Starting /dee2/code/volunteer_pipeline.sh SRR7169842 current disk space = 3052366024704 free memory = 1426615008 SRR7169842 SRAfilesize 7dd04fe3fae76872e953d2d85785a4ca SRR7169842.sra SRR7169842.sra file validated SRR7169842 is paired end SRR7169842 is conventional basespace SRR7169842 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169842_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.05175 28.0 18.0 33.0 18.0 33.0 2 24.67425 25.0 18.0 31.0 18.0 33.0 3 29.697 31.0 28.0 33.0 27.0 33.0 4 31.7205 33.0 31.0 33.0 29.0 33.0 5 32.46875 33.0 33.0 33.0 32.0 33.0 6 36.43925 38.0 37.0 38.0 34.0 38.0 7 36.876 38.0 37.0 38.0 35.0 38.0 8 37.2465 38.0 38.0 38.0 36.0 38.0 9 37.4425 38.0 38.0 38.0 37.0 38.0 10-14 37.51575 38.0 38.0 38.0 37.2 38.0 15-19 37.5721 38.0 38.0 38.0 37.8 38.0 20-24 37.6139 38.0 38.0 38.0 38.0 38.0 25-29 37.59165 38.0 38.0 38.0 38.0 38.0 30-34 37.54180000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.549 38.0 38.0 38.0 38.0 38.0 40-44 37.48735 38.0 38.0 38.0 37.6 38.0 45-49 37.462849999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.38315 38.0 38.0 38.0 37.0 38.0 55-59 37.3046 38.0 38.0 38.0 37.0 38.0 60-64 37.2916 38.0 38.0 38.0 37.0 38.0 65-69 37.2315 38.0 38.0 38.0 36.2 38.0 70-74 37.09305 38.0 38.0 38.0 36.0 38.0 75-79 37.0613 38.0 38.0 38.0 36.0 38.0 80-84 36.92805 38.0 38.0 38.0 36.0 38.0 85-89 36.82585 38.0 38.0 38.0 35.4 38.0 90-94 36.76055 38.0 38.0 38.0 35.0 38.0 95-99 36.58415000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.43925 38.0 38.0 38.0 34.0 38.0 105-109 36.166650000000004 38.0 37.6 38.0 33.6 38.0 110-114 36.018150000000006 38.0 37.2 38.0 33.2 38.0 115-119 35.927 38.0 37.0 38.0 33.0 38.0 120-124 35.622249999999994 38.0 37.0 38.0 31.0 38.0 125-129 35.20915 38.0 36.2 38.0 29.2 38.0 130-134 35.080200000000005 38.0 36.0 38.0 28.4 38.0 135-139 34.948299999999996 38.0 35.6 38.0 28.8 38.0 140-144 34.56945 38.0 35.0 38.0 27.0 38.0 145-149 34.1068 38.0 35.0 38.0 25.4 38.0 150-151 30.60875 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 2.0 17 1.0 18 2.0 19 5.0 20 1.0 21 1.0 22 9.0 23 7.0 24 6.0 25 13.0 26 16.0 27 20.0 28 25.0 29 30.0 30 43.0 31 44.0 32 74.0 33 104.0 34 163.0 35 277.0 36 765.0 37 2385.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0941475826972 10.966921119592875 9.05852417302799 38.88040712468193 2 22.6 12.975 31.05 33.375 3 18.9 17.875 26.5 36.725 4 22.975 26.974999999999998 23.425 26.625 5 22.925 30.075000000000003 24.099999999999998 22.900000000000002 6 19.7 35.949999999999996 23.150000000000002 21.2 7 14.674999999999999 28.299999999999997 39.65 17.375 8 18.125 28.349999999999998 29.75 23.775 9 17.325 25.624999999999996 33.475 23.575 10-14 19.98 30.659999999999997 27.13 22.23 15-19 20.075000000000003 29.205 27.105 23.615 20-24 20.369999999999997 28.835 27.35 23.445 25-29 19.805 29.565 27.165 23.465 30-34 19.1 29.57 27.55 23.78 35-39 19.994999999999997 29.09 26.745 24.169999999999998 40-44 20.07 28.735 27.435 23.76 45-49 19.885 28.835 27.200000000000003 24.08 50-54 20.380000000000003 29.054999999999996 27.11 23.455000000000002 55-59 20.085 28.444999999999997 27.435 24.035 60-64 20.175 29.299999999999997 26.66 23.865 65-69 20.075000000000003 28.965000000000003 27.02 23.94 70-74 20.23 29.025000000000002 26.665 24.08 75-79 20.685000000000002 28.485 26.895000000000003 23.935000000000002 80-84 20.54 28.884999999999998 27.055 23.52 85-89 20.18 29.054999999999996 27.224999999999998 23.54 90-94 20.785 28.57 26.8 23.845 95-99 20.665 28.88 26.895000000000003 23.56 100-104 20.669999999999998 28.64 27.005000000000003 23.685000000000002 105-109 21.145 28.01 26.889999999999997 23.955000000000002 110-114 20.225 28.595 27.08 24.099999999999998 115-119 20.925 28.925 26.68 23.47 120-124 20.575 29.03 26.529999999999998 23.865 125-129 20.43 28.410000000000004 27.145000000000003 24.015 130-134 21.145 27.944999999999997 27.165 23.745 135-139 20.845 28.084999999999997 27.060000000000002 24.01 140-144 21.32 27.875 27.015 23.79 145-149 20.8 27.894999999999996 27.04 24.265 150-151 20.4375 28.349999999999998 26.525 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.5 24 1.5 25 2.0 26 5.5 27 7.0 28 9.0 29 12.5 30 16.0 31 26.5 32 38.5 33 42.5 34 47.0 35 65.0 36 83.0 37 109.5 38 138.5 39 155.0 40 171.0 41 196.0 42 224.0 43 248.5 44 268.0 45 285.5 46 280.0 47 250.5 48 236.0 49 214.0 50 183.5 51 156.0 52 124.5 53 100.5 54 76.5 55 51.5 56 34.5 57 26.0 58 22.0 59 17.0 60 15.0 61 11.0 62 7.5 63 9.0 64 10.5 65 5.5 66 1.0 67 2.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.05 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.85 0.0 0.0 0.0 0.0 138-139 5.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCATG 10 0.006830828 145.0 2 >>END_MODULE SRR7169842 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169842_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8125 33.0 33.0 34.0 32.0 34.0 2 32.88175 34.0 33.0 34.0 32.0 34.0 3 32.8935 34.0 33.0 34.0 32.0 34.0 4 32.81675 34.0 33.0 34.0 32.0 34.0 5 32.80875 34.0 33.0 34.0 32.0 34.0 6 37.033 38.0 38.0 38.0 37.0 38.0 7 37.051 38.0 38.0 38.0 37.0 38.0 8 37.086 38.0 38.0 38.0 37.0 38.0 9 36.99075 38.0 38.0 38.0 37.0 38.0 10-14 37.0323 38.0 38.0 38.0 37.0 38.0 15-19 36.996249999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.9942 38.0 38.0 38.0 37.0 38.0 25-29 36.919599999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.93755 38.0 38.0 38.0 36.8 38.0 35-39 36.9022 38.0 38.0 38.0 37.0 38.0 40-44 36.82625 38.0 38.0 38.0 36.6 38.0 45-49 36.85 38.0 38.0 38.0 37.0 38.0 50-54 36.798899999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.76285 38.0 38.0 38.0 36.0 38.0 60-64 36.712450000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.5511 38.0 38.0 38.0 35.6 38.0 70-74 36.477 38.0 38.0 38.0 35.4 38.0 75-79 36.3861 38.0 38.0 38.0 34.8 38.0 80-84 36.38955 38.0 38.0 38.0 34.6 38.0 85-89 36.3378 38.0 38.0 38.0 34.8 38.0 90-94 36.201 38.0 38.0 38.0 34.0 38.0 95-99 36.162049999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.1532 38.0 38.0 38.0 34.0 38.0 105-109 35.9243 38.0 38.0 38.0 33.6 38.0 110-114 35.77755 38.0 38.0 38.0 33.0 38.0 115-119 35.5936 38.0 37.6 38.0 32.2 38.0 120-124 35.477850000000004 38.0 37.4 38.0 31.2 38.0 125-129 35.162850000000006 38.0 36.6 38.0 30.0 38.0 130-134 34.94100000000001 38.0 36.0 38.0 28.2 38.0 135-139 34.6039 38.0 36.0 38.0 27.0 38.0 140-144 34.25065 38.0 35.4 38.0 25.0 38.0 145-149 33.618449999999996 38.0 35.0 38.0 20.4 38.0 150-151 29.57625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 10.0 4 2.0 5 2.0 6 0.0 7 2.0 8 1.0 9 2.0 10 4.0 11 0.0 12 1.0 13 5.0 14 2.0 15 7.0 16 3.0 17 1.0 18 6.0 19 3.0 20 5.0 21 5.0 22 10.0 23 12.0 24 16.0 25 15.0 26 20.0 27 20.0 28 20.0 29 36.0 30 33.0 31 51.0 32 64.0 33 83.0 34 105.0 35 199.0 36 494.0 37 2733.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.08808808808809 22.47247247247247 14.28928928928929 25.150150150150154 2 26.31975867269985 27.124183006535947 27.828054298642535 18.72800402212167 3 21.141277023629964 28.00402212166918 31.447963800904976 19.40673705379588 4 24.245472837022135 32.796780684104625 24.522132796780685 18.435613682092555 5 25.05030181086519 35.06036217303823 22.359154929577464 17.530181086519114 6 22.22222222222222 36.37506284565108 23.629964806435392 17.772750125691303 7 20.497362471740768 23.587038432554635 36.49836724441095 19.417231851293646 8 22.199899547965845 24.686087393269716 28.076343545956806 25.037669512807636 9 22.669012314651923 25.735109323950738 27.921588338778587 23.67429002261875 10-14 23.397629093831625 28.676913803496085 26.522001205545507 21.403455897126783 15-19 23.2071963415247 27.931051811648828 27.58430071862908 21.2774511281974 20-24 23.495126117978092 27.725856697819314 27.464576424479954 21.314440759722643 25-29 23.548922056384743 28.232574501231216 26.991306095783706 21.22719734660033 30-34 23.350585397718707 28.119189990452742 27.888045826842873 20.642178784985678 35-39 23.064937675914756 27.734217933252914 27.764374748693204 21.436469642139123 40-44 23.132602794812506 28.08887101638685 27.84256559766764 20.935960591133004 45-49 23.968230030664053 27.33624893178505 28.01487960589152 20.680641431659378 50-54 23.34104162477378 27.694550573094713 27.91071787653328 21.05368992559823 55-59 23.54597094455336 28.0349871814206 27.517217111546778 20.901824762479265 60-64 23.819095477386934 27.854271356783922 27.236180904522612 21.090452261306535 65-69 24.147984316879462 27.772192620890724 27.32482155423746 20.75500150799236 70-74 23.70035193564605 27.23479135243841 27.772750125691303 21.292106586224232 75-79 23.423831070889893 27.943690296631473 28.12971342383107 20.50276520864756 80-84 23.423831070889893 27.214680744092508 27.943690296631473 21.417797888386122 85-89 24.167923579688285 27.174459527400703 28.024132730015083 20.633484162895925 90-94 23.629964806435392 27.18954248366013 28.250377073906485 20.93011563599799 95-99 24.28600160901046 27.323008849557525 27.353177795655668 21.037811745776345 100-104 23.931623931623932 27.425842131724487 28.15485168426345 20.487682252388133 105-109 24.467015285599356 27.690064360418344 27.34312148028962 20.49979887369268 110-114 23.974255832662912 27.302896218825424 28.127514078841514 20.595333869670153 115-119 24.77622447953334 27.53193201247108 27.763250528009653 19.928592979985922 120-124 24.861656102223563 27.834792232618977 27.452460006036826 19.851091659120637 125-129 24.30188679245283 27.82389937106918 27.69811320754717 20.17610062893082 130-134 24.516908212560388 27.551328502415455 27.65197262479871 20.279790660225444 135-139 24.602455716586153 27.82306763285024 27.687198067632853 19.887278582930755 140-144 24.99748313701802 27.952280277861675 27.066344508204978 19.983892076915332 145-149 24.89680861773885 27.333131984294774 27.5848182824927 20.185241115473673 150-151 24.984274751541076 27.75191848031199 27.185809535790668 20.07799723235627 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 8.0 2 4.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.0 27 3.5 28 3.0 29 6.0 30 10.0 31 17.5 32 21.0 33 20.5 34 29.0 35 45.0 36 65.5 37 100.0 38 131.5 39 150.0 40 181.5 41 225.5 42 265.5 43 280.5 44 279.0 45 285.5 46 283.5 47 261.5 48 241.0 49 222.5 50 180.5 51 140.0 52 119.0 53 103.0 54 80.5 55 59.5 56 41.5 57 27.5 58 23.0 59 18.0 60 14.0 61 7.0 62 5.5 63 6.5 64 3.5 65 3.0 66 4.0 67 2.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.5499999999999999 3 0.5499999999999999 4 0.6 5 0.6 6 0.5499999999999999 7 0.475 8 0.44999999999999996 9 0.525 10-14 0.45999999999999996 15-19 0.505 20-24 0.49 25-29 0.505 30-34 0.49500000000000005 35-39 0.52 40-44 0.53 45-49 0.5349999999999999 50-54 0.54 55-59 0.5349999999999999 60-64 0.5 65-69 0.53 70-74 0.5499999999999999 75-79 0.5499999999999999 80-84 0.5499999999999999 85-89 0.5499999999999999 90-94 0.5499999999999999 95-99 0.5599999999999999 100-104 0.5499999999999999 105-109 0.5599999999999999 110-114 0.5599999999999999 115-119 0.5700000000000001 120-124 0.61 125-129 0.625 130-134 0.64 135-139 0.64 140-144 0.67 145-149 0.67 150-151 0.6375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.42821158690176325 0.8500000000000001 3 0.05037783375314861 0.15 4 0.07556675062972291 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.4625000000000004 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.85 0.0 0.0 0.0 0.0 138-139 5.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACAA 10 0.006824188 145.0 8 >>END_MODULE Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729967 spots for SRR7169842.sra Written 729967 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra Read 729960 spots for SRR7169842.sra Written 729960 spots for SRR7169842.sra SRR ids: ['SRR7169842.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sc_hlzpa SRR7169842.sra spots: 14599207 blocks: [[1, 729960], [729961, 1459920], [1459921, 2189880], [2189881, 2919840], [2919841, 3649800], [3649801, 4379760], [4379761, 5109720], [5109721, 5839680], [5839681, 6569640], [6569641, 7299600], [7299601, 8029560], [8029561, 8759520], [8759521, 9489480], [9489481, 10219440], [10219441, 10949400], [10949401, 11679360], [11679361, 12409320], [12409321, 13139280], [13139281, 13869240], [13869241, 14599207]] SRR7169842 file size 4925491 SRR7169842 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169842 SRR7169842_1.fastq SRR7169842_2.fastq Input file: SRR7169842_1.fastq Paired file: SRR7169842_2.fastq trimmed: SRR7169842-trimmed-pair1.fastq, SRR7169842-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:18:40 2025 >> started Tue Feb 11 22:19:02 2025 >> done (21.495s) 14599207 read pairs processed; of these: 33423 ( 0.23%) short read pairs filtered out after trimming by size control 69521 ( 0.48%) empty read pairs filtered out after trimming by size control 14496263 (99.29%) read pairs available; of these: 5934946 (40.94%) trimmed read pairs available after processing 8561317 (59.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 6 0.00% 27 6 0.00% 28 3 0.00% 29 5 0.00% 30 9 0.00% 31 4 0.00% 32 7 0.00% 33 9 0.00% 34 7 0.00% 35 6 0.00% 36 9 0.00% 37 7 0.00% 38 7 0.00% 39 12 0.00% 40 16 0.00% 41 18 0.00% 42 30 0.00% 43 14 0.00% 44 21 0.00% 45 21 0.00% 46 32 0.00% 47 36 0.00% 48 42 0.00% 49 36 0.00% 50 44 0.00% 51 74 0.00% 52 84 0.00% 53 95 0.00% 54 91 0.00% 55 104 0.00% 56 82 0.00% 57 125 0.00% 58 143 0.00% 59 181 0.00% 60 200 0.00% 61 245 0.00% 62 255 0.00% 63 327 0.00% 64 351 0.00% 65 384 0.00% 66 423 0.00% 67 531 0.00% 68 569 0.00% 69 596 0.00% 70 769 0.01% 71 902 0.01% 72 996 0.01% 73 1152 0.01% 74 1321 0.01% 75 1448 0.01% 76 1692 0.01% 77 1704 0.01% 78 1984 0.01% 79 2136 0.01% 80 2364 0.02% 81 2789 0.02% 82 3105 0.02% 83 3462 0.02% 84 4689 0.03% 85 5427 0.04% 86 5729 0.04% 87 6457 0.04% 88 6510 0.04% 89 6854 0.05% 90 7191 0.05% 91 7635 0.05% 92 8034 0.06% 93 8588 0.06% 94 9003 0.06% 95 9797 0.07% 96 10049 0.07% 97 10607 0.07% 98 10741 0.07% 99 11235 0.08% 100 11828 0.08% 101 12075 0.08% 102 12842 0.09% 103 13377 0.09% 104 13985 0.10% 105 14741 0.10% 106 15391 0.11% 107 16047 0.11% 108 16501 0.11% 109 16446 0.11% 110 17472 0.12% 111 17801 0.12% 112 18576 0.13% 113 19161 0.13% 114 19931 0.14% 115 21295 0.15% 116 22060 0.15% 117 22565 0.16% 118 23291 0.16% 119 23244 0.16% 120 24193 0.17% 121 24640 0.17% 122 25254 0.17% 123 26364 0.18% 124 27927 0.19% 125 28732 0.20% 126 30272 0.21% 127 31136 0.21% 128 32110 0.22% 129 32887 0.23% 130 33960 0.23% 131 35234 0.24% 132 36789 0.25% 133 38515 0.27% 134 40242 0.28% 135 42810 0.30% 136 45124 0.31% 137 46868 0.32% 138 50805 0.35% 139 54587 0.38% 140 57819 0.40% 141 62906 0.43% 142 69317 0.48% 143 77143 0.53% 144 89982 0.62% 145 106098 0.73% 146 131535 0.91% 147 177280 1.22% 148 268807 1.85% 149 585965 4.04% 150 3091353 21.33% 151 8561317 59.06% 14496263 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=261.03 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=43 prefix-density=0.21 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=156.98 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=15.8 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7169842 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:19:45 Started mapping on | Feb 11 22:19:46 Finished on | Feb 11 22:21:17 Mapping speed, Million of reads per hour | 573.48 Number of input reads | 14496263 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13644108 Uniquely mapped reads % | 94.12% Average mapped length | 294.81 Number of splices: Total | 12417281 Number of splices: Annotated (sjdb) | 12201756 Number of splices: GT/AG | 12234478 Number of splices: GC/AG | 144715 Number of splices: AT/AC | 10295 Number of splices: Non-canonical | 27793 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273865 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 53634 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593254 593254 593254 N_multimapping 273865 273865 273865 N_noFeature 300682 13487490 359972 N_ambiguous 151841 869 53875 UnstrandedReadsAssigned:13191585 PositiveStrandReadsAssigned:155749 NegativeStrandReadsAssigned:13230261 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169842 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169842-trimmed-pair1.fastq SRR7169842-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,496,263 reads, 13,171,947 reads pseudoaligned [quant] estimated average fragment length: 258.206 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7169842.ke.tsv 34699 SRR7169842.se.tsv 87100 total ==> SRR7169842.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.79 264 10.8225 Potri.005G024800.1.v4.1 1035 777.794 43 3.99058 Potri.004G059700.1.v4.1 961 703.8 1 0.102561 Potri.007G009000.2.v4.1 1416 1158.79 0 0 Potri.003G141000.2.v4.1 2943 2685.79 228.036 6.12863 Potri.016G087400.1.v4.1 270 76.0077 1116.05 1059.89 Potri.015G069301.1.v4.1 564 311.327 0 0 Potri.010G195200.1.v4.1 1773 1515.79 44 2.09529 Potri.012G127500.1.v4.1 977 719.794 6621 663.969 ==> SRR7169842.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1762 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169842 completed mapping pipeline successfully