00% 50 48 0.00% 51 71 0.00% 52 94 0.00% 53 81 0.00% 54 69 0.00% 55 112 0.00% 56 135 0.00% 57 110 0.00% 58 135 0.00% 59 174 0.00% 60 207 0.00% 61 251 0.00% 62 264 0.00% 63 347 0.00% 64 370 0.00% 65 399 0.00% 66 426 0.00% 67 540 0.00% 68 535 0.00% 69 626 0.00% 70 712 0.01% 71 859 0.01% 72 951 0.01% 73 1105 0.01% 74 1257 0.01% 75 1378 0.01% 76 1523 0.01% 77 1636 0.01% 78 1874 0.01% 79 2003 0.02% 80 2151 0.02% 81 2444 0.02% 82 2798 0.02% 83 3174 0.02% 84 3933 0.03% 85 4591 0.04% 86 4604 0.04% 87 4808 0.04% 88 5251 0.04% 89 5450 0.04% 90 5816 0.05% 91 6139 0.05% 92 6619 0.05% 93 6882 0.05% 94 7376 0.06% 95 7790 0.06% 96 8148 0.06% 97 8680 0.07% 98 8838 0.07% 99 9192 0.07% 100 9729 0.08% 101 10108 0.08% 102 10434 0.08% 103 11258 0.09% 104 11727 0.09% 105 12235 0.10% 106 12765 0.10% 107 12842 0.10% 108 13016 0.10% 109 13659 0.11% 110 14124 0.11% 111 14196 0.11% 112 14817 0.12% 113 15391 0.12% 114 16012 0.12% 115 16615 0.13% 116 17018 0.13% 117 17665 0.14% 118 18023 0.14% 119 18333 0.14% 120 18890 0.15% 121 19086 0.15% 122 20011 0.16% 123 20597 0.16% 124 21805 0.17% 125 22749 0.18% 126 23477 0.18% 127 24874 0.19% 128 25795 0.20% 129 26674 0.21% 130 27627 0.22% 131 28769 0.22% 132 30400 0.24% 133 32727 0.26% 134 35331 0.28% 135 37953 0.30% 136 40434 0.32% 137 43569 0.34% 138 47238 0.37% 139 51800 0.40% 140 56692 0.44% 141 64061 0.50% 142 71611 0.56% 143 82362 0.64% 144 98796 0.77% 145 121789 0.95% 146 158747 1.24% 147 222888 1.74% 148 355005 2.77% 149 726023 5.66% 150 3367459 26.26% 151 6485598 50.57% 12824223 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.7 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=320.59 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=177.22 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=16.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169839 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:28:15 Started mapping on | Feb 11 22:28:15 Finished on | Feb 11 22:29:23 Mapping speed, Million of reads per hour | 678.93 Number of input reads | 12824223 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12281407 Uniquely mapped reads % | 95.77% Average mapped length | 294.74 Number of splices: Total | 11688342 Number of splices: Annotated (sjdb) | 11495270 Number of splices: GT/AG | 11519226 Number of splices: GC/AG | 135616 Number of splices: AT/AC | 9283 Number of splices: Non-canonical | 24217 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206790 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 11529 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 344239 344239 344239 N_multimapping 206790 206790 206790 N_noFeature 311026 12150848 364398 N_ambiguous 132450 739 54787 UnstrandedReadsAssigned:11837931 PositiveStrandReadsAssigned:129820 NegativeStrandReadsAssigned:11862222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169839 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169839-trimmed-pair1.fastq SRR7169839-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,824,223 reads, 11,765,161 reads pseudoaligned [quant] estimated average fragment length: 269.841 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7169839.ke.tsv 34699 SRR7169839.se.tsv 87100 total ==> SRR7169839.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.16 241 13.062 Potri.005G024800.1.v4.1 1035 766.159 32 3.9596 Potri.004G059700.1.v4.1 961 692.177 1 0.136963 Potri.007G009000.2.v4.1 1416 1147.16 0 0 Potri.003G141000.2.v4.1 2943 2674.16 219.063 7.76608 Potri.016G087400.1.v4.1 270 76.2485 778 967.318 Potri.015G069301.1.v4.1 564 301.421 0 0 Potri.010G195200.1.v4.1 1773 1504.16 47 2.96227 Potri.012G127500.1.v4.1 977 708.171 4902 656.23 ==> SRR7169839.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1257 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169839 completed mapping pipeline successfully