Starting /dee2/code/volunteer_pipeline.sh SRR7169847 current disk space = 3052236410880 free memory = 1412201864 SRR7169847 SRAfilesize c9aa99a11c21c5db4f0fa1517ae29a96 SRR7169847.sra SRR7169847.sra file validated SRR7169847 is paired end SRR7169847 is conventional basespace SRR7169847 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.03775 25.0 18.0 33.0 18.0 33.0 2 27.2425 28.0 25.0 31.0 18.0 33.0 3 29.873 31.0 29.0 33.0 27.0 33.0 4 31.71825 33.0 31.0 33.0 29.0 33.0 5 32.45475 33.0 33.0 33.0 31.0 34.0 6 36.61375 38.0 37.0 38.0 34.0 38.0 7 36.91 38.0 37.0 38.0 35.0 38.0 8 37.22025 38.0 38.0 38.0 36.0 38.0 9 37.44975 38.0 38.0 38.0 37.0 38.0 10-14 37.54215000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.52235 38.0 38.0 38.0 37.4 38.0 20-24 37.57805 38.0 38.0 38.0 37.6 38.0 25-29 37.5245 38.0 38.0 38.0 37.6 38.0 30-34 37.4341 38.0 38.0 38.0 37.2 38.0 35-39 37.4813 38.0 38.0 38.0 37.2 38.0 40-44 37.4609 38.0 38.0 38.0 37.2 38.0 45-49 37.4309 38.0 38.0 38.0 37.0 38.0 50-54 37.253 38.0 38.0 38.0 36.4 38.0 55-59 37.112899999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.9058 38.0 38.0 38.0 35.6 38.0 65-69 36.488350000000004 38.0 37.6 38.0 33.4 38.0 70-74 36.76875 38.0 38.0 38.0 34.6 38.0 75-79 36.7304 38.0 38.0 38.0 34.8 38.0 80-84 36.4539 38.0 37.8 38.0 33.4 38.0 85-89 35.99005 38.0 36.8 38.0 32.2 38.0 90-94 36.153 38.0 37.0 38.0 33.2 38.0 95-99 36.05595 38.0 37.0 38.0 33.2 38.0 100-104 35.7025 38.0 36.6 38.0 30.8 38.0 105-109 35.224000000000004 38.0 35.8 38.0 28.6 38.0 110-114 35.0631 38.0 36.0 38.0 28.0 38.0 115-119 34.076350000000005 37.8 34.0 38.0 23.6 38.0 120-124 33.602850000000004 37.8 33.4 38.0 21.0 38.0 125-129 32.242900000000006 36.8 29.8 38.0 16.2 38.0 130-134 32.622249999999994 37.2 31.4 38.0 17.4 38.0 135-139 32.285399999999996 37.0 31.2 38.0 14.4 38.0 140-144 31.2596 36.6 29.4 38.0 12.8 38.0 145-149 29.2743 36.0 27.2 38.0 3.8 38.0 150-151 22.898375 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 1.0 18 1.0 19 4.0 20 9.0 21 5.0 22 9.0 23 10.0 24 11.0 25 18.0 26 17.0 27 40.0 28 36.0 29 41.0 30 77.0 31 102.0 32 128.0 33 219.0 34 351.0 35 709.0 36 1280.0 37 923.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1204333585286 10.657596371882086 8.969513731418493 42.252456538170826 2 19.0 14.224999999999998 32.35 34.425 3 18.25 18.875 27.150000000000002 35.725 4 21.575 27.700000000000003 24.099999999999998 26.625 5 23.5 31.525 23.35 21.625 6 18.6 36.575 25.25 19.575 7 14.424999999999999 27.500000000000004 42.175000000000004 15.9 8 17.724999999999998 25.35 31.85 25.074999999999996 9 16.6 23.7 35.325 24.375 10-14 19.25 30.320000000000004 27.815 22.615 15-19 19.61 28.735 28.34 23.315 20-24 19.695 29.175 27.815 23.315 25-29 19.875 29.07 27.755000000000003 23.3 30-34 19.15 29.015 27.825 24.01 35-39 19.27 29.215000000000003 27.889999999999997 23.625 40-44 19.735 29.630000000000003 27.534999999999997 23.1 45-49 19.715 29.025000000000002 28.02 23.24 50-54 19.875 29.160000000000004 27.27 23.695 55-59 19.825 29.13 27.905 23.14 60-64 19.52 29.255 27.99 23.235 65-69 19.59 29.4 27.884999999999998 23.125 70-74 19.375 29.270000000000003 27.405 23.95 75-79 20.185 29.310000000000002 27.33 23.175 80-84 20.035 28.67 27.700000000000003 23.595 85-89 20.09 29.275000000000002 27.445000000000004 23.189999999999998 90-94 19.6 29.630000000000003 27.37 23.400000000000002 95-99 20.46 28.525 27.435 23.580000000000002 100-104 19.775000000000002 29.360000000000003 27.900000000000002 22.965 105-109 20.13 29.054999999999996 27.1 23.715 110-114 20.671705290555085 29.08553981680765 27.68406827168527 22.558686620952002 115-119 20.520781171757637 29.018527791687532 27.255883825738607 23.204807210816224 120-124 20.1351689612015 28.896120150187738 27.62453066332916 23.3441802252816 125-129 19.95995995995996 28.413413413413412 27.47747747747748 24.14914914914915 130-134 20.335 28.815 27.529999999999998 23.32 135-139 20.575 27.93 27.700000000000003 23.794999999999998 140-144 20.72 28.21 27.42 23.65 145-149 20.935000000000002 28.33 27.185 23.549999999999997 150-151 20.525 28.487499999999997 27.3125 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 2.5 25 5.0 26 6.0 27 6.5 28 12.0 29 15.5 30 16.0 31 21.0 32 30.5 33 47.0 34 65.0 35 77.5 36 88.0 37 101.5 38 130.5 39 164.5 40 194.0 41 234.0 42 276.5 43 290.0 44 282.5 45 287.5 46 291.5 47 271.0 48 230.0 49 185.0 50 157.0 51 138.0 52 105.0 53 80.5 54 59.0 55 36.0 56 26.0 57 21.0 58 15.0 59 10.0 60 7.0 61 2.5 62 1.0 63 0.5 64 1.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.105 115-119 0.15 120-124 0.125 125-129 0.1 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.775 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGATT 10 0.006832588 144.9875 2 >>END_MODULE SRR7169847 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169847_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35425 34.0 33.0 34.0 33.0 34.0 2 33.44325 34.0 33.0 34.0 33.0 34.0 3 33.47675 34.0 33.0 34.0 33.0 34.0 4 33.467 34.0 33.0 34.0 33.0 34.0 5 33.40825 34.0 33.0 34.0 33.0 34.0 6 37.618 38.0 38.0 38.0 38.0 38.0 7 37.5945 38.0 38.0 38.0 38.0 38.0 8 37.58375 38.0 38.0 38.0 38.0 38.0 9 37.481 38.0 38.0 38.0 38.0 38.0 10-14 37.17334999999999 38.0 38.0 38.0 36.6 38.0 15-19 37.47185 38.0 38.0 38.0 38.0 38.0 20-24 37.3411 38.0 38.0 38.0 37.2 38.0 25-29 37.48285 38.0 38.0 38.0 38.0 38.0 30-34 37.47834999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.2496 38.0 38.0 38.0 37.4 38.0 40-44 37.32835 38.0 38.0 38.0 37.4 38.0 45-49 37.39845 38.0 38.0 38.0 37.4 38.0 50-54 37.33875 38.0 38.0 38.0 37.0 38.0 55-59 37.32995 38.0 38.0 38.0 37.0 38.0 60-64 37.23700000000001 38.0 38.0 38.0 36.8 38.0 65-69 36.859350000000006 38.0 38.0 38.0 35.6 38.0 70-74 37.103950000000005 38.0 38.0 38.0 36.6 38.0 75-79 37.1327 38.0 38.0 38.0 36.8 38.0 80-84 36.9362 38.0 38.0 38.0 36.0 38.0 85-89 36.577600000000004 38.0 37.8 38.0 34.6 38.0 90-94 36.69775 38.0 38.0 38.0 34.8 38.0 95-99 36.63275 38.0 38.0 38.0 34.8 38.0 100-104 35.3104 38.0 36.4 38.0 28.2 38.0 105-109 35.90715 38.0 37.0 38.0 32.2 38.0 110-114 35.7789 38.0 36.8 38.0 32.0 38.0 115-119 34.662 38.0 35.0 38.0 24.2 38.0 120-124 34.8464 38.0 35.2 38.0 27.0 38.0 125-129 33.66395 38.0 33.2 38.0 21.2 38.0 130-134 33.04375 38.0 32.0 38.0 19.2 38.0 135-139 33.15745 38.0 33.0 38.0 19.6 38.0 140-144 32.5834 37.6 32.0 38.0 18.0 38.0 145-149 30.670550000000002 36.8 29.4 38.0 7.8 38.0 150-151 25.401 33.0 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 3.0 12 1.0 13 0.0 14 3.0 15 4.0 16 2.0 17 3.0 18 3.0 19 5.0 20 4.0 21 9.0 22 5.0 23 9.0 24 6.0 25 16.0 26 24.0 27 19.0 28 30.0 29 38.0 30 45.0 31 82.0 32 78.0 33 114.0 34 240.0 35 431.0 36 1000.0 37 1819.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.550000000000004 21.05 14.299999999999999 26.1 2 27.85 26.6 29.799999999999997 15.75 3 19.525000000000002 28.475 32.375 19.625 4 23.65 32.725 24.525 19.1 5 23.674999999999997 36.775000000000006 22.8 16.75 6 20.525 37.0 24.25 18.224999999999998 7 19.275000000000002 21.05 40.025 19.650000000000002 8 21.099999999999998 25.2 27.900000000000002 25.8 9 21.224999999999998 24.725 30.15 23.9 10-14 22.400000000000002 28.74 27.27 21.59 15-19 22.5 28.48 28.015 21.005 20-24 22.695 28.025 28.13 21.15 25-29 22.395 28.51 28.405 20.69 30-34 22.79 28.37 28.444999999999997 20.395 35-39 22.345000000000002 28.215 28.694999999999997 20.745 40-44 22.845 28.555000000000003 28.199999999999996 20.4 45-49 22.814999999999998 27.700000000000003 29.110000000000003 20.375 50-54 23.09 28.365000000000002 28.165000000000003 20.380000000000003 55-59 23.125 28.22 28.499999999999996 20.155 60-64 23.055 28.455000000000002 28.26 20.23 65-69 22.939999999999998 28.13 28.98 19.950000000000003 70-74 23.0 28.17 28.325 20.505000000000003 75-79 22.8 27.779999999999998 28.799999999999997 20.62 80-84 22.825 28.9 27.584999999999997 20.69 85-89 23.265 27.83 28.285 20.62 90-94 23.315 28.000000000000004 27.955000000000002 20.73 95-99 23.05 27.68 28.74 20.53 100-104 23.73 27.875 27.860000000000003 20.535 105-109 23.645 28.110000000000003 28.544999999999998 19.7 110-114 23.355 28.744999999999997 27.735 20.165 115-119 23.48 28.025 28.53 19.965 120-124 24.185000000000002 27.589999999999996 27.83 20.395 125-129 23.994798959791957 27.870574114822965 28.240648129625924 19.89397879575915 130-134 24.51 27.800000000000004 27.71 19.98 135-139 23.915 28.455000000000002 27.965 19.665 140-144 24.33 27.865000000000002 27.935 19.869999999999997 145-149 24.48 28.21 27.625 19.685 150-151 24.6875 28.1125 29.062500000000004 18.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 4.0 26 6.0 27 7.0 28 9.5 29 12.0 30 16.0 31 18.0 32 16.0 33 36.0 34 57.5 35 64.5 36 89.5 37 112.5 38 130.0 39 180.5 40 219.0 41 235.5 42 276.5 43 310.5 44 306.0 45 293.5 46 287.5 47 266.0 48 229.0 49 188.0 50 157.5 51 120.0 52 89.0 53 77.5 54 55.0 55 35.5 56 24.5 57 14.5 58 13.5 59 11.5 60 4.5 61 1.5 62 4.0 63 4.5 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03991915108641 98.0 2 0.9095502779181406 1.7999999999999998 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGTTACAAGCGCAAATCACTCGAAGCAGAAGCTTACTCATTTTAATTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.1375 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTAC 10 0.006830828 145.0 3 ATTTACA 10 0.006830828 145.0 4 >>END_MODULE Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561296 spots for SRR7169847.sra Written 561296 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra Read 561293 spots for SRR7169847.sra Written 561293 spots for SRR7169847.sra SRR ids: ['SRR7169847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xxu3k3ga SRR7169847.sra spots: 11225863 blocks: [[1, 561293], [561294, 1122586], [1122587, 1683879], [1683880, 2245172], [2245173, 2806465], [2806466, 3367758], [3367759, 3929051], [3929052, 4490344], [4490345, 5051637], [5051638, 5612930], [5612931, 6174223], [6174224, 6735516], [6735517, 7296809], [7296810, 7858102], [7858103, 8419395], [8419396, 8980688], [8980689, 9541981], [9541982, 10103274], [10103275, 10664567], [10664568, 11225863]] SRR7169847 file size 3782376 SRR7169847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169847 SRR7169847_1.fastq SRR7169847_2.fastq Input file: SRR7169847_1.fastq Paired file: SRR7169847_2.fastq trimmed: SRR7169847-trimmed-pair1.fastq, SRR7169847-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:31:45 2025 >> started Tue Feb 11 22:31:57 2025 >> done (12.524s) 11225863 read pairs processed; of these: 5308 ( 0.05%) short read pairs filtered out after trimming by size control 7178 ( 0.06%) empty read pairs filtered out after trimming by size control 11213377 (99.89%) read pairs available; of these: 5548214 (49.48%) trimmed read pairs available after processing 5665163 (50.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 2 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 0 0.00% 33 2 0.00% 34 6 0.00% 35 7 0.00% 36 6 0.00% 37 6 0.00% 38 5 0.00% 39 13 0.00% 40 7 0.00% 41 18 0.00% 42 21 0.00% 43 22 0.00% 44 13 0.00% 45 19 0.00% 46 30 0.00% 47 24 0.00% 48 23 0.00% 49 34 0.00% 50 41 0.00% 51 44 0.00% 52 59 0.00% 53 54 0.00% 54 48 0.00% 55 73 0.00% 56 81 0.00% 57 91 0.00% 58 111 0.00% 59 151 0.00% 60 161 0.00% 61 195 0.00% 62 190 0.00% 63 260 0.00% 64 262 0.00% 65 267 0.00% 66 300 0.00% 67 344 0.00% 68 391 0.00% 69 453 0.00% 70 505 0.00% 71 555 0.00% 72 690 0.01% 73 758 0.01% 74 860 0.01% 75 934 0.01% 76 1069 0.01% 77 1153 0.01% 78 1253 0.01% 79 1441 0.01% 80 1540 0.01% 81 1710 0.02% 82 1993 0.02% 83 2182 0.02% 84 2755 0.02% 85 3189 0.03% 86 3270 0.03% 87 3386 0.03% 88 3696 0.03% 89 3830 0.03% 90 4265 0.04% 91 4493 0.04% 92 4751 0.04% 93 5105 0.05% 94 5602 0.05% 95 5807 0.05% 96 6110 0.05% 97 6298 0.06% 98 6612 0.06% 99 6876 0.06% 100 7211 0.06% 101 7473 0.07% 102 7898 0.07% 103 8551 0.08% 104 8800 0.08% 105 9329 0.08% 106 9732 0.09% 107 9961 0.09% 108 9911 0.09% 109 10487 0.09% 110 10687 0.10% 111 11288 0.10% 112 11732 0.10% 113 12175 0.11% 114 12780 0.11% 115 13198 0.12% 116 13307 0.12% 117 13945 0.12% 118 14287 0.13% 119 14714 0.13% 120 14975 0.13% 121 15307 0.14% 122 16099 0.14% 123 16647 0.15% 124 17600 0.16% 125 18422 0.16% 126 19247 0.17% 127 20451 0.18% 128 20953 0.19% 129 21711 0.19% 130 22796 0.20% 131 23529 0.21% 132 25332 0.23% 133 26951 0.24% 134 29158 0.26% 135 31289 0.28% 136 33971 0.30% 137 37098 0.33% 138 40095 0.36% 139 44010 0.39% 140 48405 0.43% 141 54172 0.48% 142 61813 0.55% 143 72191 0.64% 144 86845 0.77% 145 108347 0.97% 146 141595 1.26% 147 201054 1.79% 148 319901 2.85% 149 656218 5.85% 150 2988011 26.65% 151 5665163 50.52% 11213377 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=43 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=313.15 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=35 prefix-density=0.40 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=221.12 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=24.5 sequence=GAAGAAGAAGAAA SRR7169847 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:32:40 Started mapping on | Feb 11 22:32:40 Finished on | Feb 11 22:33:34 Mapping speed, Million of reads per hour | 747.56 Number of input reads | 11213377 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10747403 Uniquely mapped reads % | 95.84% Average mapped length | 295.19 Number of splices: Total | 10516841 Number of splices: Annotated (sjdb) | 10348308 Number of splices: GT/AG | 10363682 Number of splices: GC/AG | 122952 Number of splices: AT/AC | 8894 Number of splices: Non-canonical | 21313 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184242 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 10721 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 288677 288677 288677 N_multimapping 184242 184242 184242 N_noFeature 258639 10636624 304361 N_ambiguous 111842 458 46455 UnstrandedReadsAssigned:10376922 PositiveStrandReadsAssigned:110321 NegativeStrandReadsAssigned:10396587 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169847 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169847-trimmed-pair1.fastq SRR7169847-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,213,377 reads, 10,283,940 reads pseudoaligned [quant] estimated average fragment length: 278.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7169847.ke.tsv 34699 SRR7169847.se.tsv 87100 total ==> SRR7169847.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.97 188 11.2314 Potri.005G024800.1.v4.1 1035 757.967 34 4.66546 Potri.004G059700.1.v4.1 961 683.993 3 0.456179 Potri.007G009000.2.v4.1 1416 1138.97 0 0 Potri.003G141000.2.v4.1 2943 2665.97 228 8.89499 Potri.016G087400.1.v4.1 270 74.4534 790 1103.59 Potri.015G069301.1.v4.1 564 293.915 0 0 Potri.010G195200.1.v4.1 1773 1495.97 10 0.695254 Potri.012G127500.1.v4.1 977 699.987 4363 648.277 ==> SRR7169847.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 832 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169847 completed mapping pipeline successfully