Starting /dee2/code/volunteer_pipeline.sh SRR7169844 current disk space = 3052283375616 free memory = 1447215916 SRR7169844 SRAfilesize be95a4c2e3c7548eb8a0ea54f9949823 SRR7169844.sra SRR7169844.sra file validated SRR7169844 is paired end SRR7169844 is conventional basespace SRR7169844 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169844_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.38775 18.0 18.0 18.0 18.0 32.0 2 27.412 27.0 27.0 30.0 25.0 31.0 3 29.43025 30.0 29.0 31.0 25.0 33.0 4 31.86 33.0 31.0 33.0 30.0 33.0 5 32.52175 33.0 33.0 33.0 32.0 33.0 6 36.3745 38.0 36.0 38.0 34.0 38.0 7 36.085 38.0 37.0 38.0 33.0 38.0 8 37.1835 38.0 38.0 38.0 36.0 38.0 9 37.49775 38.0 38.0 38.0 37.0 38.0 10-14 37.5437 38.0 38.0 38.0 37.0 38.0 15-19 37.54119999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.5835 38.0 38.0 38.0 37.8 38.0 25-29 37.62919999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.53315 38.0 38.0 38.0 38.0 38.0 35-39 37.5552 38.0 38.0 38.0 37.8 38.0 40-44 37.3577 38.0 38.0 38.0 36.8 38.0 45-49 37.5198 38.0 38.0 38.0 37.0 38.0 50-54 37.348600000000005 38.0 38.0 38.0 36.8 38.0 55-59 37.282799999999995 38.0 38.0 38.0 36.6 38.0 60-64 37.225049999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.15305 38.0 38.0 38.0 36.0 38.0 70-74 37.054050000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.93835 38.0 38.0 38.0 35.6 38.0 80-84 36.840700000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.40259999999999 38.0 37.6 38.0 33.8 38.0 90-94 36.35355 38.0 37.4 38.0 33.4 38.0 95-99 36.198449999999994 38.0 37.0 38.0 33.4 38.0 100-104 35.2926 38.0 35.8 38.0 29.2 38.0 105-109 35.92975 38.0 36.8 38.0 32.2 38.0 110-114 35.9156 38.0 37.0 38.0 32.4 38.0 115-119 35.37815 38.0 36.2 38.0 29.8 38.0 120-124 34.55030000000001 38.0 34.8 38.0 24.8 38.0 125-129 35.08945000000001 38.0 35.0 38.0 28.2 38.0 130-134 33.90535 37.8 33.8 38.0 23.2 38.0 135-139 34.371050000000004 38.0 34.8 38.0 26.4 38.0 140-144 33.400150000000004 37.4 33.6 38.0 19.6 38.0 145-149 32.1604 36.6 31.6 38.0 15.6 38.0 150-151 28.577375 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 3.0 18 2.0 19 7.0 20 1.0 21 7.0 22 3.0 23 5.0 24 2.0 25 9.0 26 11.0 27 20.0 28 26.0 29 35.0 30 36.0 31 57.0 32 83.0 33 133.0 34 248.0 35 512.0 36 1422.0 37 1373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.900000000000002 32.95 8.825 32.324999999999996 2 22.1 14.399999999999999 33.675 29.825000000000003 3 19.75 21.25 27.025 31.974999999999998 4 22.725 28.175 21.925 27.175 5 22.525000000000002 32.574999999999996 24.25 20.65 6 19.575 35.725 24.2 20.5 7 15.35 27.525 41.075 16.05 8 17.95 27.700000000000003 29.925 24.425 9 16.55 26.400000000000002 33.775 23.275000000000002 10-14 19.56 30.514999999999997 27.189999999999998 22.735 15-19 19.475 29.79 27.505000000000003 23.23 20-24 19.78 29.435 27.355 23.43 25-29 19.725 29.74 27.245 23.29 30-34 19.675 29.86 27.295 23.169999999999998 35-39 19.650000000000002 29.635 27.13 23.585 40-44 20.13 29.975 27.01 22.884999999999998 45-49 20.119999999999997 29.225 27.284999999999997 23.369999999999997 50-54 20.455000000000002 29.335 26.93 23.28 55-59 20.175 29.4 27.435 22.99 60-64 20.175 29.25 27.334999999999997 23.24 65-69 20.225 28.925 26.82 24.03 70-74 19.634999999999998 29.84 27.22 23.305 75-79 19.775000000000002 29.09 27.485 23.65 80-84 20.119999999999997 29.84 26.555 23.485 85-89 20.34 28.754999999999995 27.205000000000002 23.7 90-94 20.9 29.065 26.985 23.05 95-99 20.695 29.095 26.82 23.39 100-104 20.315 29.5 26.674999999999997 23.51 105-109 20.615 29.21 26.39 23.785 110-114 20.785 28.985 26.640000000000004 23.59 115-119 20.84 29.475 26.16 23.525 120-124 20.685000000000002 28.970000000000002 26.505000000000003 23.84 125-129 21.044999999999998 28.175 26.71 24.07 130-134 20.34 29.14 26.765 23.755000000000003 135-139 20.395 27.87 27.334999999999997 24.4 140-144 20.655 28.32 26.810000000000002 24.215 145-149 20.61 28.21 27.445000000000004 23.735 150-151 20.0125 28.8875 27.200000000000003 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 3.5 25 6.0 26 7.5 27 10.5 28 12.0 29 18.5 30 28.5 31 38.5 32 44.5 33 51.5 34 71.0 35 93.0 36 99.0 37 108.0 38 132.5 39 150.5 40 185.0 41 231.5 42 247.5 43 257.5 44 256.5 45 260.0 46 270.0 47 255.5 48 227.0 49 194.0 50 160.0 51 132.5 52 105.5 53 85.0 54 69.5 55 45.0 56 31.0 57 25.0 58 21.5 59 14.0 60 9.0 61 5.0 62 2.0 63 4.0 64 6.0 65 6.5 66 5.5 67 2.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.30120481927710846 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.4749999999999996 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.4000000000000004 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGCAC 10 0.006830828 145.0 9 >>END_MODULE SRR7169844 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169844_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22925 34.0 33.0 34.0 33.0 34.0 2 33.30925 34.0 33.0 34.0 33.0 34.0 3 33.3105 34.0 33.0 34.0 33.0 34.0 4 33.3415 34.0 33.0 34.0 33.0 34.0 5 33.29775 34.0 33.0 34.0 33.0 34.0 6 37.38625 38.0 38.0 38.0 38.0 38.0 7 37.38475 38.0 38.0 38.0 38.0 38.0 8 37.42025 38.0 38.0 38.0 38.0 38.0 9 37.45275 38.0 38.0 38.0 38.0 38.0 10-14 37.41155 38.0 38.0 38.0 38.0 38.0 15-19 37.4142 38.0 38.0 38.0 37.8 38.0 20-24 37.18805 38.0 38.0 38.0 37.4 38.0 25-29 36.724199999999996 38.0 37.8 38.0 35.0 38.0 30-34 36.455349999999996 38.0 37.8 38.0 33.6 38.0 35-39 37.056650000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.9508 38.0 38.0 38.0 36.2 38.0 45-49 37.01455 38.0 38.0 38.0 36.6 38.0 50-54 37.161150000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.2224 38.0 38.0 38.0 37.0 38.0 60-64 37.1291 38.0 38.0 38.0 37.0 38.0 65-69 37.12835 38.0 38.0 38.0 37.0 38.0 70-74 37.15755 38.0 38.0 38.0 37.0 38.0 75-79 37.1111 38.0 38.0 38.0 36.8 38.0 80-84 36.9126 38.0 38.0 38.0 36.0 38.0 85-89 36.872749999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.8885 38.0 38.0 38.0 36.0 38.0 95-99 36.83965 38.0 38.0 38.0 36.0 38.0 100-104 36.61149999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.599599999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.51115 38.0 38.0 38.0 34.6 38.0 115-119 36.30605 38.0 38.0 38.0 34.2 38.0 120-124 36.13895 38.0 38.0 38.0 33.8 38.0 125-129 36.02635 38.0 37.8 38.0 33.2 38.0 130-134 35.80944999999999 38.0 36.8 38.0 33.0 38.0 135-139 35.4191 38.0 36.0 38.0 31.0 38.0 140-144 35.330349999999996 38.0 36.0 38.0 31.2 38.0 145-149 34.693650000000005 38.0 35.6 38.0 28.8 38.0 150-151 30.7975 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 3.0 5 3.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 3.0 13 0.0 14 1.0 15 1.0 16 3.0 17 3.0 18 3.0 19 4.0 20 7.0 21 4.0 22 2.0 23 9.0 24 7.0 25 9.0 26 10.0 27 10.0 28 15.0 29 19.0 30 29.0 31 36.0 32 48.0 33 55.0 34 117.0 35 227.0 36 619.0 37 2740.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.550000000000004 21.175 14.549999999999999 23.724999999999998 2 28.549999999999997 26.125 27.85 17.474999999999998 3 21.975 28.249999999999996 30.425 19.35 4 23.25 32.925 23.674999999999997 20.150000000000002 5 23.875 35.9 22.225 18.0 6 22.25 37.275000000000006 21.725 18.75 7 21.175 22.025 37.125 19.675 8 23.325000000000003 26.375 25.575 24.725 9 22.0 25.275 30.099999999999998 22.625 10-14 23.125 28.444999999999997 26.765 21.665 15-19 23.345 28.24 27.310000000000002 21.105 20-24 23.525 28.215 27.605 20.655 25-29 23.435 27.96 27.575 21.029999999999998 30-34 23.48 27.994999999999997 27.415 21.11 35-39 23.03 28.04 27.98 20.95 40-44 23.855 27.55 27.735 20.86 45-49 23.9 27.37 28.305000000000003 20.424999999999997 50-54 23.59 27.575 27.794999999999998 21.04 55-59 23.625 27.575 27.515 21.285 60-64 23.48 27.639999999999997 27.915 20.965 65-69 23.39 27.779999999999998 27.815 21.015 70-74 23.76 28.060000000000002 27.66 20.52 75-79 23.375 27.595 28.1 20.93 80-84 23.544999999999998 27.800000000000004 28.194999999999997 20.46 85-89 23.645 27.68 28.125 20.549999999999997 90-94 23.46 28.194999999999997 28.02 20.325 95-99 24.095 26.895000000000003 28.470000000000002 20.54 100-104 23.575 28.325 27.57 20.53 105-109 23.724999999999998 28.01 27.284999999999997 20.979999999999997 110-114 23.96 28.194999999999997 27.544999999999998 20.3 115-119 23.61 27.715 27.97 20.705000000000002 120-124 24.205 27.83 27.725 20.24 125-129 24.04 27.76 27.805000000000003 20.395 130-134 24.46 27.79 27.584999999999997 20.165 135-139 24.42 27.55 27.445000000000004 20.585 140-144 23.995 27.43 27.71 20.865000000000002 145-149 24.135 27.63 27.405 20.830000000000002 150-151 24.212500000000002 27.712500000000002 27.3 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.5 27 5.0 28 3.5 29 4.5 30 10.0 31 12.0 32 15.0 33 21.5 34 35.0 35 47.0 36 70.0 37 97.5 38 125.5 39 159.5 40 192.5 41 230.0 42 260.5 43 288.5 44 301.5 45 304.5 46 284.5 47 264.5 48 245.5 49 215.0 50 182.0 51 137.5 52 112.0 53 97.0 54 76.5 55 50.5 56 35.5 57 29.5 58 24.0 59 19.5 60 10.5 61 4.0 62 4.0 63 3.5 64 1.5 65 2.5 66 4.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.4273504273504274 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.4749999999999996 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.4625 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.55 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTGT 10 0.006830828 145.0 5 GTGGAAT 10 0.006830828 145.0 1 CTCAAAC 10 0.006830828 145.0 1 >>END_MODULE Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra Read 570657 spots for SRR7169844.sra Written 570657 spots for SRR7169844.sra SRR ids: ['SRR7169844.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8yb6dv8_ SRR7169844.sra spots: 11413140 blocks: [[1, 570657], [570658, 1141314], [1141315, 1711971], [1711972, 2282628], [2282629, 2853285], [2853286, 3423942], [3423943, 3994599], [3994600, 4565256], [4565257, 5135913], [5135914, 5706570], [5706571, 6277227], [6277228, 6847884], [6847885, 7418541], [7418542, 7989198], [7989199, 8559855], [8559856, 9130512], [9130513, 9701169], [9701170, 10271826], [10271827, 10842483], [10842484, 11413140]] SRR7169844 file size 3845838 SRR7169844 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169844 SRR7169844_1.fastq SRR7169844_2.fastq Input file: SRR7169844_1.fastq Paired file: SRR7169844_2.fastq trimmed: SRR7169844-trimmed-pair1.fastq, SRR7169844-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:28:40 2025 >> started Tue Feb 11 22:28:52 2025 >> done (12.440s) 11413140 read pairs processed; of these: 13059 ( 0.11%) short read pairs filtered out after trimming by size control 20443 ( 0.18%) empty read pairs filtered out after trimming by size control 11379638 (99.71%) read pairs available; of these: 5101677 (44.83%) trimmed read pairs available after processing 6277961 (55.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 6 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 1 0.00% 30 5 0.00% 31 2 0.00% 32 7 0.00% 33 4 0.00% 34 10 0.00% 35 7 0.00% 36 8 0.00% 37 7 0.00% 38 19 0.00% 39 13 0.00% 40 14 0.00% 41 22 0.00% 42 22 0.00% 43 27 0.00% 44 29 0.00% 45 37 0.00% 46 30 0.00% 47 60 0.00% 48 59 0.00% 49 78 0.00% 50 77 0.00% 51 109 0.00% 52 110 0.00% 53 113 0.00% 54 132 0.00% 55 137 0.00% 56 176 0.00% 57 180 0.00% 58 224 0.00% 59 302 0.00% 60 281 0.00% 61 345 0.00% 62 411 0.00% 63 442 0.00% 64 471 0.00% 65 540 0.00% 66 647 0.01% 67 688 0.01% 68 791 0.01% 69 877 0.01% 70 939 0.01% 71 1151 0.01% 72 1320 0.01% 73 1525 0.01% 74 1660 0.01% 75 1866 0.02% 76 2206 0.02% 77 2449 0.02% 78 2366 0.02% 79 2497 0.02% 80 2705 0.02% 81 3100 0.03% 82 3318 0.03% 83 3848 0.03% 84 4677 0.04% 85 5304 0.05% 86 5457 0.05% 87 5885 0.05% 88 6113 0.05% 89 6420 0.06% 90 6725 0.06% 91 7004 0.06% 92 7305 0.06% 93 7944 0.07% 94 8188 0.07% 95 8548 0.08% 96 8694 0.08% 97 9069 0.08% 98 9126 0.08% 99 9330 0.08% 100 9729 0.09% 101 10104 0.09% 102 10839 0.10% 103 11118 0.10% 104 11415 0.10% 105 11744 0.10% 106 12348 0.11% 107 12255 0.11% 108 12722 0.11% 109 12652 0.11% 110 13121 0.12% 111 13486 0.12% 112 14075 0.12% 113 14668 0.13% 114 15457 0.14% 115 15753 0.14% 116 16032 0.14% 117 16208 0.14% 118 16189 0.14% 119 16631 0.15% 120 16737 0.15% 121 17177 0.15% 122 17683 0.16% 123 18313 0.16% 124 19406 0.17% 125 19662 0.17% 126 20856 0.18% 127 21466 0.19% 128 21588 0.19% 129 22584 0.20% 130 23219 0.20% 131 24146 0.21% 132 25263 0.22% 133 26761 0.24% 134 28106 0.25% 135 30097 0.26% 136 32117 0.28% 137 34005 0.30% 138 36648 0.32% 139 39929 0.35% 140 43343 0.38% 141 47505 0.42% 142 53747 0.47% 143 62094 0.55% 144 74298 0.65% 145 92388 0.81% 146 119958 1.05% 147 169094 1.49% 148 269899 2.37% 149 558186 4.91% 150 2694568 23.68% 151 6277961 55.17% 11379638 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=38 prefix-density=0.28 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=67.46 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.0 sequence=CCAGCACCATACTTCACTCCCTCACGGAAGACTGAGAGAAGCTTTTCATCGGAGCGAGAGTTCTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=45 prefix-density=0.21 prefix-fanout=2.2 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=140.85 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169844 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:29:35 Started mapping on | Feb 11 22:29:35 Finished on | Feb 11 22:31:00 Mapping speed, Million of reads per hour | 481.96 Number of input reads | 11379638 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10506249 Uniquely mapped reads % | 92.32% Average mapped length | 294.39 Number of splices: Total | 9397085 Number of splices: Annotated (sjdb) | 9238307 Number of splices: GT/AG | 9260756 Number of splices: GC/AG | 108581 Number of splices: AT/AC | 7026 Number of splices: Non-canonical | 20722 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 199595 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 17168 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.74% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685835 685835 685835 N_multimapping 199595 199595 199595 N_noFeature 227317 10379093 271542 N_ambiguous 128631 619 45309 UnstrandedReadsAssigned:10150301 PositiveStrandReadsAssigned:126537 NegativeStrandReadsAssigned:10189398 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169844 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169844-trimmed-pair1.fastq SRR7169844-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,379,638 reads, 10,142,102 reads pseudoaligned [quant] estimated average fragment length: 279.908 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7169844.ke.tsv 34699 SRR7169844.se.tsv 87100 total ==> SRR7169844.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.09 151 7.7769 Potri.005G024800.1.v4.1 1035 756.092 22 2.60615 Potri.004G059700.1.v4.1 961 682.103 3 0.393934 Potri.007G009000.2.v4.1 1416 1137.09 0 0 Potri.003G141000.2.v4.1 2943 2664.09 186.037 6.25463 Potri.016G087400.1.v4.1 270 78.581 981.513 1118.74 Potri.015G069301.1.v4.1 564 291.913 0 0 Potri.010G195200.1.v4.1 1773 1494.09 37 2.21808 Potri.012G127500.1.v4.1 977 698.103 4807 616.746 ==> SRR7169844.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1143 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169844 completed mapping pipeline successfully