Starting /dee2/code/volunteer_pipeline.sh SRR7169840 current disk space = 3052576346112 free memory = 1403975836 SRR7169840 SRAfilesize cf9db106a8a91d53051e33e27a64ca80 SRR7169840.sra SRR7169840.sra file validated SRR7169840 is paired end SRR7169840 is conventional basespace SRR7169840 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169840_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.68675 25.0 18.0 33.0 18.0 33.0 2 27.27225 29.0 25.0 31.0 18.0 33.0 3 30.63075 31.0 29.0 33.0 27.0 33.0 4 32.2485 33.0 33.0 33.0 31.0 33.0 5 32.64925 33.0 33.0 33.0 31.0 34.0 6 36.45075 38.0 37.0 38.0 34.0 38.0 7 37.06075 38.0 37.0 38.0 35.0 38.0 8 37.44925 38.0 38.0 38.0 37.0 38.0 9 37.518 38.0 38.0 38.0 37.0 38.0 10-14 37.618100000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.5963 38.0 38.0 38.0 37.8 38.0 20-24 37.6305 38.0 38.0 38.0 38.0 38.0 25-29 37.6222 38.0 38.0 38.0 38.0 38.0 30-34 37.560649999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.45265 38.0 38.0 38.0 37.4 38.0 40-44 37.52315 38.0 38.0 38.0 37.8 38.0 45-49 37.49185 38.0 38.0 38.0 37.4 38.0 50-54 37.39145 38.0 38.0 38.0 37.0 38.0 55-59 37.295049999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.243100000000005 38.0 38.0 38.0 36.4 38.0 65-69 37.193799999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.85 38.0 38.0 38.0 35.2 38.0 75-79 36.660399999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.6886 38.0 37.8 38.0 34.4 38.0 85-89 36.76405 38.0 38.0 38.0 35.0 38.0 90-94 36.6686 38.0 38.0 38.0 34.2 38.0 95-99 36.573899999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.2044 38.0 37.2 38.0 33.4 38.0 105-109 34.828250000000004 38.0 35.4 38.0 24.8 38.0 110-114 35.22705 38.0 35.6 38.0 27.0 38.0 115-119 35.610800000000005 38.0 36.2 38.0 31.0 38.0 120-124 35.44975 38.0 36.0 38.0 30.6 38.0 125-129 34.7697 38.0 35.0 38.0 27.2 38.0 130-134 34.353699999999996 38.0 34.2 38.0 25.0 38.0 135-139 33.151599999999995 37.8 32.6 38.0 19.2 38.0 140-144 32.658249999999995 37.6 32.0 38.0 16.2 38.0 145-149 31.006649999999997 36.0 30.4 38.0 10.6 38.0 150-151 26.2885 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 2.0 20 0.0 21 6.0 22 8.0 23 9.0 24 12.0 25 12.0 26 16.0 27 23.0 28 20.0 29 39.0 30 53.0 31 67.0 32 81.0 33 155.0 34 236.0 35 504.0 36 1264.0 37 1488.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.713713713713716 11.586586586586586 7.982982982982984 41.71671671671672 2 19.175 14.6 33.675 32.550000000000004 3 20.225 18.575 25.5 35.699999999999996 4 23.7 26.3 23.075000000000003 26.924999999999997 5 22.15 32.0 24.425 21.425 6 19.125 36.475 24.3 20.1 7 14.099999999999998 26.875 40.5 18.525 8 17.224999999999998 27.0 31.25 24.525 9 16.616616616616618 24.64964964964965 34.209209209209206 24.524524524524523 10-14 19.67 30.48 26.845000000000002 23.005 15-19 19.869999999999997 28.93 27.889999999999997 23.31 20-24 19.634999999999998 29.175 27.915 23.275000000000002 25-29 19.650000000000002 29.599999999999998 27.345000000000002 23.405 30-34 19.41 29.37 27.735 23.485 35-39 19.415 28.575 27.900000000000002 24.11 40-44 19.615 29.054999999999996 27.87 23.46 45-49 19.425 28.749999999999996 27.955000000000002 23.87 50-54 19.28 29.09 28.205000000000002 23.425 55-59 19.71 29.205 27.32 23.765 60-64 19.425 29.425 27.560000000000002 23.59 65-69 20.025000000000002 28.78 28.044999999999998 23.150000000000002 70-74 19.485 29.15 27.605 23.76 75-79 19.965 28.199999999999996 27.76 24.075 80-84 20.085 29.15 27.43 23.335 85-89 19.830000000000002 28.93 27.925 23.315 90-94 19.685 29.054999999999996 27.24 24.02 95-99 20.080000000000002 28.435 27.54 23.945 100-104 19.985 29.265 27.375 23.375 105-109 19.665 28.660000000000004 28.105000000000004 23.57 110-114 19.950000000000003 29.435 27.13 23.485 115-119 19.634999999999998 28.884999999999998 27.779999999999998 23.7 120-124 20.01200120012001 28.81288128812881 27.622762276227625 23.552355235523553 125-129 19.53976988494247 28.559279639819913 28.07403701850926 23.826913456728363 130-134 20.04 28.825 27.62 23.515 135-139 20.43 27.725 27.905 23.94 140-144 19.525000000000002 28.225 28.34 23.91 145-149 20.305 28.21 27.975 23.51 150-151 20.05 28.1625 28.287499999999998 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 1.5 26 2.0 27 5.5 28 8.0 29 10.5 30 18.5 31 26.5 32 32.0 33 39.0 34 60.5 35 84.0 36 105.5 37 116.0 38 130.5 39 164.0 40 186.5 41 214.5 42 240.0 43 290.0 44 302.0 45 274.0 46 267.0 47 255.0 48 246.5 49 217.0 50 170.0 51 134.5 52 101.0 53 72.5 54 60.0 55 45.5 56 29.5 57 24.0 58 20.5 59 10.0 60 5.5 61 7.0 62 5.0 63 1.0 64 0.5 65 1.5 66 1.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.1 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.05 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.35 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169840 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169840_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.131 34.0 33.0 34.0 33.0 34.0 2 33.306 34.0 33.0 34.0 33.0 34.0 3 33.30325 34.0 33.0 34.0 33.0 34.0 4 33.33 34.0 33.0 34.0 33.0 34.0 5 33.34 34.0 33.0 34.0 33.0 34.0 6 37.51525 38.0 38.0 38.0 38.0 38.0 7 37.52975 38.0 38.0 38.0 38.0 38.0 8 37.59925 38.0 38.0 38.0 38.0 38.0 9 37.529 38.0 38.0 38.0 38.0 38.0 10-14 37.496900000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.4468 38.0 38.0 38.0 37.8 38.0 20-24 37.153499999999994 38.0 38.0 38.0 36.6 38.0 25-29 37.355549999999994 38.0 38.0 38.0 37.4 38.0 30-34 37.2 38.0 38.0 38.0 37.2 38.0 35-39 37.401050000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.3661 38.0 38.0 38.0 37.8 38.0 45-49 37.1962 38.0 38.0 38.0 37.0 38.0 50-54 37.30705 38.0 38.0 38.0 37.4 38.0 55-59 37.33815 38.0 38.0 38.0 37.6 38.0 60-64 37.25045 38.0 38.0 38.0 37.0 38.0 65-69 37.19235 38.0 38.0 38.0 37.0 38.0 70-74 36.64915 38.0 37.8 38.0 34.2 38.0 75-79 36.70219999999999 38.0 38.0 38.0 35.2 38.0 80-84 37.1339 38.0 38.0 38.0 36.8 38.0 85-89 37.0185 38.0 38.0 38.0 36.2 38.0 90-94 37.063750000000006 38.0 38.0 38.0 36.4 38.0 95-99 37.0381 38.0 38.0 38.0 36.2 38.0 100-104 36.79285 38.0 38.0 38.0 35.8 38.0 105-109 36.6664 38.0 38.0 38.0 35.0 38.0 110-114 36.09495 38.0 37.2 38.0 32.8 38.0 115-119 36.4404 38.0 38.0 38.0 34.2 38.0 120-124 36.36014999999999 38.0 38.0 38.0 34.2 38.0 125-129 36.1262 38.0 37.8 38.0 33.4 38.0 130-134 35.749849999999995 38.0 37.2 38.0 31.4 38.0 135-139 35.47475 38.0 36.4 38.0 31.0 38.0 140-144 31.874599999999997 37.0 29.4 38.0 14.8 38.0 145-149 33.92015 38.0 34.6 38.0 26.0 38.0 150-151 29.472375 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 4.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 4.0 18 1.0 19 3.0 20 2.0 21 6.0 22 6.0 23 5.0 24 5.0 25 11.0 26 12.0 27 16.0 28 21.0 29 23.0 30 34.0 31 38.0 32 47.0 33 86.0 34 127.0 35 247.0 36 709.0 37 2581.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.7 21.7 12.55 27.05 2 25.531382845711427 26.056514128532132 32.03300825206302 16.379094773693424 3 20.080020005001252 27.881970492623154 32.03300825206302 20.005001250312578 4 23.655913978494624 33.4333583395849 24.15603900975244 18.754688672168044 5 25.431357839459867 36.30907726931733 21.655413853463365 16.60415103775944 6 20.95 38.85 23.275000000000002 16.925 7 20.705176294073517 22.48062015503876 38.93473368342086 17.879469867466867 8 20.7551887971993 26.406601650412604 29.057264316079017 23.78094523630908 9 21.625 25.874999999999996 29.475 23.025000000000002 10-14 22.936146807340364 29.651482574128707 26.706335316765838 20.706035301765088 15-19 22.555 28.804999999999996 27.765 20.875 20-24 22.921146057302867 28.841442072103607 27.49137456872844 20.746037301865094 25-29 22.375 29.270000000000003 27.425 20.93 30-34 22.884999999999998 28.675 28.044999999999998 20.395 35-39 22.67 28.33 28.349999999999998 20.65 40-44 23.27732773277328 28.027802780278027 28.597859785978596 20.097009700970098 45-49 22.869999999999997 27.875 27.595 21.66 50-54 23.141157057852894 28.621431071553577 27.67638381919096 20.56102805140257 55-59 23.380000000000003 28.470000000000002 27.894999999999996 20.255000000000003 60-64 22.785 28.444999999999997 28.465 20.305 65-69 23.31 28.255000000000003 27.800000000000004 20.635 70-74 23.494999999999997 28.095 28.125 20.285 75-79 23.06 28.625 27.950000000000003 20.365 80-84 23.44 28.694999999999997 27.72 20.145 85-89 23.549999999999997 27.765 28.73 19.955000000000002 90-94 23.494999999999997 27.505000000000003 28.775000000000002 20.225 95-99 23.365 28.485 28.1 20.05 100-104 23.78 28.16 27.97 20.09 105-109 23.307330733073307 28.38283828382838 28.16781678167817 20.142014201420142 110-114 23.77 28.315 27.884999999999998 20.03 115-119 23.49 28.265 27.894999999999996 20.349999999999998 120-124 23.425 28.194999999999997 28.585 19.794999999999998 125-129 23.49 28.325 27.860000000000003 20.325 130-134 24.185000000000002 28.000000000000004 27.715 20.1 135-139 24.455 28.134999999999998 27.96 19.45 140-144 24.099999999999998 28.01 27.615000000000002 20.275000000000002 145-149 24.465 28.215 28.04 19.28 150-151 24.5625 27.3 28.962500000000002 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.0 26 1.5 27 3.5 28 4.5 29 9.0 30 15.5 31 21.5 32 25.5 33 33.0 34 44.0 35 62.5 36 89.0 37 112.5 38 136.5 39 185.5 40 232.5 41 265.5 42 299.0 43 298.5 44 283.5 45 287.5 46 297.0 47 261.5 48 216.0 49 186.0 50 145.0 51 116.5 52 95.5 53 75.5 54 51.0 55 31.5 56 29.5 57 26.0 58 18.5 59 11.0 60 4.5 61 5.0 62 5.5 63 2.5 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.025 8 0.025 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8500000000000001 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535526 spots for SRR7169840.sra Written 535526 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra Read 535519 spots for SRR7169840.sra Written 535519 spots for SRR7169840.sra SRR ids: ['SRR7169840.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fy_ybd7j SRR7169840.sra spots: 10710387 blocks: [[1, 535519], [535520, 1071038], [1071039, 1606557], [1606558, 2142076], [2142077, 2677595], [2677596, 3213114], [3213115, 3748633], [3748634, 4284152], [4284153, 4819671], [4819672, 5355190], [5355191, 5890709], [5890710, 6426228], [6426229, 6961747], [6961748, 7497266], [7497267, 8032785], [8032786, 8568304], [8568305, 9103823], [9103824, 9639342], [9639343, 10174861], [10174862, 10710387]] SRR7169840 file size 3607698 SRR7169840 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169840 SRR7169840_1.fastq SRR7169840_2.fastq Input file: SRR7169840_1.fastq Paired file: SRR7169840_2.fastq trimmed: SRR7169840-trimmed-pair1.fastq, SRR7169840-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:51:53 2025 >> started Tue Feb 11 21:52:04 2025 >> done (11.789s) 10710387 read pairs processed; of these: 8453 ( 0.08%) short read pairs filtered out after trimming by size control 5561 ( 0.05%) empty read pairs filtered out after trimming by size control 10696373 (99.87%) read pairs available; of these: 5306182 (49.61%) trimmed read pairs available after processing 5390191 (50.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 1 0.00% 26 5 0.00% 27 0 0.00% 28 5 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 6 0.00% 36 5 0.00% 37 3 0.00% 38 8 0.00% 39 4 0.00% 40 11 0.00% 41 7 0.00% 42 4 0.00% 43 6 0.00% 44 6 0.00% 45 15 0.00% 46 8 0.00% 47 12 0.00% 48 11 0.00% 49 15 0.00% 50 22 0.00% 51 27 0.00% 52 29 0.00% 53 25 0.00% 54 28 0.00% 55 36 0.00% 56 30 0.00% 57 55 0.00% 58 47 0.00% 59 60 0.00% 60 67 0.00% 61 71 0.00% 62 84 0.00% 63 112 0.00% 64 114 0.00% 65 94 0.00% 66 148 0.00% 67 129 0.00% 68 175 0.00% 69 214 0.00% 70 215 0.00% 71 234 0.00% 72 319 0.00% 73 353 0.00% 74 378 0.00% 75 404 0.00% 76 449 0.00% 77 533 0.00% 78 582 0.01% 79 654 0.01% 80 773 0.01% 81 861 0.01% 82 1015 0.01% 83 1073 0.01% 84 1499 0.01% 85 1632 0.02% 86 1810 0.02% 87 1930 0.02% 88 2130 0.02% 89 2264 0.02% 90 2389 0.02% 91 2550 0.02% 92 2774 0.03% 93 3125 0.03% 94 3261 0.03% 95 3467 0.03% 96 3656 0.03% 97 3751 0.04% 98 4021 0.04% 99 4171 0.04% 100 4466 0.04% 101 4821 0.05% 102 5161 0.05% 103 5478 0.05% 104 6008 0.06% 105 6328 0.06% 106 6678 0.06% 107 6780 0.06% 108 7073 0.07% 109 7205 0.07% 110 7580 0.07% 111 7865 0.07% 112 8453 0.08% 113 8933 0.08% 114 9347 0.09% 115 10039 0.09% 116 10165 0.10% 117 10781 0.10% 118 11168 0.10% 119 11727 0.11% 120 11961 0.11% 121 12211 0.11% 122 13058 0.12% 123 13863 0.13% 124 14564 0.14% 125 15767 0.15% 126 16537 0.15% 127 17567 0.16% 128 18106 0.17% 129 19179 0.18% 130 20509 0.19% 131 21128 0.20% 132 22106 0.21% 133 24192 0.23% 134 25736 0.24% 135 27924 0.26% 136 30067 0.28% 137 32795 0.31% 138 36544 0.34% 139 40198 0.38% 140 44787 0.42% 141 52321 0.49% 142 61650 0.58% 143 80393 0.75% 144 86645 0.81% 145 112817 1.05% 146 141876 1.33% 147 204224 1.91% 148 339351 3.17% 149 681574 6.37% 150 2856476 26.71% 151 5390191 50.39% 10696373 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.7 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=227.65 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=34 prefix-density=0.37 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=132.12 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169840 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:52:46 Started mapping on | Feb 11 21:52:46 Finished on | Feb 11 21:53:50 Mapping speed, Million of reads per hour | 601.67 Number of input reads | 10696373 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10236518 Uniquely mapped reads % | 95.70% Average mapped length | 296.16 Number of splices: Total | 9857046 Number of splices: Annotated (sjdb) | 9694510 Number of splices: GT/AG | 9713284 Number of splices: GC/AG | 115002 Number of splices: AT/AC | 8273 Number of splices: Non-canonical | 20487 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166986 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 31348 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 299154 299154 299154 N_multimapping 166986 166986 166986 N_noFeature 238477 10120857 286981 N_ambiguous 109672 524 42148 UnstrandedReadsAssigned:9888369 PositiveStrandReadsAssigned:115137 NegativeStrandReadsAssigned:9907389 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169840 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169840-trimmed-pair1.fastq SRR7169840-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,696,373 reads, 9,826,964 reads pseudoaligned [quant] estimated average fragment length: 258.71 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7169840.ke.tsv 34699 SRR7169840.se.tsv 87100 total ==> SRR7169840.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.29 190 10.7926 Potri.005G024800.1.v4.1 1035 777.29 28 3.60188 Potri.004G059700.1.v4.1 961 703.328 2 0.284333 Potri.007G009000.2.v4.1 1416 1158.29 0 0 Potri.003G141000.2.v4.1 2943 2685.29 171.03 6.36849 Potri.016G087400.1.v4.1 270 69.462 848 1220.68 Potri.015G069301.1.v4.1 564 311.514 0 0 Potri.010G195200.1.v4.1 1773 1515.29 8 0.527897 Potri.012G127500.1.v4.1 977 719.303 3558 494.594 ==> SRR7169840.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1258 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169840 completed mapping pipeline successfully