Starting /dee2/code/volunteer_pipeline.sh SRR7169848 current disk space = 2796497272832 free memory = 1571460896 SRR7169848_1.fastq is conventional basespace SRR7169848_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 10782558 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 1.0782558E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.715870427853055 11.36814717647147 9.766975780836901 40.14900661483857 2 20.316117910234993 14.64286830578352 34.09431190138476 30.946701882596727 3 19.071845627828043 19.5435350771718 27.086048630544006 34.29857066445614 4 21.918150730921585 27.952482863055057 23.279850632763004 26.849515773260357 5 22.201716883878575 31.766840484419372 24.765987811055595 21.265454820646454 6 19.628978578181542 35.04927123971881 25.08413124232673 20.23761893977292 7 14.579564515210583 26.0360018466861 41.29141712013049 18.093016517972824 8 18.149867591716177 25.797765242718846 30.583178870913564 25.469188294651417 9 17.231319321444875 24.65739576823978 33.76786844086533 24.343416469450013 10-14 19.73764296004714 29.69175959916005 27.23524232376028 23.335355117032528 15-19 19.723790959436528 28.59501057170293 27.877882038751846 23.8033164301087 20-24 19.87378162707485 28.72519639968809 27.66444387221732 23.736578101019738 25-29 19.837834268466114 28.913218602195833 27.502658492624942 23.74628863671311 30-34 19.857231523766913 28.742763081715182 27.606829355779176 23.79317603873872 35-39 19.946625932309082 28.677085183971812 27.473694238643446 23.902594645075656 40-44 20.01044733800811 28.755463178364238 27.524052118869058 23.710037364758595 45-49 20.090758987142628 28.579233383358254 27.443839934399517 23.8861676950996 50-54 20.04496262691938 28.671562662281364 27.513019792845228 23.77045491795403 55-59 20.094877954530233 28.66035921466608 27.366721362593932 23.87804146820976 60-64 20.036841729802905 28.602961249743057 27.463977092777526 23.896219927676515 65-69 20.11973377975795 28.492289498422075 27.539090239998988 23.84888648182099 70-74 20.14307746276767 28.64103269345659 27.45730313335911 23.758586710416623 75-79 20.219134412725452 28.425162432592256 27.46003599581448 23.895667158867813 80-84 20.18474754722043 28.520984365810094 27.3949255072622 23.899342579707277 85-89 20.260287477643683 28.43618533813595 27.484566629272955 23.818960554947417 90-94 20.25786446976037 28.506518561446658 27.336353749328868 23.899263219464103 95-99 20.25580224396962 28.335083152314432 27.557375452221056 23.851739151494897 100-104 20.426596093357592 28.45394083901564 27.387772462592803 23.731690605033968 105-109 20.425341159553582 28.256116011490278 27.500136480330777 23.818406348625356 110-114 20.47039791377448 28.359648574159557 27.416076766190184 23.75387674587578 115-119 20.47418618105277 28.38335022171919 27.402883434524533 23.739580162703508 120-124 20.535930557849127 28.29281269390712 27.362019557124643 23.809237191119106 125-129 20.505450404739086 28.12541282162526 27.49592627017366 23.873210503461998 130-134 20.655730260569065 28.13518194995296 27.43921365733523 23.769874132142746 135-139 20.600182883913902 28.08926747214806 27.45564744186873 23.854902202069304 140-144 20.70453071994081 28.035315403975915 27.384759507037394 23.875394369045882 145-149 20.656208384376885 28.136687558932522 27.3913214045145 23.815782652176097 150-151 20.48052975926492 28.08637338190066 27.38339547999649 24.049701378837934 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 790.0 1 549.5 2 284.0 3 272.0 4 268.5 5 255.5 6 250.5 7 249.5 8 263.0 9 261.0 10 247.5 11 254.5 12 270.0 13 286.0 14 329.0 15 426.5 16 538.0 17 710.5 18 932.0 19 1156.5 20 1518.0 21 2047.5 22 2791.5 23 3906.5 24 5646.0 25 8135.0 26 11865.5 27 17384.5 28 24418.5 29 33931.0 30 46359.0 31 62386.5 32 82320.5 33 106953.5 34 137070.5 35 176176.0 36 223432.5 37 275836.0 38 337382.5 39 410864.5 40 489933.5 41 566711.5 42 637799.0 43 697058.0 44 736492.0 45 749184.5 46 740198.0 47 712694.0 48 659748.5 49 583761.0 50 493112.0 51 406138.0 52 333056.0 53 268321.5 54 206219.5 55 147318.5 56 101470.0 57 73677.5 58 54310.0 59 38210.5 60 27153.5 61 19161.5 62 14459.5 63 10766.5 64 8022.0 65 6751.5 66 5593.0 67 4813.5 68 4206.0 69 3305.5 70 2204.5 71 881.5 72 413.0 73 391.0 74 255.0 75 67.0 76 40.5 77 17.0 78 7.5 79 3.5 80 2.0 81 2.0 82 1.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.008244796828359281 2 0.006445594820820811 3 0.023964628801440253 4 5.5645422913560956E-5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.004770667591122626 25-29 0.0012241993040983412 30-34 0.011522312237968022 35-39 0.0022554944754296707 40-44 9.125849357823997E-4 45-49 0.0018437183458693196 50-54 0.003327596290230945 55-59 0.0014708940123484614 60-64 2.225816916542438E-5 65-69 0.002201703899946562 70-74 0.002919529855531498 75-79 0.011067874617507275 80-84 0.006382530008185442 85-89 0.014851763375629419 90-94 2.374204710978601E-4 95-99 0.01691435371829208 100-104 0.012720543678040035 105-109 0.007276566469663321 110-114 5.675833137183218E-4 115-119 0.0 120-124 1.0943599839666989E-4 125-129 5.193572805265689E-4 130-134 0.00850818516348347 135-139 0.0038747762822142944 140-144 0.0025188828105538593 145-149 9.181494780737558E-4 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 1.0782558E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 45.962068330863836 #Duplication Level Percentage of deduplicated Percentage of total 1 70.63020163493475 32.46310153767561 2 14.537255764592171 13.363246855908592 3 5.340089436804557 7.363246667620056 4 2.73966109058833 5.03681960996119 5 1.5570045329382027 3.57815743671852 6 1.0310102633689864 2.843241850487236 7 0.7271008352419642 2.3393340790973527 8 0.5448916002880633 2.003547597228297 9 0.4098314685187234 1.695303176417625 >10 2.266096376554103 18.849840024768096 >50 0.1491917785140728 4.682791436052466 >100 0.06550150425543197 5.0912461260824315 >500 0.002002310746049076 0.602187900398649 >1k 1.6140265465252807E-4 0.08793570158383401 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 8.346813437034144E-5 2.7822711456780478E-5 0.0 0.0 0.0 2 8.346813437034144E-5 6.491966006582111E-5 0.0 0.0 0.0 3 1.0201660867486175E-4 6.491966006582111E-5 0.0 0.0 0.0 4 2.3185592880650398E-4 6.491966006582111E-5 0.0 0.0 0.0 5 2.3185592880650398E-4 6.491966006582111E-5 0.0 0.0 0.0 6 2.504044031110243E-4 6.491966006582111E-5 0.0 2.7822711456780478E-5 0.0 7 2.689528774155446E-4 6.491966006582111E-5 0.0 6.491966006582111E-5 0.0 8 2.967755888723251E-4 6.491966006582111E-5 0.0 1.1129084582712191E-4 0.0 9 3.0604982602458524E-4 6.491966006582111E-5 0.0 1.5766203158842272E-4 0.0 10-11 3.524210117858861E-4 7.419389721808128E-5 0.0 1.854847430452032E-4 0.0 12-13 4.2197779042783725E-4 8.346813437034144E-5 0.0 2.3185592880650398E-4 0.0 14-15 4.4516338330848765E-4 8.346813437034144E-5 0.0 2.5967864026328445E-4 0.0 16-17 4.776232133413982E-4 1.0201660867486175E-4 0.0 2.875013517200649E-4 0.0 18-19 5.379057548310892E-4 1.1129084582712191E-4 0.0 2.967755888723251E-4 0.0 20-21 5.564542291356095E-4 1.1129084582712191E-4 0.0 2.967755888723251E-4 0.0 22-23 5.703655848639998E-4 1.1129084582712191E-4 0.0 3.245983003291056E-4 0.0 24-25 6.120996520491706E-4 1.2983932013164223E-4 0.0 3.245983003291056E-4 0.0 26-27 6.35285244929821E-4 1.344764387077723E-4 0.0 3.245983003291056E-4 0.0 28-29 6.538337192343413E-4 1.3911355728390238E-4 0.0 3.245983003291056E-4 0.0 30-31 6.862935492672518E-4 1.4375067586003246E-4 0.0 3.524210117858861E-4 0.0 32-33 7.141162607240323E-4 1.5302491301229265E-4 0.0 3.848808418187966E-4 0.0 34-35 7.512132093330729E-4 1.5766203158842272E-4 0.0 4.2661490900396733E-4 0.0 36-37 8.022215136705038E-4 1.5766203158842272E-4 0.0 4.312520275800974E-4 0.0 38-39 9.227865966498858E-4 1.5766203158842272E-4 0.0 4.358891461562275E-4 0.0 40-41 0.0010433516796292679 1.854847430452032E-4 0.0 4.358891461562275E-4 0.0 42-43 0.0011500054068802597 2.086703359258536E-4 0.0 4.358891461562275E-4 0.0 44-45 0.0012937560827402921 2.5967864026328445E-4 0.0 4.358891461562275E-4 0.0 46-47 0.0014282325214480646 2.5967864026328445E-4 0.0 4.358891461562275E-4 0.0 48-49 0.0015580718415797068 2.5967864026328445E-4 0.0 4.358891461562275E-4 0.0 50-51 0.0017064596360158693 2.5967864026328445E-4 0.0 4.358891461562275E-4 0.0 52-53 0.0019475898019746334 2.8286423314393484E-4 0.0 4.4052626473235757E-4 0.0 54-55 0.002295373695184389 3.1532406317684545E-4 0.0 4.4516338330848765E-4 0.0 56-57 0.002786908264254178 3.292354189052357E-4 0.0 4.6834897618913804E-4 0.0 58-59 0.003408282153455609 3.524210117858861E-4 0.0 4.8689745049365835E-4 0.0 60-61 0.0041734067185170715 3.895179603949267E-4 0.0 4.915345690697884E-4 0.0 62-63 0.005323412125397331 4.358891461562275E-4 0.0 5.286315176788291E-4 0.0 64-65 0.006751644646845396 4.4516338330848765E-4 0.0 5.610913477117396E-4 0.0 66-67 0.008444192927132875 4.544376204607478E-4 0.0 5.981882963207802E-4 0.0 68-69 0.01046133950774946 4.6371185761300796E-4 0.0 6.074625334730404E-4 0.0 70-71 0.013512563530843052 4.729860947652681E-4 0.0 6.120996520491705E-4 0.0 72-73 0.017727704316545294 5.100830433743087E-4 0.0 6.167367706253006E-4 0.0 74-75 0.023565836603893067 5.379057548310892E-4 0.0 6.213738892014306E-4 0.0 76-77 0.03018300481203069 5.379057548310892E-4 0.0 6.35285244929821E-4 0.0 78-79 0.038024372324266656 5.471799919833494E-4 0.0 6.491966006582112E-4 0.0 80-81 0.04805909692301215 5.8427694059239E-4 0.0 6.677450749627315E-4 0.0 82-83 0.06178496790835718 5.889140591685201E-4 0.0 6.816564306911218E-4 0.0 84-85 0.07904432324871334 6.074625334730404E-4 0.0 7.141162607240323E-4 0.0 86-87 0.09976760616543867 6.306481263536909E-4 0.0 7.280276164524225E-4 0.0 88-89 0.12393626818422865 6.445594820820811E-4 0.0 7.419389721808128E-4 0.0 90-91 0.15180998794534656 6.862935492672518E-4 0.0 7.604874464853331E-4 0.0 92-93 0.18463151322719526 7.187533793001624E-4 0.0 7.883101579421136E-4 0.0 94-95 0.22409339231006226 7.373018536046827E-4 0.0 7.883101579421136E-4 0.0 96-97 0.2703161902769269 7.55850327909203E-4 0.0 7.883101579421136E-4 0.0 98-99 0.32142651122303256 7.790359207898534E-4 0.0 7.883101579421136E-4 0.0 100-101 0.3759358400854417 8.254071065511542E-4 0.0 7.929472765182436E-4 0.0 102-103 0.4368119327528774 8.810525294647151E-4 0.0 8.16132869398894E-4 0.0 104-105 0.5048570107390101 9.691577824111866E-4 0.0 8.16132869398894E-4 0.0 106-107 0.5816569685968765 0.0010062547310202273 0.0 8.207699879750241E-4 0.0 108-109 0.6633027153667989 0.0010248032053247476 0.0 8.346813437034143E-4 0.0 110-111 0.7480646058198805 0.0010294403239008776 0.0 8.346813437034143E-4 0.0 112-113 0.8377279306079318 0.0010294403239008776 0.0 8.346813437034143E-4 0.0 114-115 0.9368834371213213 0.0010433516796292679 0.0 8.346813437034143E-4 0.0 116-117 1.041965181175005 0.0010711743910860484 0.0 8.485926994318046E-4 0.0 118-119 1.1515031961803497 0.0011592796440325198 0.0 8.625040551601948E-4 0.0 120-121 1.263869853517134 0.001224199304098341 0.0 8.671411737363249E-4 0.0 122-123 1.3804145546910112 0.0012520220155551214 0.0 8.764154108885851E-4 0.0 124-125 1.5033399310256435 0.0012659333712835119 0.0 9.042381223453655E-4 0.0 126-127 1.6354838990896226 0.0012937560827402923 0.0 9.645206638350565E-4 0.0 128-129 1.7730857557177062 0.0013169416756209427 0.0 9.645206638350565E-4 0.0 130-131 1.9112718892863827 0.0013169416756209427 0.0 9.737949009873167E-4 0.0 132-133 2.0524628756923917 0.0013169416756209427 0.0 9.87706256715707E-4 0.0 134-135 2.2008182102985208 0.001330853031349333 0.0 0.001052625916781528 0.0 136-137 2.3559112781957676 0.0013401272685015931 0.0 0.0010711743910860484 0.0 138-139 2.51789974141572 0.0013725870985345037 0.0 0.0010897228653905687 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGAT 2160 0.0 14.772563 1 GCCCGAC 1045 0.0 13.879398 1 GTCCGTT 1620 0.0 13.429603 1 GTCCGGA 1735 0.0 13.375421 1 GCGGGAT 2060 0.0 11.617259 1 GCCCTAT 2215 0.0 11.45912 1 GTCGGCT 1710 0.0 11.450504 1 GTCGGTT 2375 0.0 11.297831 1 CGCGGTA 1380 3.6379788E-12 11.030769 4 CCCGAAT 3100 0.0 10.994946 1 CCCCGAT 2600 0.0 10.877978 1 GTCCGCT 2460 0.0 10.612661 1 CCGGTAT 3790 0.0 10.52399 1 GTCCGGG 1265 1.0040822E-9 10.319031 1 GCCCGTT 2120 0.0 10.262244 1 CCCGACT 4340 0.0 10.1928835 1 GCCTTAT 6700 0.0 10.174428 1 CCCGTAC 1570 3.6379788E-12 10.162018 1 GTCCCGC 1075 1.05792424E-7 10.11905 1 GTCCGCC 1040 7.313356E-7 9.762288 1 >>END_MODULE SRR7169848 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169848_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 10782558 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 1.0782558E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.02180370863004 21.19091107740857 14.373625292803064 27.413659921158324 2 25.600234008745463 26.984226204249605 30.141535782554385 17.274004004450543 3 20.06790465747601 29.11756498116248 30.867071193606733 19.947459167754776 4 22.897815155272173 34.140078823900424 23.5268996139709 19.435206406856505 5 23.709191654828416 35.783586169683026 22.488023944043015 18.01919823144554 6 20.556605358251083 37.532207115018835 23.4211893437498 18.489998182980287 7 19.76553613206686 21.80939888593814 38.26860733363459 20.15645764836041 8 21.81105619361463 25.491312699235657 27.312228072599922 25.385403034549793 9 21.317566759205008 25.270645425695832 29.737331345678825 23.674456469420335 10-14 22.96562873972466 28.77747992717628 26.462729488500642 21.794161844598413 15-19 22.70607132926977 27.97871706049399 27.917714590969155 21.397497019267085 20-24 22.677950439435776 28.206524479908197 27.740669381294303 21.374855699361724 25-29 22.81063612835639 28.237894341505065 27.695339959203825 21.25612957093472 30-34 22.70990281222395 28.174111152635945 27.898109310768593 21.21787672437151 35-39 22.745536236421575 28.152892812409934 27.83298506432463 21.26858588684386 40-44 22.907674400852354 28.12239291575217 27.903913771823262 21.06601891157221 45-49 22.90144893993642 27.999142132530952 27.988646076919704 21.110762850612925 50-54 22.934633439572085 28.119942116887458 27.89645543941036 21.048969004130093 55-59 23.21753337072756 27.88136612782684 27.947549637864427 20.953550863581178 60-64 23.067029204897324 27.927958512613742 28.144692275863868 20.860320006625063 65-69 23.20971401849708 27.871075436100785 28.042184279652083 20.877026265750054 70-74 23.281008796044535 27.83396554621297 27.94437755974053 20.94064809800197 75-79 23.240416857352876 27.745073032887742 28.137223871852335 20.877286237907043 80-84 23.332068069863766 27.90380099566131 27.89868107506312 20.865449859411804 85-89 23.49371241308066 27.82888728908164 27.89909037978731 20.77830991805039 90-94 23.44268411748268 27.8260803433378 27.98409334092984 20.747142198249684 95-99 23.470389557532922 27.870902459936058 27.88222646712251 20.776481515408506 100-104 23.679898343791567 27.86176225059632 27.74968475944453 20.70865464616758 105-109 23.616192612044813 27.772145886795137 27.86597843389777 20.745683067262284 110-114 23.718178116592696 27.8978876761172 27.657974204148765 20.725960003141335 115-119 23.895905807472076 27.89087723982611 27.593722294028982 20.619494658672828 120-124 23.84227531920769 27.848179538552763 27.625657235952488 20.683887906287058 125-129 23.914735668008568 27.95049973740209 27.50467875423373 20.63008584035561 130-134 24.136905325558704 27.866884506449928 27.448851448776214 20.54735871921515 135-139 24.010565312046403 27.812120367527406 27.595526573663285 20.581787746762902 140-144 24.102726381621455 27.93661990706447 27.447125677023106 20.513528034290974 145-149 24.258295909554803 27.847774937351865 27.451698305400107 20.44223084769322 150-151 24.334104313312903 27.620701044394902 27.639697211761572 20.405497430530623 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 22.0 1 18.0 2 12.0 3 12.5 4 18.5 5 27.5 6 38.5 7 53.5 8 75.0 9 89.5 10 108.5 11 136.5 12 156.5 13 190.0 14 264.0 15 335.5 16 387.5 17 497.0 18 631.5 19 776.5 20 999.5 21 1343.5 22 1871.5 23 2683.5 24 3782.5 25 5158.5 26 6967.0 27 9616.0 28 13833.0 29 19622.0 30 27981.5 31 39394.5 32 57159.5 33 85976.0 34 118048.5 35 155984.5 36 209329.5 37 278432.0 38 358642.5 39 449207.0 40 545613.5 41 631752.0 42 707645.0 43 765628.0 44 788394.0 45 784775.5 46 763811.0 47 718071.0 48 645875.5 49 554821.5 50 459326.0 51 377363.5 52 308565.5 53 241438.0 54 177993.0 55 126789.0 56 91205.0 57 66726.0 58 48250.5 59 34105.0 60 23878.5 61 17163.5 62 13716.5 63 11455.5 64 7929.5 65 4959.5 66 3661.5 67 2948.0 68 2471.5 69 2105.5 70 1530.5 71 900.0 72 576.5 73 377.0 74 242.5 75 120.0 76 82.0 77 83.5 78 76.5 79 39.0 80 24.5 81 21.5 82 17.5 83 16.0 84 13.5 85 10.0 86 9.0 87 6.5 88 5.5 89 5.0 90 8.5 91 12.0 92 7.5 93 5.5 94 5.5 95 5.0 96 6.0 97 5.5 98 6.0 99 7.5 100 13.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.048810310132345214 2 5.100830433743087E-4 3 8.068586322466339E-4 4 0.040389302798092996 5 0.0038859053667970067 6 0.010823034756687607 7 0.010294403239008777 8 0.006751644646845396 9 0.0 10-14 0.009418915251835417 15-19 0.027770775728727822 20-24 0.030849822463278193 25-29 0.02981296274965551 30-34 0.012293928769036068 35-39 0.0088086704472167 40-44 0.010359322899074598 45-49 0.03033232003018208 50-54 0.011539005864842092 55-59 0.017871454992405326 60-64 0.01559184750037978 65-69 0.004933894165002405 70-74 0.013770387323675885 75-79 0.016298544371382003 80-84 0.01058004974329839 85-89 0.009101736341228121 90-94 0.0037746145209698848 95-99 0.0014449261483221328 100-104 0.02499406912534113 105-109 0.0449596468667268 110-114 0.02245663784048275 115-119 0.022172846183623588 120-124 0.021657198597957925 125-129 0.009789884737925823 130-134 0.004119616143033963 135-139 0.0023612207789654367 140-144 0.002272188102303739 145-149 0.012158524906613068 150-151 0.03772759673539433 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 1.0782558E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 45.469739387928186 #Duplication Level Percentage of deduplicated Percentage of total 1 69.29403282759239 31.507816138091666 2 15.226678042893434 13.847061647085058 3 5.731139695237267 7.817802850147461 4 2.8100177157297357 5.110830928387694 5 1.6848263857267107 3.8304308336449253 6 1.0557273946506787 2.8802189699677663 7 0.7417902184436561 2.361030553920316 8 0.5522613884680723 2.008894512612689 9 0.39452307379285656 1.6144975213096995 >10 2.299585035594496 18.927916464437665 >50 0.14860549411098906 4.6149308426573725 >100 0.0582982844996065 4.507300874194168 >500 0.0020249021523142917 0.5828252542915245 >1k 4.895411079178647E-4 0.3884426092520443 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 8.346813437034144E-5 0.0 0.0 0.0 0.0 2 8.346813437034144E-5 0.0 0.0 4.63711857613008E-5 0.0 3 8.346813437034144E-5 0.0 0.0 5.5645422913560956E-5 0.0 4 1.1129084582712191E-4 0.0 0.0 7.419389721808127E-5 0.0 5 1.1129084582712191E-4 0.0 0.0 1.1129084582712191E-4 0.0 6 1.1129084582712191E-4 0.0 0.0 1.3911355728390238E-4 0.0 7 1.1129084582712191E-4 0.0 0.0 1.3911355728390238E-4 0.0 8 1.2983932013164223E-4 0.0 0.0 1.4838779443616254E-4 0.0 9 1.2983932013164223E-4 0.0 0.0 1.4838779443616254E-4 0.0 10-11 1.344764387077723E-4 0.0 0.0 1.4838779443616254E-4 0.0 12-13 1.5302491301229265E-4 9.274237152260159E-6 0.0 1.7621050589294304E-4 0.0 14-15 1.7157338731681296E-4 9.274237152260159E-6 0.0 1.9012186162133327E-4 0.0 16-17 1.9939609877359343E-4 9.274237152260159E-6 0.0 2.040332173497235E-4 0.0 18-19 2.2258169165424382E-4 9.274237152260159E-6 0.0 2.1330745450198367E-4 0.0 20-21 2.4113016595876414E-4 1.3911355728390239E-5 0.0 2.5504152168715437E-4 0.0 22-23 2.5504152168715437E-4 1.8548474304520317E-5 0.0 2.735899959916747E-4 0.0 24-25 2.92138470296195E-4 1.8548474304520317E-5 0.0 2.967755888723251E-4 0.0 26-27 3.1532406317684545E-4 1.8548474304520317E-5 0.0 3.1532406317684545E-4 0.0 28-29 3.245983003291056E-4 1.8548474304520317E-5 0.0 3.245983003291056E-4 0.0 30-31 3.524210117858861E-4 1.8548474304520317E-5 0.0 3.292354189052357E-4 0.0 32-33 3.8024372324266655E-4 2.7822711456780478E-5 0.0 3.3850965605749584E-4 0.0 34-35 4.2661490900396733E-4 3.2459830032910556E-5 4.637118576130079E-6 3.431467746336259E-4 0.0 36-37 4.729860947652681E-4 3.7096948609040635E-5 2.7822711456780478E-5 3.431467746336259E-4 0.0 38-39 5.935511777446502E-4 3.7096948609040635E-5 2.7822711456780478E-5 3.431467746336259E-4 0.0 40-41 7.094791421479022E-4 4.63711857613008E-5 2.7822711456780478E-5 3.524210117858861E-4 0.0 42-43 8.11495750822764E-4 4.63711857613008E-5 2.7822711456780478E-5 3.7560660466653647E-4 0.0 44-45 9.598835452589265E-4 6.491966006582111E-5 2.7822711456780478E-5 4.0342931612331694E-4 0.0 46-47 0.0010989971025428288 6.491966006582111E-5 2.7822711456780478E-5 4.08066434699447E-4 0.0 48-49 0.0012195621855222109 6.491966006582111E-5 2.7822711456780478E-5 4.4516338330848765E-4 0.0 50-51 0.0013586757428061134 6.491966006582111E-5 2.7822711456780478E-5 4.6834897618913804E-4 0.0 52-53 0.0015998059087648775 6.491966006582111E-5 2.7822711456780478E-5 5.100830433743087E-4 0.0 54-55 0.0019568640391268936 6.491966006582111E-5 2.7822711456780478E-5 5.610913477117396E-4 0.0 56-57 0.002443761489620552 6.955677864195119E-5 2.7822711456780478E-5 5.703655848639998E-4 0.0 58-59 0.0030512240230935925 7.419389721808127E-5 2.7822711456780478E-5 5.935511777446502E-4 0.0 60-61 0.003839534181035706 8.346813437034144E-5 2.7822711456780478E-5 6.260110077775608E-4 0.0 62-63 0.005021999417948876 8.346813437034144E-5 2.7822711456780478E-5 6.584708378104714E-4 0.0 64-65 0.0064687804137014615 8.346813437034144E-5 2.7822711456780478E-5 6.631079563866014E-4 0.0 66-67 0.008170602931141201 8.346813437034144E-5 2.7822711456780478E-5 6.723821935388616E-4 0.0 68-69 0.010210935104638434 8.346813437034144E-5 2.7822711456780478E-5 6.816564306911218E-4 0.0 70-71 0.013266796246308159 8.346813437034144E-5 2.7822711456780478E-5 7.326647350285526E-4 0.0 72-73 0.017514396862043313 9.27423715226016E-5 2.7822711456780478E-5 7.883101579421136E-4 0.0 74-75 0.02332006931935817 1.0665372725099183E-4 2.7822711456780478E-5 7.975843950943737E-4 0.0 76-77 0.029969697357528705 1.1129084582712191E-4 2.7822711456780478E-5 8.022215136705038E-4 0.0 78-79 0.03784816181837371 1.1129084582712191E-4 2.7822711456780478E-5 8.578669365840647E-4 0.0 80-81 0.04789216065427146 1.1592796440325199E-4 2.7822711456780478E-5 8.856896480408452E-4 0.0 82-83 0.06163658011392102 1.2056508297938207E-4 2.7822711456780478E-5 9.413350709544062E-4 0.0 84-85 0.07881246731990683 1.2056508297938207E-4 2.7822711456780478E-5 9.645206638350565E-4 0.0 86-87 0.0995867585409696 1.2983932013164223E-4 2.7822711456780478E-5 9.784320195634468E-4 0.0 88-89 0.1238203402198254 1.2983932013164223E-4 2.7822711456780478E-5 9.830691381395769E-4 0.0 90-91 0.15165232591375813 1.2983932013164223E-4 2.7822711456780478E-5 0.0010155289681724874 0.0 92-93 0.18449239966991135 1.3911355728390238E-4 2.7822711456780478E-5 0.0010572630353576581 0.0 94-95 0.2239821014642351 1.3911355728390238E-4 2.7822711456780478E-5 0.0011221826954234792 0.0 96-97 0.2702883675654701 1.3911355728390238E-4 3.7096948609040635E-5 0.0011221826954234792 0.0 98-99 0.3217047383376004 1.3911355728390238E-4 3.7096948609040635E-5 0.0011268198139996093 0.0 100-101 0.376802981259178 1.3911355728390238E-4 3.7096948609040635E-5 0.0011546425254563898 0.0 102-103 0.43830508493439124 1.4375067586003246E-4 3.7096948609040635E-5 0.0011824652369131702 0.0 104-105 0.5072497639242932 1.4838779443616254E-4 3.7096948609040635E-5 0.0012010137112176906 0.0 106-107 0.5854223088806942 1.4838779443616254E-4 3.7096948609040635E-5 0.0012102879483699507 0.0 108-109 0.6689089917253401 1.4838779443616254E-4 3.7096948609040635E-5 0.001279844727011902 0.0 110-111 0.7552614138500344 1.4838779443616254E-4 5.5645422913560956E-5 0.0012937560827402923 0.0 112-113 0.8464271650567519 1.4838779443616254E-4 5.5645422913560956E-5 0.0013076674384686826 0.0 114-115 0.946426627150997 1.5766203158842272E-4 5.5645422913560956E-5 0.0013401272685015931 0.0 116-117 1.0524682547499395 1.5766203158842272E-4 5.5645422913560956E-5 0.0013540386242299834 0.0 118-119 1.1632258319408066 1.5766203158842272E-4 5.5645422913560956E-5 0.001386498454262894 0.0 120-121 1.2762880570640103 1.5766203158842272E-4 5.5645422913560956E-5 0.0014050469285674142 0.0 122-123 1.3940430461862574 1.5766203158842272E-4 5.5645422913560956E-5 0.0014096840471435443 0.0 124-125 1.5182946384336629 1.5766203158842272E-4 5.5645422913560956E-5 0.0014096840471435443 0.0 126-127 1.6516767171574687 1.5766203158842272E-4 5.5645422913560956E-5 0.0014189582842958045 0.0 128-129 1.7901596263150172 1.6693626874068288E-4 5.5645422913560956E-5 0.0014421438771764549 0.0 130-131 1.9292917320732244 1.6693626874068288E-4 5.5645422913560956E-5 0.001451418114328715 0.0 132-133 2.072105709980878 1.6693626874068288E-4 5.5645422913560956E-5 0.001456055232904845 0.0 134-135 2.222413271507559 1.8084762446907312E-4 5.5645422913560956E-5 0.001456055232904845 0.0 136-137 2.3801402227560473 1.854847430452032E-4 5.5645422913560956E-5 0.0014746037072093654 0.0 138-139 2.5440994613708545 1.854847430452032E-4 5.5645422913560956E-5 0.001567346078731967 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGGCG 1620 0.0 23.26463 6 GGCGTCT 3450 0.0 19.542515 9 GCGGGAC 1240 0.0 19.294477 2 AGGCGTC 3545 0.0 19.017838 8 AGCGCAA 4365 0.0 15.444112 7 TAGGCGT 2420 0.0 15.27633 7 GCGCAAA 4685 0.0 14.544965 8 TACCCGC 1810 0.0 14.018644 9 TGCACGC 2695 0.0 13.9850645 5 CTACCCG 2005 0.0 13.01615 8 CTGCACG 3260 0.0 12.454067 4 CGGGACT 2010 0.0 11.903061 3 GCACGCA 3270 0.0 11.747242 6 CATAGGC 3315 0.0 10.93217 5 CGCAAAT 6495 0.0 10.603788 9 ACGCAAA 4025 0.0 10.4461565 8 ACAAGCG 6800 0.0 10.235359 4 CGTAGAT 2030 0.0 10.004565 1 GGCGGGA 3495 0.0 9.754094 1 CACGCAA 4000 0.0 9.604618 7 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169848 SRR7169848_1.fastq SRR7169848_2.fastq Input file: SRR7169848_1.fastq Paired file: SRR7169848_2.fastq trimmed: SRR7169848-trimmed-pair1.fastq, SRR7169848-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Apr 15 04:21:49 2025 >> started Tue Apr 15 04:22:02 2025 >> done (13.019s) 10782558 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1508 ( 0.01%) empty read pairs filtered out after trimming by size control 10781029 (99.99%) read pairs available; of these: 402145 ( 3.73%) trimmed read pairs available after processing 10378884 (96.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 3 0.00% 34 2 0.00% 35 2 0.00% 36 5 0.00% 37 8 0.00% 38 6 0.00% 39 8 0.00% 40 3 0.00% 41 6 0.00% 42 7 0.00% 43 7 0.00% 44 10 0.00% 45 5 0.00% 46 9 0.00% 47 7 0.00% 48 4 0.00% 49 7 0.00% 50 14 0.00% 51 12 0.00% 52 16 0.00% 53 21 0.00% 54 20 0.00% 55 30 0.00% 56 29 0.00% 57 33 0.00% 58 36 0.00% 59 42 0.00% 60 51 0.00% 61 68 0.00% 62 72 0.00% 63 87 0.00% 64 72 0.00% 65 97 0.00% 66 107 0.00% 67 103 0.00% 68 135 0.00% 69 176 0.00% 70 183 0.00% 71 233 0.00% 72 282 0.00% 73 320 0.00% 74 348 0.00% 75 353 0.00% 76 402 0.00% 77 424 0.00% 78 483 0.00% 79 552 0.01% 80 622 0.01% 81 783 0.01% 82 842 0.01% 83 953 0.01% 84 1033 0.01% 85 1174 0.01% 86 1188 0.01% 87 1335 0.01% 88 1461 0.01% 89 1499 0.01% 90 1669 0.02% 91 1818 0.02% 92 1934 0.02% 93 2213 0.02% 94 2331 0.02% 95 2560 0.02% 96 2744 0.03% 97 2803 0.03% 98 2940 0.03% 99 2998 0.03% 100 3124 0.03% 101 3351 0.03% 102 3699 0.03% 103 3701 0.03% 104 4069 0.04% 105 4325 0.04% 106 4448 0.04% 107 4606 0.04% 108 4638 0.04% 109 4740 0.04% 110 4821 0.04% 111 4933 0.05% 112 5302 0.05% 113 5479 0.05% 114 5724 0.05% 115 5834 0.05% 116 5873 0.05% 117 6067 0.06% 118 6315 0.06% 119 6128 0.06% 120 6284 0.06% 121 6485 0.06% 122 6698 0.06% 123 6781 0.06% 124 7122 0.07% 125 7363 0.07% 126 7539 0.07% 127 7640 0.07% 128 7719 0.07% 129 7666 0.07% 130 7619 0.07% 131 7922 0.07% 132 7994 0.07% 133 8295 0.08% 134 8511 0.08% 135 8647 0.08% 136 8925 0.08% 137 9032 0.08% 138 9056 0.08% 139 9034 0.08% 140 8982 0.08% 141 9245 0.09% 142 9343 0.09% 143 9410 0.09% 144 9892 0.09% 145 10135 0.09% 146 10064 0.09% 147 10260 0.10% 148 10596 0.10% 149 10253 0.10% 150 10638 0.10% 151 10378884 96.27% 10781029 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=35 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=6 fanout-score=55.71 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=14.4 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=37 prefix-density=0.39 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.16 sequence-density-rank=15 fanout-score=36.39 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.1 sequence=TGTTGGTGGTGGTACTGGA SRR7169848 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 15 04:23:03 Started mapping on | Apr 15 04:23:04 Finished on | Apr 15 04:24:14 Mapping speed, Million of reads per hour | 554.45 Number of input reads | 10781029 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 10112683 Uniquely mapped reads % | 93.80% Average mapped length | 298.86 Number of splices: Total | 9798739 Number of splices: Annotated (sjdb) | 9644693 Number of splices: GT/AG | 9663492 Number of splices: GC/AG | 108555 Number of splices: AT/AC | 8039 Number of splices: Non-canonical | 18653 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 188685 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 73055 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 479661 479661 479661 N_multimapping 188685 188685 188685 N_noFeature 202473 10004292 242037 N_ambiguous 117206 607 47919 UnstrandedReadsAssigned:9793004 PositiveStrandReadsAssigned:107784 NegativeStrandReadsAssigned:9822727 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7169848 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169848-trimmed-pair1.fastq SRR7169848-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,781,029 reads, 9,817,360 reads pseudoaligned [quant] estimated average fragment length: 306.997 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7169848.ke.tsv 34699 SRR7169848.se.tsv 87100 total ==> SRR7169848.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1712 169 10.1716 Potri.005G024800.1.v4.1 1035 729.003 25 3.53361 Potri.004G059700.1.v4.1 961 655.033 1 0.157306 Potri.007G009000.2.v4.1 1416 1110 0 0 Potri.003G141000.2.v4.1 2943 2637 185.058 7.23112 Potri.016G087400.1.v4.1 270 69.4838 796 1180.42 Potri.015G069301.1.v4.1 564 268.718 0 0 Potri.010G195200.1.v4.1 1773 1467 7 0.491671 Potri.012G127500.1.v4.1 977 671.015 3181 488.471 ==> SRR7169848.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169848 completed mapping pipeline successfully