Starting /dee2/code/volunteer_pipeline.sh SRR7169846 current disk space = 3052334628864 free memory = 1575742628 SRR7169846 SRAfilesize 29706c5db74b08317e172c617f287ea8 SRR7169846.sra SRR7169846.sra file validated SRR7169846 is paired end SRR7169846 is conventional basespace SRR7169846 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.025 18.0 18.0 27.0 18.0 32.0 2 29.113 29.0 27.0 31.0 25.0 33.0 3 31.36025 33.0 31.0 33.0 29.0 33.0 4 32.578 33.0 33.0 33.0 31.0 33.0 5 32.8215 33.0 33.0 34.0 32.0 34.0 6 36.87325 38.0 37.0 38.0 35.0 38.0 7 37.5255 38.0 38.0 38.0 37.0 38.0 8 37.716 38.0 38.0 38.0 38.0 38.0 9 37.70125 38.0 38.0 38.0 38.0 38.0 10-14 37.67395 38.0 38.0 38.0 38.0 38.0 15-19 37.63165 38.0 38.0 38.0 38.0 38.0 20-24 37.65005 38.0 38.0 38.0 37.8 38.0 25-29 37.65715 38.0 38.0 38.0 38.0 38.0 30-34 37.61635 38.0 38.0 38.0 38.0 38.0 35-39 37.57645 38.0 38.0 38.0 37.8 38.0 40-44 37.63335 38.0 38.0 38.0 38.0 38.0 45-49 37.652300000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.5871 38.0 38.0 38.0 38.0 38.0 55-59 37.47705 38.0 38.0 38.0 37.2 38.0 60-64 37.441250000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.391 38.0 38.0 38.0 37.0 38.0 70-74 37.404199999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.3609 38.0 38.0 38.0 37.0 38.0 80-84 37.10265 38.0 38.0 38.0 35.8 38.0 85-89 37.11795 38.0 38.0 38.0 36.0 38.0 90-94 36.8668 38.0 38.0 38.0 35.2 38.0 95-99 37.067150000000005 38.0 38.0 38.0 36.2 38.0 100-104 36.79995 38.0 38.0 38.0 35.0 38.0 105-109 36.04615 38.0 36.6 38.0 31.4 38.0 110-114 36.10095 38.0 37.0 38.0 32.4 38.0 115-119 35.01255 37.8 34.8 38.0 28.8 38.0 120-124 36.097249999999995 38.0 37.2 38.0 33.2 38.0 125-129 35.036449999999995 38.0 35.4 38.0 28.0 38.0 130-134 35.55045 38.0 35.8 38.0 31.0 38.0 135-139 35.556200000000004 38.0 36.2 38.0 31.4 38.0 140-144 35.07315 38.0 35.4 38.0 29.2 38.0 145-149 32.65050000000001 37.6 31.8 38.0 17.2 38.0 150-151 27.789625 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 0.0 19 2.0 20 0.0 21 3.0 22 1.0 23 6.0 24 3.0 25 8.0 26 12.0 27 7.0 28 19.0 29 12.0 30 27.0 31 43.0 32 68.0 33 86.0 34 155.0 35 368.0 36 1137.0 37 2037.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.7 14.799999999999999 7.7 32.800000000000004 2 23.111555777888945 14.70735367683842 34.892446223111556 27.288644322161083 3 20.474999999999998 20.674999999999997 27.05 31.8 4 23.525 28.425 23.125 24.925 5 22.6 34.125 23.325000000000003 19.950000000000003 6 18.6 36.925000000000004 24.6 19.875 7 14.2 27.900000000000002 40.6 17.299999999999997 8 18.175 26.174999999999997 30.225 25.424999999999997 9 17.424999999999997 24.7 33.675 24.2 10-14 20.39 30.209999999999997 26.77 22.63 15-19 20.16 28.975 28.110000000000003 22.755 20-24 20.25 27.944999999999997 28.77 23.035 25-29 19.955000000000002 29.45 27.42 23.175 30-34 20.580000000000002 28.64 27.615000000000002 23.165 35-39 20.03 28.87 27.765 23.335 40-44 20.24 29.565 27.310000000000002 22.884999999999998 45-49 20.345 28.365000000000002 27.665 23.625 50-54 19.975 28.77 27.810000000000002 23.445 55-59 20.349999999999998 29.015 27.755000000000003 22.88 60-64 20.51 29.134999999999998 27.3 23.055 65-69 20.445 28.975 27.345000000000002 23.235 70-74 20.9 28.955 27.235 22.91 75-79 20.485 29.299999999999997 26.919999999999998 23.294999999999998 80-84 20.544999999999998 29.330000000000002 27.555000000000003 22.57 85-89 20.835 28.945 27.245 22.975 90-94 20.525 28.79 26.865 23.82 95-99 21.13 28.68 27.275 22.915 100-104 21.044999999999998 29.225 26.465 23.265 105-109 20.705000000000002 29.744999999999997 26.25 23.3 110-114 21.855 29.110000000000003 26.21 22.825 115-119 21.632305844675738 29.11829463570857 25.85568454763811 23.393714971977584 120-124 22.055 28.875 25.16 23.91 125-129 21.91 28.52 25.705 23.865 130-134 22.055 28.76 25.27 23.915 135-139 21.575 28.725 25.264999999999997 24.435000000000002 140-144 21.81 28.485 25.590000000000003 24.115000000000002 145-149 21.46 29.275000000000002 24.715 24.55 150-151 21.45 27.900000000000002 26.025 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 2.0 26 3.0 27 4.0 28 11.0 29 14.5 30 17.0 31 31.0 32 39.5 33 53.5 34 72.5 35 80.0 36 88.0 37 115.5 38 139.5 39 156.5 40 183.0 41 214.5 42 235.5 43 243.0 44 266.0 45 276.5 46 268.5 47 258.0 48 230.5 49 201.0 50 162.0 51 133.5 52 126.0 53 105.5 54 80.0 55 53.0 56 33.0 57 25.0 58 22.5 59 17.0 60 9.5 61 7.0 62 5.5 63 2.5 64 0.0 65 0.5 66 2.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.08 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.875 0.0 0.0 0.0 0.0 80-81 1.05 0.0 0.0 0.0 0.0 82-83 1.2 0.0 0.0 0.0 0.0 84-85 1.55 0.0 0.0 0.0 0.0 86-87 1.95 0.0 0.0 0.0 0.0 88-89 2.2625 0.0 0.0 0.0 0.0 90-91 2.75 0.0 0.0 0.0 0.0 92-93 3.325 0.0 0.0 0.0 0.0 94-95 4.137499999999999 0.0 0.0 0.0 0.0 96-97 4.7875 0.0 0.0 0.0 0.0 98-99 5.324999999999999 0.0 0.0 0.0 0.0 100-101 5.7 0.0 0.0 0.0 0.0 102-103 6.2625 0.0 0.0 0.0 0.0 104-105 7.125 0.0 0.0 0.0 0.0 106-107 8.075 0.0 0.0 0.0 0.0 108-109 8.9 0.0 0.0 0.0 0.0 110-111 9.85 0.0 0.0 0.0 0.0 112-113 10.775 0.0 0.0 0.0 0.0 114-115 11.6125 0.0 0.0 0.0 0.0 116-117 12.462499999999999 0.0 0.0 0.0 0.0 118-119 13.225000000000001 0.0 0.0 0.0 0.0 120-121 14.149999999999999 0.0 0.0 0.0 0.0 122-123 15.3 0.0 0.0 0.0 0.0 124-125 16.4 0.0 0.0 0.0 0.0 126-127 17.9125 0.0 0.0 0.0 0.0 128-129 19.0875 0.0 0.0 0.0 0.0 130-131 20.1 0.0 0.0 0.0 0.0 132-133 21.225 0.0 0.0 0.0 0.0 134-135 22.3125 0.0 0.0 0.0 0.0 136-137 23.0875 0.0 0.0 0.0 0.0 138-139 24.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGGAG 10 0.006830828 145.0 8 TCAGCCT 10 0.006830828 145.0 7 >>END_MODULE SRR7169846 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169846_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38775 34.0 33.0 34.0 33.0 34.0 2 33.433 34.0 33.0 34.0 33.0 34.0 3 33.4775 34.0 33.0 34.0 33.0 34.0 4 33.4735 34.0 33.0 34.0 33.0 34.0 5 33.424 34.0 33.0 34.0 33.0 34.0 6 37.51475 38.0 38.0 38.0 38.0 38.0 7 37.6025 38.0 38.0 38.0 38.0 38.0 8 37.6725 38.0 38.0 38.0 38.0 38.0 9 37.65125 38.0 38.0 38.0 38.0 38.0 10-14 37.62765 38.0 38.0 38.0 38.0 38.0 15-19 37.57845 38.0 38.0 38.0 38.0 38.0 20-24 37.51995000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.484249999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.521699999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.258449999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.4415 38.0 38.0 38.0 38.0 38.0 45-49 37.53995 38.0 38.0 38.0 38.0 38.0 50-54 37.519349999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.4997 38.0 38.0 38.0 38.0 38.0 60-64 37.35265 38.0 38.0 38.0 37.8 38.0 65-69 37.37445 38.0 38.0 38.0 38.0 38.0 70-74 37.36125 38.0 38.0 38.0 38.0 38.0 75-79 37.38244999999999 38.0 38.0 38.0 37.8 38.0 80-84 37.24175 38.0 38.0 38.0 37.4 38.0 85-89 37.02125 38.0 38.0 38.0 36.4 38.0 90-94 37.17375 38.0 38.0 38.0 36.8 38.0 95-99 37.13755 38.0 38.0 38.0 36.8 38.0 100-104 37.0195 38.0 38.0 38.0 36.4 38.0 105-109 36.4606 38.0 37.8 38.0 34.0 38.0 110-114 36.45855 38.0 37.8 38.0 34.0 38.0 115-119 36.625600000000006 38.0 38.0 38.0 35.0 38.0 120-124 36.4737 38.0 38.0 38.0 34.4 38.0 125-129 35.5136 38.0 36.4 38.0 28.8 38.0 130-134 36.1772 38.0 38.0 38.0 33.8 38.0 135-139 35.75865 38.0 37.0 38.0 31.8 38.0 140-144 34.717349999999996 38.0 35.0 38.0 27.4 38.0 145-149 32.8704 37.6 31.8 38.0 20.8 38.0 150-151 29.526625 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 3.0 18 1.0 19 1.0 20 4.0 21 3.0 22 4.0 23 4.0 24 7.0 25 8.0 26 11.0 27 18.0 28 11.0 29 19.0 30 23.0 31 22.0 32 38.0 33 58.0 34 113.0 35 208.0 36 652.0 37 2777.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.725 21.95 10.424999999999999 24.9 2 25.85 26.825 30.7 16.625 3 21.15 27.325 33.050000000000004 18.475 4 23.625 34.575 22.8 19.0 5 22.725 37.15 22.425 17.7 6 20.025000000000002 37.1 24.175 18.7 7 21.15 20.9 37.5 20.45 8 21.475 26.450000000000003 27.800000000000004 24.275 9 20.8 25.4 31.0 22.8 10-14 22.8 28.38 27.284999999999997 21.535 15-19 22.795 27.705000000000002 28.17 21.33 20-24 22.99 27.55 28.544999999999998 20.915 25-29 23.385 27.73 27.939999999999998 20.945 30-34 22.715 27.229999999999997 28.67 21.385 35-39 22.415 27.715 28.999999999999996 20.87 40-44 22.634999999999998 27.55 28.65 21.165 45-49 22.665 27.485 28.945 20.905 50-54 22.09 27.73 29.235 20.945 55-59 22.994999999999997 27.655 28.48 20.87 60-64 22.585 27.505000000000003 28.955 20.955 65-69 22.67 27.400000000000002 28.87 21.060000000000002 70-74 22.685 27.675 28.265 21.375 75-79 22.715 28.215 28.54 20.53 80-84 23.150000000000002 27.255000000000003 28.675 20.919999999999998 85-89 23.125 27.665 28.83 20.380000000000003 90-94 24.065 28.07 27.905 19.96 95-99 24.315 27.839999999999996 27.395000000000003 20.45 100-104 24.2 27.915 27.91 19.975 105-109 24.54 27.884999999999998 27.48 20.095 110-114 25.014999999999997 28.055000000000003 26.924999999999997 20.005 115-119 25.6 27.689999999999998 26.995 19.715 120-124 25.485000000000003 27.725 27.125 19.665 125-129 26.545 27.32 26.490000000000002 19.645000000000003 130-134 26.68567426970788 27.425970388155264 26.45558223289316 19.432773109243698 135-139 27.445000000000004 27.005000000000003 26.200000000000003 19.35 140-144 27.055 26.455000000000002 27.105 19.384999999999998 145-149 27.794999999999998 27.175 26.21 18.82 150-151 27.474999999999998 27.3125 26.674999999999997 18.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.0 23 0.0 24 1.0 25 4.5 26 5.0 27 4.5 28 8.0 29 14.0 30 23.5 31 23.0 32 22.0 33 32.0 34 51.0 35 80.0 36 95.5 37 112.5 38 141.0 39 177.0 40 195.0 41 210.5 42 242.0 43 260.0 44 286.0 45 291.0 46 274.5 47 262.0 48 240.5 49 199.5 50 151.5 51 132.0 52 114.5 53 86.5 54 72.0 55 54.0 56 33.5 57 27.0 58 23.5 59 16.0 60 9.5 61 5.5 62 3.5 63 2.5 64 2.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.875 0.0 0.0 0.0 0.0 80-81 1.05 0.0 0.0 0.0 0.0 82-83 1.2 0.0 0.0 0.0 0.0 84-85 1.525 0.0 0.0 0.0 0.0 86-87 1.9 0.0 0.0 0.0 0.0 88-89 2.2375 0.0 0.0 0.0 0.0 90-91 2.75 0.0 0.0 0.0 0.0 92-93 3.375 0.0 0.0 0.0 0.0 94-95 4.2125 0.0 0.0 0.0 0.0 96-97 4.8625 0.0 0.0 0.0 0.0 98-99 5.35 0.0 0.0 0.0 0.0 100-101 5.800000000000001 0.0 0.0 0.0 0.0 102-103 6.4 0.0 0.0 0.0 0.0 104-105 7.3125 0.0 0.0 0.0 0.0 106-107 8.275 0.0 0.0 0.0 0.0 108-109 9.2 0.0 0.0 0.0 0.0 110-111 10.225 0.0 0.0 0.0 0.0 112-113 11.2 0.0 0.0 0.0 0.0 114-115 12.0625 0.0 0.0 0.0 0.0 116-117 12.95 0.0 0.0 0.0 0.0 118-119 13.7 0.0 0.0 0.0 0.0 120-121 14.6875 0.0 0.0 0.0 0.0 122-123 15.9375 0.0 0.0 0.0 0.0 124-125 17.075 0.0 0.0 0.0 0.0 126-127 18.575 0.0 0.0 0.0 0.0 128-129 19.75 0.0 0.0 0.0 0.0 130-131 20.7625 0.0 0.0 0.0 0.0 132-133 21.8875 0.0 0.0 0.0 0.0 134-135 22.950000000000003 0.0 0.0 0.0 0.0 136-137 23.7125 0.0 0.0 0.0 0.0 138-139 25.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGGT 10 0.006830828 145.0 5 >>END_MODULE Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202018 spots for SRR7169846.sra Written 1202018 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra Read 1202014 spots for SRR7169846.sra Written 1202014 spots for SRR7169846.sra SRR ids: ['SRR7169846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b9tpiywe SRR7169846.sra spots: 24040284 blocks: [[1, 1202014], [1202015, 2404028], [2404029, 3606042], [3606043, 4808056], [4808057, 6010070], [6010071, 7212084], [7212085, 8414098], [8414099, 9616112], [9616113, 10818126], [10818127, 12020140], [12020141, 13222154], [13222155, 14424168], [14424169, 15626182], [15626183, 16828196], [16828197, 18030210], [18030211, 19232224], [19232225, 20434238], [20434239, 21636252], [21636253, 22838266], [22838267, 24040284]] SRR7169846 file size 8124763 SRR7169846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169846 SRR7169846_1.fastq SRR7169846_2.fastq Input file: SRR7169846_1.fastq Paired file: SRR7169846_2.fastq trimmed: SRR7169846-trimmed-pair1.fastq, SRR7169846-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:09:22 2025 >> started Tue Feb 11 23:09:49 2025 >> done (26.926s) 24040284 read pairs processed; of these: 20043 ( 0.08%) short read pairs filtered out after trimming by size control 18218 ( 0.08%) empty read pairs filtered out after trimming by size control 24002023 (99.84%) read pairs available; of these: 13948313 (58.11%) trimmed read pairs available after processing 10053710 (41.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 10 0.00% 21 7 0.00% 22 9 0.00% 23 5 0.00% 24 13 0.00% 25 14 0.00% 26 18 0.00% 27 11 0.00% 28 15 0.00% 29 22 0.00% 30 27 0.00% 31 19 0.00% 32 33 0.00% 33 27 0.00% 34 22 0.00% 35 47 0.00% 36 38 0.00% 37 55 0.00% 38 82 0.00% 39 86 0.00% 40 99 0.00% 41 112 0.00% 42 137 0.00% 43 160 0.00% 44 165 0.00% 45 203 0.00% 46 217 0.00% 47 287 0.00% 48 327 0.00% 49 384 0.00% 50 478 0.00% 51 537 0.00% 52 666 0.00% 53 768 0.00% 54 795 0.00% 55 896 0.00% 56 987 0.00% 57 1213 0.01% 58 1424 0.01% 59 1755 0.01% 60 2164 0.01% 61 2552 0.01% 62 2923 0.01% 63 3347 0.01% 64 3855 0.02% 65 4265 0.02% 66 4718 0.02% 67 5245 0.02% 68 6200 0.03% 69 7296 0.03% 70 8372 0.03% 71 10084 0.04% 72 12075 0.05% 73 13794 0.06% 74 15152 0.06% 75 16506 0.07% 76 18351 0.08% 77 19843 0.08% 78 21415 0.09% 79 24111 0.10% 80 27423 0.11% 81 30946 0.13% 82 35822 0.15% 83 39576 0.16% 84 43992 0.18% 85 47661 0.20% 86 49423 0.21% 87 51360 0.21% 88 54673 0.23% 89 57226 0.24% 90 61997 0.26% 91 67268 0.28% 92 72997 0.30% 93 79486 0.33% 94 84654 0.35% 95 87884 0.37% 96 89701 0.37% 97 89587 0.37% 98 90765 0.38% 99 94331 0.39% 100 97678 0.41% 101 102089 0.43% 102 108419 0.45% 103 114670 0.48% 104 118120 0.49% 105 122555 0.51% 106 123284 0.51% 107 121689 0.51% 108 121973 0.51% 109 121672 0.51% 110 122682 0.51% 111 126788 0.53% 112 130922 0.55% 113 134487 0.56% 114 140218 0.58% 115 142363 0.59% 116 141537 0.59% 117 141541 0.59% 118 138462 0.58% 119 136041 0.57% 120 137038 0.57% 121 138848 0.58% 122 140633 0.59% 123 144819 0.60% 124 148817 0.62% 125 151186 0.63% 126 152932 0.64% 127 150809 0.63% 128 149077 0.62% 129 148271 0.62% 130 146788 0.61% 131 146649 0.61% 132 149052 0.62% 133 152552 0.64% 134 155157 0.65% 135 159913 0.67% 136 161258 0.67% 137 161435 0.67% 138 161491 0.67% 139 162714 0.68% 140 164475 0.69% 141 168277 0.70% 142 174357 0.73% 143 182561 0.76% 144 197325 0.82% 145 218562 0.91% 146 245051 1.02% 147 300631 1.25% 148 408360 1.70% 149 762234 3.18% 150 4128626 17.20% 151 10053710 41.89% 24002023 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=2.3 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=68.68 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.4 sequence=AGAAAGGAAAAACAAAAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=40.01 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.1 sequence=TGTTGGTGGTGG SRR7169846 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:10:35 Started mapping on | Feb 11 23:10:35 Finished on | Feb 11 23:12:29 Mapping speed, Million of reads per hour | 757.96 Number of input reads | 24002023 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 22924612 Uniquely mapped reads % | 95.51% Average mapped length | 278.28 Number of splices: Total | 19336388 Number of splices: Annotated (sjdb) | 18994272 Number of splices: GT/AG | 19063612 Number of splices: GC/AG | 210083 Number of splices: AT/AC | 14999 Number of splices: Non-canonical | 47694 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406818 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 41887 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 687397 687397 687397 N_multimapping 406818 406818 406818 N_noFeature 658791 22601633 826905 N_ambiguous 240350 1604 84244 UnstrandedReadsAssigned:22025471 PositiveStrandReadsAssigned:321375 NegativeStrandReadsAssigned:22013463 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=126 echo kmer=121 SRR7169846 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169846-trimmed-pair1.fastq SRR7169846-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,002,023 reads, 21,932,543 reads pseudoaligned [quant] estimated average fragment length: 182.861 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7169846.ke.tsv 34699 SRR7169846.se.tsv 87100 total ==> SRR7169846.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1836.14 383.968 11.1154 Potri.005G024800.1.v4.1 1035 853.139 62 3.86287 Potri.004G059700.1.v4.1 961 779.139 4 0.272887 Potri.007G009000.2.v4.1 1416 1234.14 0 0 Potri.003G141000.2.v4.1 2943 2761.14 388.142 7.47206 Potri.016G087400.1.v4.1 270 113.6 1409 659.282 Potri.015G069301.1.v4.1 564 384.304 0 0 Potri.010G195200.1.v4.1 1773 1591.14 13 0.434283 Potri.012G127500.1.v4.1 977 795.139 4240 283.44 ==> SRR7169846.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1662 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169846 completed mapping pipeline successfully