Starting /dee2/code/volunteer_pipeline.sh SRR7169845 current disk space = 3052207034368 free memory = 1399307164 SRR7169845 SRAfilesize 67f5a987af7799ec6a9c2538fe29b7aa SRR7169845.sra SRR7169845.sra file validated SRR7169845 is paired end SRR7169845 is conventional basespace SRR7169845 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.7735 25.0 18.0 32.0 18.0 33.0 2 25.16925 25.0 18.0 30.0 18.0 33.0 3 28.9535 30.0 27.0 31.0 25.0 33.0 4 31.61725 33.0 31.0 33.0 29.0 33.0 5 32.40725 33.0 33.0 33.0 31.0 33.0 6 36.26275 38.0 36.0 38.0 33.0 38.0 7 36.81325 38.0 37.0 38.0 34.0 38.0 8 37.2155 38.0 38.0 38.0 36.0 38.0 9 36.31675 38.0 38.0 38.0 34.0 38.0 10-14 37.3284 38.0 38.0 38.0 36.6 38.0 15-19 37.3053 38.0 38.0 38.0 36.6 38.0 20-24 37.32645000000001 38.0 38.0 38.0 36.6 38.0 25-29 37.5072 38.0 38.0 38.0 37.2 38.0 30-34 37.427800000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.39235 38.0 38.0 38.0 37.0 38.0 40-44 37.27139999999999 38.0 38.0 38.0 36.8 38.0 45-49 37.3728 38.0 38.0 38.0 37.0 38.0 50-54 37.281800000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.188300000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.117450000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.0068 38.0 38.0 38.0 36.0 38.0 70-74 36.9418 38.0 38.0 38.0 35.6 38.0 75-79 36.78515 38.0 38.0 38.0 35.0 38.0 80-84 36.4775 38.0 37.6 38.0 33.8 38.0 85-89 35.95485000000001 38.0 36.8 38.0 31.8 38.0 90-94 36.39535000000001 38.0 37.4 38.0 34.0 38.0 95-99 36.325900000000004 38.0 37.0 38.0 33.8 38.0 100-104 36.02334999999999 38.0 37.0 38.0 32.0 38.0 105-109 34.97540000000001 38.0 35.2 38.0 26.0 38.0 110-114 34.8288 38.0 35.2 38.0 26.0 38.0 115-119 35.1165 38.0 35.6 38.0 28.4 38.0 120-124 35.0152 38.0 35.2 38.0 28.2 38.0 125-129 33.2767 37.2 31.4 38.0 21.6 38.0 130-134 33.56865 37.6 33.2 38.0 22.4 38.0 135-139 33.6465 38.0 33.4 38.0 21.8 38.0 140-144 32.5909 37.2 31.4 38.0 18.2 38.0 145-149 31.122499999999995 36.4 30.4 38.0 10.8 38.0 150-151 26.822249999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 3.0 21 3.0 22 8.0 23 6.0 24 13.0 25 17.0 26 14.0 27 25.0 28 32.0 29 41.0 30 48.0 31 74.0 32 116.0 33 171.0 34 293.0 35 608.0 36 1419.0 37 1097.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.574999999999996 10.8 10.274999999999999 40.35 2 20.87087087087087 14.53953953953954 33.50850850850851 31.08108108108108 3 19.6 21.6 28.1 30.7 4 22.0 29.225 23.45 25.324999999999996 5 22.025 32.45 24.099999999999998 21.425 6 20.075000000000003 35.075 25.874999999999996 18.975 7 14.35 25.374999999999996 42.575 17.7 8 18.925 26.150000000000002 30.55 24.375 9 17.95 23.775 34.375 23.9 10-14 19.72 29.755 27.075 23.45 15-19 20.43 27.915 28.205000000000002 23.45 20-24 20.23 28.810000000000002 27.985 22.975 25-29 20.01 29.365000000000002 26.935 23.69 30-34 19.84 28.555000000000003 28.065 23.54 35-39 19.63 28.65 28.1 23.62 40-44 20.235 28.62 27.26 23.885 45-49 20.225 28.470000000000002 27.525 23.78 50-54 20.005 28.37 27.935 23.69 55-59 20.495 28.71 26.91 23.885 60-64 19.73 28.999999999999996 27.639999999999997 23.630000000000003 65-69 20.335 28.38 27.305 23.98 70-74 21.125 28.64 27.195000000000004 23.04 75-79 20.294999999999998 28.725 27.455000000000002 23.525 80-84 20.345 28.810000000000002 27.744999999999997 23.1 85-89 20.685000000000002 28.615000000000002 27.165 23.535 90-94 20.474999999999998 28.299999999999997 27.255000000000003 23.97 95-99 20.24 28.415000000000003 27.334999999999997 24.01 100-104 20.515 28.845 27.66 22.98 105-109 20.435 28.660000000000004 27.515 23.39 110-114 20.599999999999998 28.455000000000002 27.445000000000004 23.5 115-119 20.945 28.749999999999996 26.93 23.375 120-124 20.21 29.335 27.395000000000003 23.06 125-129 20.46 28.22 27.98 23.34 130-134 20.49 28.199999999999996 27.98 23.330000000000002 135-139 20.44 28.23 28.144999999999996 23.185 140-144 20.325 28.470000000000002 27.6 23.605 145-149 20.794999999999998 27.505000000000003 27.73 23.97 150-151 20.8875 27.700000000000003 28.1 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 3.0 25 4.5 26 6.0 27 7.5 28 8.5 29 12.0 30 17.0 31 28.5 32 38.5 33 39.0 34 51.0 35 63.5 36 80.0 37 111.0 38 131.0 39 143.5 40 177.5 41 213.5 42 247.5 43 276.5 44 277.0 45 265.0 46 258.5 47 256.0 48 246.0 49 219.0 50 168.0 51 139.5 52 128.0 53 99.0 54 77.0 55 49.0 56 29.0 57 28.5 58 24.5 59 19.5 60 12.5 61 7.5 62 6.0 63 4.5 64 3.5 65 4.5 66 4.0 67 2.5 68 1.0 69 0.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.25 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCCCA 10 0.006830828 145.0 9 AATCAGA 10 0.006830828 145.0 8 GCTACAT 10 0.006830828 145.0 7 >>END_MODULE SRR7169845 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169845_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22925 34.0 33.0 34.0 33.0 34.0 2 33.2455 34.0 33.0 34.0 33.0 34.0 3 33.281 34.0 33.0 34.0 33.0 34.0 4 33.239 34.0 33.0 34.0 33.0 34.0 5 33.2755 34.0 33.0 34.0 33.0 34.0 6 37.457 38.0 38.0 38.0 38.0 38.0 7 37.46425 38.0 38.0 38.0 38.0 38.0 8 37.25025 38.0 38.0 38.0 37.0 38.0 9 37.37475 38.0 38.0 38.0 38.0 38.0 10-14 37.321600000000004 38.0 38.0 38.0 37.4 38.0 15-19 37.3217 38.0 38.0 38.0 37.0 38.0 20-24 37.33265 38.0 38.0 38.0 37.2 38.0 25-29 36.98475 38.0 38.0 38.0 36.0 38.0 30-34 37.277950000000004 38.0 38.0 38.0 37.2 38.0 35-39 36.967850000000006 38.0 38.0 38.0 36.0 38.0 40-44 37.248799999999996 38.0 38.0 38.0 37.0 38.0 45-49 36.8478 38.0 38.0 38.0 35.2 38.0 50-54 37.11045 38.0 38.0 38.0 36.6 38.0 55-59 37.15525 38.0 38.0 38.0 36.8 38.0 60-64 37.0306 38.0 38.0 38.0 36.0 38.0 65-69 37.065200000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.03195 38.0 38.0 38.0 36.6 38.0 75-79 37.0863 38.0 38.0 38.0 36.4 38.0 80-84 36.8787 38.0 38.0 38.0 36.0 38.0 85-89 36.777100000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.8031 38.0 38.0 38.0 35.0 38.0 95-99 36.6674 38.0 38.0 38.0 35.0 38.0 100-104 36.46315 38.0 38.0 38.0 34.4 38.0 105-109 36.38029999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.31400000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.123850000000004 38.0 37.6 38.0 33.6 38.0 120-124 35.80155 38.0 36.8 38.0 32.2 38.0 125-129 35.157799999999995 38.0 35.6 38.0 28.6 38.0 130-134 35.4295 38.0 36.0 38.0 30.6 38.0 135-139 33.97595 38.0 34.2 38.0 22.0 38.0 140-144 33.689 38.0 33.0 38.0 22.2 38.0 145-149 32.9533 38.0 32.6 38.0 18.2 38.0 150-151 29.44475 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 1.0 17 3.0 18 2.0 19 3.0 20 7.0 21 6.0 22 5.0 23 4.0 24 15.0 25 13.0 26 20.0 27 15.0 28 24.0 29 26.0 30 32.0 31 45.0 32 79.0 33 94.0 34 157.0 35 292.0 36 750.0 37 2392.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 21.65 13.875000000000002 26.375 2 26.9567391847962 26.581645411352838 29.982495623905976 16.479119779944988 3 20.9 28.000000000000004 31.3 19.8 4 23.80595148787197 33.558389597399355 22.53063265816454 20.10502625656414 5 23.275000000000002 36.6 22.6 17.525 6 20.175 38.074999999999996 22.55 19.2 7 19.45 21.0 38.6 20.95 8 21.95 24.6 27.900000000000002 25.55 9 21.6 25.324999999999996 29.15 23.925 10-14 23.355 29.054999999999996 26.16 21.43 15-19 22.905 27.939999999999998 28.115000000000002 21.04 20-24 22.98 27.915 28.199999999999996 20.905 25-29 22.915 28.485 27.529999999999998 21.07 30-34 22.400000000000002 28.265 27.46 21.875 35-39 22.470000000000002 28.77 27.905 20.855 40-44 22.695 28.854999999999997 27.229999999999997 21.22 45-49 23.11 27.915 27.97 21.005 50-54 22.485 28.449999999999996 28.365000000000002 20.7 55-59 23.41 28.46 27.855 20.275000000000002 60-64 22.99 27.88 28.16 20.97 65-69 23.494999999999997 27.555000000000003 28.46 20.49 70-74 23.405 27.495000000000005 28.01 21.09 75-79 22.57 27.58 28.76 21.09 80-84 23.625 28.189999999999998 27.515 20.669999999999998 85-89 23.65 28.189999999999998 27.54 20.62 90-94 23.655 27.85 28.349999999999998 20.145 95-99 23.799999999999997 28.32 27.58 20.3 100-104 23.5 28.155 27.79 20.555 105-109 23.45 28.215 27.655 20.68 110-114 24.185000000000002 28.04 27.11 20.665 115-119 23.78 27.3 27.655 21.265 120-124 23.345 28.970000000000002 27.02 20.665 125-129 23.86 27.99 27.644999999999996 20.505000000000003 130-134 24.515 27.839999999999996 27.595 20.05 135-139 23.945 27.865000000000002 27.85 20.34 140-144 24.36 28.305000000000003 26.584999999999997 20.75 145-149 24.38 28.689999999999998 27.089999999999996 19.84 150-151 24.5375 27.525 27.474999999999998 20.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 4.0 27 5.5 28 8.0 29 13.0 30 15.0 31 16.0 32 21.5 33 29.0 34 44.5 35 58.5 36 73.5 37 109.5 38 146.0 39 169.0 40 208.0 41 236.0 42 249.0 43 287.0 44 292.5 45 271.5 46 269.0 47 264.0 48 251.5 49 215.0 50 174.5 51 140.0 52 103.0 53 84.0 54 59.0 55 40.0 56 33.0 57 24.5 58 22.0 59 16.0 60 8.0 61 5.0 62 6.5 63 7.0 64 5.0 65 3.0 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.7999999999999998 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0125 0.0 138-139 2.6875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCCT 10 0.006830828 145.0 9 AAAACCC 10 0.006830828 145.0 8 >>END_MODULE Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619590 spots for SRR7169845.sra Written 619590 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra Read 619578 spots for SRR7169845.sra Written 619578 spots for SRR7169845.sra SRR ids: ['SRR7169845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2wy14t4k SRR7169845.sra spots: 12391572 blocks: [[1, 619578], [619579, 1239156], [1239157, 1858734], [1858735, 2478312], [2478313, 3097890], [3097891, 3717468], [3717469, 4337046], [4337047, 4956624], [4956625, 5576202], [5576203, 6195780], [6195781, 6815358], [6815359, 7434936], [7434937, 8054514], [8054515, 8674092], [8674093, 9293670], [9293671, 9913248], [9913249, 10532826], [10532827, 11152404], [11152405, 11771982], [11771983, 12391572]] SRR7169845 file size 4177396 SRR7169845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169845 SRR7169845_1.fastq SRR7169845_2.fastq Input file: SRR7169845_1.fastq Paired file: SRR7169845_2.fastq trimmed: SRR7169845-trimmed-pair1.fastq, SRR7169845-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:34:44 2025 >> started Tue Feb 11 22:34:59 2025 >> done (15.098s) 12391572 read pairs processed; of these: 7729 ( 0.06%) short read pairs filtered out after trimming by size control 5927 ( 0.05%) empty read pairs filtered out after trimming by size control 12377916 (99.89%) read pairs available; of these: 5699550 (46.05%) trimmed read pairs available after processing 6678366 (53.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 4 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 1 0.00% 28 6 0.00% 29 3 0.00% 30 6 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 3 0.00% 35 5 0.00% 36 4 0.00% 37 5 0.00% 38 6 0.00% 39 9 0.00% 40 14 0.00% 41 12 0.00% 42 3 0.00% 43 11 0.00% 44 11 0.00% 45 13 0.00% 46 22 0.00% 47 12 0.00% 48 29 0.00% 49 30 0.00% 50 39 0.00% 51 32 0.00% 52 54 0.00% 53 47 0.00% 54 49 0.00% 55 42 0.00% 56 45 0.00% 57 61 0.00% 58 75 0.00% 59 101 0.00% 60 103 0.00% 61 125 0.00% 62 149 0.00% 63 148 0.00% 64 175 0.00% 65 193 0.00% 66 211 0.00% 67 233 0.00% 68 250 0.00% 69 293 0.00% 70 382 0.00% 71 461 0.00% 72 467 0.00% 73 531 0.00% 74 590 0.00% 75 651 0.01% 76 769 0.01% 77 815 0.01% 78 929 0.01% 79 962 0.01% 80 1179 0.01% 81 1333 0.01% 82 1498 0.01% 83 1699 0.01% 84 2257 0.02% 85 2495 0.02% 86 2681 0.02% 87 3010 0.02% 88 3170 0.03% 89 3388 0.03% 90 3524 0.03% 91 3768 0.03% 92 4123 0.03% 93 4442 0.04% 94 4573 0.04% 95 4968 0.04% 96 5189 0.04% 97 5470 0.04% 98 5580 0.05% 99 5744 0.05% 100 6003 0.05% 101 6435 0.05% 102 6799 0.05% 103 7405 0.06% 104 7847 0.06% 105 8239 0.07% 106 8510 0.07% 107 8753 0.07% 108 9135 0.07% 109 9185 0.07% 110 9592 0.08% 111 10050 0.08% 112 10695 0.09% 113 10828 0.09% 114 11780 0.10% 115 12060 0.10% 116 12539 0.10% 117 12769 0.10% 118 13137 0.11% 119 13391 0.11% 120 13756 0.11% 121 14127 0.11% 122 14833 0.12% 123 15586 0.13% 124 16280 0.13% 125 17027 0.14% 126 17947 0.14% 127 18905 0.15% 128 19374 0.16% 129 20162 0.16% 130 21570 0.17% 131 22865 0.18% 132 24316 0.20% 133 26044 0.21% 134 28220 0.23% 135 30062 0.24% 136 32211 0.26% 137 35669 0.29% 138 38998 0.32% 139 42860 0.35% 140 47873 0.39% 141 54139 0.44% 142 61789 0.50% 143 72853 0.59% 144 89222 0.72% 145 112283 0.91% 146 148697 1.20% 147 212148 1.71% 148 340672 2.75% 149 686133 5.54% 150 3128475 25.27% 151 6678366 53.95% 12377916 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=30 prefix-density=0.20 prefix-fanout=2.9 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=88.20 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=18.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=33 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=51.33 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7169845 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:35:44 Started mapping on | Feb 11 22:35:44 Finished on | Feb 11 22:36:46 Mapping speed, Million of reads per hour | 718.72 Number of input reads | 12377916 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11681456 Uniquely mapped reads % | 94.37% Average mapped length | 296.06 Number of splices: Total | 11370954 Number of splices: Annotated (sjdb) | 11189187 Number of splices: GT/AG | 11206918 Number of splices: GC/AG | 132087 Number of splices: AT/AC | 8272 Number of splices: Non-canonical | 23677 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227602 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 12518 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 478749 478749 478749 N_multimapping 227602 227602 227602 N_noFeature 255287 11563603 303136 N_ambiguous 123014 664 52582 UnstrandedReadsAssigned:11303155 PositiveStrandReadsAssigned:117189 NegativeStrandReadsAssigned:11325738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169845 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169845-trimmed-pair1.fastq SRR7169845-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,377,916 reads, 11,199,568 reads pseudoaligned [quant] estimated average fragment length: 303.544 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR7169845.ke.tsv 34699 SRR7169845.se.tsv 87100 total ==> SRR7169845.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1715.46 218 11.3325 Potri.005G024800.1.v4.1 1035 732.456 17 2.06974 Potri.004G059700.1.v4.1 961 658.482 0 0 Potri.007G009000.2.v4.1 1416 1113.46 0 0 Potri.003G141000.2.v4.1 2943 2640.46 221 7.46382 Potri.016G087400.1.v4.1 270 72.4629 810.507 997.445 Potri.015G069301.1.v4.1 564 271.624 0 0 Potri.010G195200.1.v4.1 1773 1470.46 3 0.181935 Potri.012G127500.1.v4.1 977 674.469 3066 405.376 ==> SRR7169845.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 727 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169845 completed mapping pipeline successfully