Starting /dee2/code/volunteer_pipeline.sh SRR7169843 current disk space = 3052431351808 free memory = 1429954208 SRR7169843 SRAfilesize f6cf379baf762fa8fc747bc3a2fd1fe0 SRR7169843.sra SRR7169843.sra file validated SRR7169843 is paired end SRR7169843 is conventional basespace SRR7169843 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.0325 18.0 18.0 18.0 18.0 32.0 2 28.69125 29.0 27.0 31.0 25.0 33.0 3 31.06125 31.0 30.0 33.0 29.0 33.0 4 32.3685 33.0 33.0 33.0 31.0 33.0 5 32.89475 33.0 33.0 34.0 32.0 34.0 6 36.77675 38.0 37.0 38.0 34.0 38.0 7 35.4435 38.0 37.0 38.0 29.0 38.0 8 36.905 38.0 37.0 38.0 35.0 38.0 9 37.4275 38.0 38.0 38.0 37.0 38.0 10-14 37.491749999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.497 38.0 38.0 38.0 37.0 38.0 20-24 37.54715 38.0 38.0 38.0 37.8 38.0 25-29 37.522600000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.4978 38.0 38.0 38.0 37.8 38.0 35-39 37.44015 38.0 38.0 38.0 37.0 38.0 40-44 37.37985 38.0 38.0 38.0 36.8 38.0 45-49 37.431650000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.16575 38.0 38.0 38.0 36.2 38.0 55-59 36.854850000000006 38.0 38.0 38.0 35.4 38.0 60-64 36.96995 38.0 38.0 38.0 35.8 38.0 65-69 36.365700000000004 38.0 37.4 38.0 32.8 38.0 70-74 36.855500000000006 38.0 37.8 38.0 35.4 38.0 75-79 36.84955 38.0 38.0 38.0 35.4 38.0 80-84 36.7096 38.0 38.0 38.0 35.2 38.0 85-89 36.57305 38.0 38.0 38.0 34.4 38.0 90-94 35.360200000000006 38.0 36.2 38.0 27.8 38.0 95-99 35.9471 38.0 36.8 38.0 32.4 38.0 100-104 35.11025 38.0 36.0 38.0 26.6 38.0 105-109 35.53735 38.0 36.4 38.0 30.0 38.0 110-114 34.86245 38.0 35.2 38.0 26.8 38.0 115-119 34.5052 38.0 34.6 38.0 25.2 38.0 120-124 33.7774 37.4 31.8 38.0 24.4 38.0 125-129 34.09505 38.0 33.6 38.0 23.2 38.0 130-134 34.520849999999996 38.0 34.8 38.0 26.4 38.0 135-139 34.15595 38.0 34.4 38.0 24.2 38.0 140-144 33.21125 37.6 32.8 38.0 21.4 38.0 145-149 32.65695 36.8 33.0 38.0 15.8 38.0 150-151 29.79875 36.0 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 3.0 18 6.0 19 12.0 20 5.0 21 3.0 22 4.0 23 8.0 24 11.0 25 11.0 26 22.0 27 16.0 28 23.0 29 34.0 30 36.0 31 70.0 32 103.0 33 163.0 34 276.0 35 543.0 36 1341.0 37 1303.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 18.475 9.125 33.725 2 22.836418209104554 16.15807903951976 31.79089544772386 29.214607303651825 3 19.425 22.375 26.224999999999998 31.974999999999998 4 22.1 28.449999999999996 22.625 26.825 5 22.650000000000002 34.525 23.35 19.475 6 20.5 36.125 24.65 18.725 7 15.825 28.1 39.800000000000004 16.275000000000002 8 18.2 26.974999999999998 30.0 24.825 9 17.349999999999998 24.85 33.550000000000004 24.25 10-14 20.04 30.7 26.11 23.150000000000002 15-19 20.064999999999998 29.65 27.400000000000002 22.884999999999998 20-24 19.725 29.904999999999998 27.48 22.89 25-29 19.925 30.099999999999998 27.3 22.675 30-34 19.625 29.57 27.229999999999997 23.575 35-39 19.645000000000003 29.544999999999998 27.175 23.635 40-44 20.275000000000002 29.965000000000003 26.405 23.355 45-49 20.135 29.395 27.52 22.95 50-54 19.79 29.15 28.1 22.96 55-59 19.470000000000002 30.39 26.765 23.375 60-64 20.244999999999997 29.515 27.16 23.080000000000002 65-69 20.375 29.555 26.669999999999998 23.400000000000002 70-74 20.16 29.294999999999998 27.055 23.49 75-79 20.155 28.82 27.284999999999997 23.74 80-84 20.244999999999997 29.39 26.625 23.74 85-89 20.200000000000003 28.835 27.375 23.59 90-94 20.330000000000002 29.775000000000002 26.47 23.425 95-99 20.419999999999998 28.59 27.605 23.385 100-104 20.705000000000002 29.12 27.115000000000002 23.06 105-109 20.265 29.404999999999998 27.37 22.96 110-114 20.54 29.195 26.565 23.7 115-119 20.596192384769537 29.203406813627254 26.613226452905813 23.587174348697395 120-124 20.0 28.953953953953953 27.24224224224224 23.803803803803802 125-129 20.195 29.265 27.034999999999997 23.505000000000003 130-134 20.9 28.09 26.584999999999997 24.425 135-139 20.53 28.139999999999997 27.779999999999998 23.549999999999997 140-144 21.256691180149083 27.840312171694432 26.944819650807943 23.95817699734854 145-149 20.810000000000002 28.310000000000002 26.840000000000003 24.04 150-151 20.95 28.9 26.487500000000004 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 3.0 24 4.0 25 5.5 26 7.0 27 6.0 28 12.5 29 20.0 30 27.5 31 37.5 32 46.5 33 50.5 34 62.0 35 82.5 36 92.5 37 105.0 38 136.0 39 164.5 40 187.0 41 225.5 42 253.0 43 257.0 44 257.5 45 242.5 46 253.0 47 258.5 48 220.0 49 198.0 50 173.0 51 147.5 52 123.5 53 92.0 54 68.0 55 44.0 56 30.5 57 27.0 58 17.0 59 11.0 60 11.0 61 8.0 62 6.0 63 6.5 64 4.5 65 2.5 66 1.5 67 2.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.2 120-124 0.1 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.055 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.3770739064856712 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025138260432378077 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 8 0.2 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.475 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 2.85 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGAT 10 0.006830828 145.0 1 TCTCTTT 10 0.006830828 145.0 5 >>END_MODULE SRR7169843 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169843_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1715 34.0 33.0 34.0 33.0 34.0 2 33.24825 34.0 33.0 34.0 33.0 34.0 3 33.275 34.0 33.0 34.0 33.0 34.0 4 33.21475 34.0 33.0 34.0 33.0 34.0 5 33.22525 34.0 33.0 34.0 33.0 34.0 6 37.35875 38.0 38.0 38.0 38.0 38.0 7 37.41125 38.0 38.0 38.0 37.0 38.0 8 37.3535 38.0 38.0 38.0 38.0 38.0 9 37.38775 38.0 38.0 38.0 38.0 38.0 10-14 37.283049999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.2976 38.0 38.0 38.0 37.4 38.0 20-24 36.90155 38.0 37.8 38.0 35.4 38.0 25-29 35.67975 38.0 36.8 38.0 28.8 38.0 30-34 36.9429 38.0 37.8 38.0 35.4 38.0 35-39 37.201499999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.97175 38.0 38.0 38.0 36.4 38.0 45-49 37.07615 38.0 38.0 38.0 36.8 38.0 50-54 36.919850000000004 38.0 38.0 38.0 36.2 38.0 55-59 37.02115 38.0 38.0 38.0 36.6 38.0 60-64 36.86295 38.0 38.0 38.0 36.0 38.0 65-69 36.8257 38.0 38.0 38.0 36.0 38.0 70-74 36.91135 38.0 38.0 38.0 36.0 38.0 75-79 36.957300000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.727599999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.4125 38.0 38.0 38.0 34.6 38.0 90-94 36.653150000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.576150000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.3618 38.0 38.0 38.0 34.4 38.0 105-109 36.27435 38.0 38.0 38.0 34.0 38.0 110-114 36.257349999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.0495 38.0 38.0 38.0 33.6 38.0 120-124 35.8391 38.0 37.4 38.0 33.2 38.0 125-129 35.7385 38.0 37.0 38.0 33.0 38.0 130-134 35.46205 38.0 36.4 38.0 31.4 38.0 135-139 34.7362 38.0 35.8 38.0 27.0 38.0 140-144 34.54690000000001 38.0 35.4 38.0 26.4 38.0 145-149 33.62185 38.0 34.6 38.0 21.4 38.0 150-151 30.395375 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 2.0 6 3.0 7 2.0 8 5.0 9 2.0 10 1.0 11 1.0 12 3.0 13 0.0 14 1.0 15 1.0 16 5.0 17 3.0 18 3.0 19 3.0 20 12.0 21 4.0 22 4.0 23 6.0 24 10.0 25 11.0 26 18.0 27 25.0 28 20.0 29 26.0 30 31.0 31 56.0 32 61.0 33 80.0 34 129.0 35 240.0 36 661.0 37 2563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.574999999999996 22.3 14.774999999999999 24.349999999999998 2 27.325 26.424999999999997 28.475 17.775 3 20.349999999999998 29.625 31.0 19.025 4 23.655913978494624 32.3330832708177 22.980745186296573 21.030257564391096 5 23.705926481620406 34.858714678669664 22.83070767691923 18.6046511627907 6 22.400000000000002 37.475 22.05 18.075 7 21.5 22.75 36.375 19.375 8 21.65 26.724999999999998 25.874999999999996 25.75 9 22.075 27.05 27.575 23.3 10-14 23.735 29.195 25.885 21.185000000000002 15-19 23.53 28.285 27.075 21.11 20-24 23.07 28.37 27.115000000000002 21.445 25-29 22.900000000000002 28.4 27.435 21.265 30-34 22.465 28.439999999999998 27.474999999999998 21.62 35-39 22.675 28.444999999999997 27.694999999999997 21.185000000000002 40-44 22.805 28.37 27.48 21.345 45-49 23.365 28.09 27.495000000000005 21.05 50-54 23.54 27.965 28.095 20.4 55-59 23.77 27.98 27.689999999999998 20.560000000000002 60-64 23.34 27.435 27.91 21.315 65-69 23.73 27.365000000000002 28.345 20.560000000000002 70-74 23.455000000000002 27.725 27.955000000000002 20.865000000000002 75-79 23.13 27.58 28.26 21.029999999999998 80-84 23.39 27.894999999999996 28.175 20.54 85-89 23.575 27.700000000000003 27.79 20.935000000000002 90-94 23.45 27.435 28.225 20.89 95-99 23.465 27.355 28.21 20.97 100-104 23.775 27.794999999999998 27.589999999999996 20.84 105-109 23.935000000000002 27.575 27.825 20.665 110-114 23.73 27.845 27.525 20.9 115-119 24.265 27.425 27.71 20.599999999999998 120-124 23.955000000000002 27.525 27.555000000000003 20.965 125-129 24.175 27.67 27.97 20.185 130-134 23.974999999999998 27.815 27.495000000000005 20.715 135-139 24.30795414726936 27.27136206637633 27.892075887270362 20.528607899083948 140-144 23.645 27.42 27.950000000000003 20.985 145-149 23.94 27.82 28.09 20.150000000000002 150-151 24.625 26.75 27.8875 20.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 0.5 24 2.0 25 3.5 26 2.0 27 3.5 28 5.5 29 4.5 30 10.0 31 16.5 32 20.0 33 27.0 34 32.5 35 47.0 36 70.0 37 90.0 38 127.0 39 173.0 40 203.0 41 218.0 42 257.0 43 288.5 44 298.5 45 295.5 46 279.5 47 268.0 48 234.5 49 211.5 50 190.0 51 155.0 52 113.5 53 89.5 54 73.0 55 46.5 56 33.0 57 27.0 58 24.0 59 16.0 60 8.0 61 5.5 62 6.5 63 6.0 64 4.0 65 1.5 66 1.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.11499999999999999 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64815280221161 99.125 2 0.30158331239004776 0.6 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025131942699170642 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.3375000000000004 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.25 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.05 0.0 0.0 0.0 0.0 138-139 4.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAACC 10 0.006830828 145.0 2 >>END_MODULE Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693527 spots for SRR7169843.sra Written 693527 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra Read 693509 spots for SRR7169843.sra Written 693509 spots for SRR7169843.sra SRR ids: ['SRR7169843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ralobgk SRR7169843.sra spots: 13870198 blocks: [[1, 693509], [693510, 1387018], [1387019, 2080527], [2080528, 2774036], [2774037, 3467545], [3467546, 4161054], [4161055, 4854563], [4854564, 5548072], [5548073, 6241581], [6241582, 6935090], [6935091, 7628599], [7628600, 8322108], [8322109, 9015617], [9015618, 9709126], [9709127, 10402635], [10402636, 11096144], [11096145, 11789653], [11789654, 12483162], [12483163, 13176671], [13176672, 13870198]] SRR7169843 file size 4678454 SRR7169843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169843 SRR7169843_1.fastq SRR7169843_2.fastq Input file: SRR7169843_1.fastq Paired file: SRR7169843_2.fastq trimmed: SRR7169843-trimmed-pair1.fastq, SRR7169843-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:13:33 2025 >> started Tue Feb 11 22:13:49 2025 >> done (15.816s) 13870198 read pairs processed; of these: 18090 ( 0.13%) short read pairs filtered out after trimming by size control 32810 ( 0.24%) empty read pairs filtered out after trimming by size control 13819298 (99.63%) read pairs available; of these: 6005905 (43.46%) trimmed read pairs available after processing 7813393 (56.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 9 0.00% 27 5 0.00% 28 6 0.00% 29 4 0.00% 30 8 0.00% 31 3 0.00% 32 3 0.00% 33 14 0.00% 34 5 0.00% 35 9 0.00% 36 13 0.00% 37 6 0.00% 38 11 0.00% 39 15 0.00% 40 19 0.00% 41 12 0.00% 42 19 0.00% 43 24 0.00% 44 20 0.00% 45 34 0.00% 46 29 0.00% 47 36 0.00% 48 32 0.00% 49 46 0.00% 50 56 0.00% 51 73 0.00% 52 82 0.00% 53 75 0.00% 54 77 0.00% 55 104 0.00% 56 95 0.00% 57 129 0.00% 58 146 0.00% 59 191 0.00% 60 217 0.00% 61 244 0.00% 62 316 0.00% 63 349 0.00% 64 335 0.00% 65 380 0.00% 66 423 0.00% 67 468 0.00% 68 526 0.00% 69 627 0.00% 70 776 0.01% 71 843 0.01% 72 1090 0.01% 73 1147 0.01% 74 1249 0.01% 75 1551 0.01% 76 1847 0.01% 77 2045 0.01% 78 1998 0.01% 79 2030 0.01% 80 2288 0.02% 81 2545 0.02% 82 2953 0.02% 83 3319 0.02% 84 4225 0.03% 85 4975 0.04% 86 5204 0.04% 87 5359 0.04% 88 5657 0.04% 89 5848 0.04% 90 6337 0.05% 91 6564 0.05% 92 7133 0.05% 93 7593 0.05% 94 8060 0.06% 95 8657 0.06% 96 8620 0.06% 97 8732 0.06% 98 9032 0.07% 99 9410 0.07% 100 9965 0.07% 101 10349 0.07% 102 11066 0.08% 103 11668 0.08% 104 12151 0.09% 105 12834 0.09% 106 13189 0.10% 107 13539 0.10% 108 13730 0.10% 109 13800 0.10% 110 14223 0.10% 111 14764 0.11% 112 15365 0.11% 113 16451 0.12% 114 17143 0.12% 115 17944 0.13% 116 18209 0.13% 117 18331 0.13% 118 18859 0.14% 119 19126 0.14% 120 19530 0.14% 121 19773 0.14% 122 20692 0.15% 123 21908 0.16% 124 23045 0.17% 125 24058 0.17% 126 24846 0.18% 127 25708 0.19% 128 26438 0.19% 129 27534 0.20% 130 28462 0.21% 131 29537 0.21% 132 31430 0.23% 133 33134 0.24% 134 35504 0.26% 135 37507 0.27% 136 39864 0.29% 137 42348 0.31% 138 44780 0.32% 139 48284 0.35% 140 52563 0.38% 141 57720 0.42% 142 64950 0.47% 143 74723 0.54% 144 89180 0.65% 145 110826 0.80% 146 142508 1.03% 147 197670 1.43% 148 306403 2.22% 149 630242 4.56% 150 3239626 23.44% 151 7813393 56.54% 13819298 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=66.82 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=12.6 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=46 prefix-density=0.21 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=121.28 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.6 sequence=CTCTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACATAACGGCGATCCTTGCGAAAGCTGGTCAGTTCACAACCTTAATTCGGTTGTTGAAAAGCACCCAAGAGGCTGACCAAATCAACACACAACTCAACAATTCAAACCAAGGCCTAACAGT SRR7169843 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:14:30 Started mapping on | Feb 11 22:14:31 Finished on | Feb 11 22:15:38 Mapping speed, Million of reads per hour | 742.53 Number of input reads | 13819298 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13056646 Uniquely mapped reads % | 94.48% Average mapped length | 295.05 Number of splices: Total | 11726898 Number of splices: Annotated (sjdb) | 11536473 Number of splices: GT/AG | 11555334 Number of splices: GC/AG | 137000 Number of splices: AT/AC | 8957 Number of splices: Non-canonical | 25607 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239529 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 16377 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 539725 539725 539725 N_multimapping 239529 239529 239529 N_noFeature 264438 12906309 316443 N_ambiguous 155926 725 57139 UnstrandedReadsAssigned:12636282 PositiveStrandReadsAssigned:149612 NegativeStrandReadsAssigned:12683064 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169843 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169843-trimmed-pair1.fastq SRR7169843-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,819,298 reads, 12,580,285 reads pseudoaligned [quant] estimated average fragment length: 276.929 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7169843.ke.tsv 34699 SRR7169843.se.tsv 87100 total ==> SRR7169843.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.07 232 9.6288 Potri.005G024800.1.v4.1 1035 759.071 17 1.61926 Potri.004G059700.1.v4.1 961 685.084 0 0 Potri.007G009000.2.v4.1 1416 1140.07 0 0 Potri.003G141000.2.v4.1 2943 2667.07 212.034 5.74805 Potri.016G087400.1.v4.1 270 74.8819 1331.07 1285.21 Potri.015G069301.1.v4.1 564 294.786 0 0 Potri.010G195200.1.v4.1 1773 1497.07 17 0.821025 Potri.012G127500.1.v4.1 977 701.078 7043 726.342 ==> SRR7169843.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1339 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169843 completed mapping pipeline successfully