Starting /dee2/code/volunteer_pipeline.sh SRR7169849 current disk space = 3052579713024 free memory = 1406275844 SRR7169849 SRAfilesize 27988420e5a83aad3a260b33bed2016e SRR7169849.sra SRR7169849.sra file validated SRR7169849 is paired end SRR7169849 is conventional basespace SRR7169849 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.6735 31.0 25.0 32.0 18.0 33.0 2 31.7885 33.0 31.0 33.0 29.0 33.0 3 32.171 33.0 33.0 33.0 30.0 33.0 4 32.55675 33.0 33.0 33.0 31.0 34.0 5 33.235 34.0 33.0 34.0 33.0 34.0 6 37.23025 38.0 37.0 38.0 36.0 38.0 7 37.50875 38.0 38.0 38.0 37.0 38.0 8 37.573 38.0 38.0 38.0 38.0 38.0 9 37.63825 38.0 38.0 38.0 38.0 38.0 10-14 37.60889999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.62475 38.0 38.0 38.0 38.0 38.0 20-24 37.6237 38.0 38.0 38.0 38.0 38.0 25-29 37.57469999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5654 38.0 38.0 38.0 38.0 38.0 35-39 37.51835 38.0 38.0 38.0 38.0 38.0 40-44 37.4694 38.0 38.0 38.0 37.8 38.0 45-49 37.45205 38.0 38.0 38.0 37.6 38.0 50-54 37.3481 38.0 38.0 38.0 37.0 38.0 55-59 37.2879 38.0 38.0 38.0 37.0 38.0 60-64 37.237049999999996 38.0 38.0 38.0 36.8 38.0 65-69 37.164300000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.049699999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.005700000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.87395 38.0 38.0 38.0 35.4 38.0 85-89 36.8056 38.0 38.0 38.0 35.0 38.0 90-94 36.79045 38.0 38.0 38.0 35.0 38.0 95-99 36.59555 38.0 38.0 38.0 34.8 38.0 100-104 36.4071 38.0 38.0 38.0 34.0 38.0 105-109 36.0914 38.0 37.2 38.0 33.6 38.0 110-114 36.021499999999996 38.0 37.4 38.0 33.0 38.0 115-119 35.951350000000005 38.0 37.0 38.0 33.0 38.0 120-124 35.586149999999996 38.0 36.8 38.0 30.8 38.0 125-129 35.17505 38.0 36.0 38.0 29.0 38.0 130-134 35.00665 38.0 36.0 38.0 28.2 38.0 135-139 34.84995 38.0 35.6 38.0 28.6 38.0 140-144 34.3637 38.0 35.0 38.0 27.2 38.0 145-149 33.82495 38.0 35.0 38.0 22.6 38.0 150-151 30.44175 36.5 29.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 1.0 17 4.0 18 2.0 19 8.0 20 4.0 21 7.0 22 7.0 23 9.0 24 10.0 25 6.0 26 16.0 27 21.0 28 21.0 29 31.0 30 45.0 31 39.0 32 69.0 33 84.0 34 151.0 35 266.0 36 694.0 37 2499.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.74090099261898 10.817001781623823 10.231611096971239 37.21048612878595 2 21.95 13.375 33.4 31.275 3 19.35 17.474999999999998 26.8 36.375 4 22.75 25.55 23.775 27.925 5 23.799999999999997 31.0 24.224999999999998 20.974999999999998 6 19.85 34.075 25.275 20.8 7 14.249999999999998 28.225 40.300000000000004 17.224999999999998 8 18.625 26.05 31.15 24.175 9 17.625 25.0 34.050000000000004 23.325000000000003 10-14 19.605 30.8 26.775 22.82 15-19 19.869999999999997 28.74 28.055000000000003 23.335 20-24 19.470000000000002 29.095 27.51 23.925 25-29 19.71 29.18 27.145000000000003 23.965 30-34 19.99 29.03 27.195000000000004 23.785 35-39 20.09 28.92 27.555000000000003 23.435 40-44 19.89 28.904999999999998 27.534999999999997 23.669999999999998 45-49 20.21 28.425 27.97 23.395 50-54 20.330000000000002 28.799999999999997 27.295 23.575 55-59 19.935 28.689999999999998 27.915 23.46 60-64 19.580000000000002 28.389999999999997 27.79 24.240000000000002 65-69 19.85 28.59 28.28 23.28 70-74 20.485 28.33 27.529999999999998 23.655 75-79 20.294999999999998 28.294999999999998 27.35 24.060000000000002 80-84 19.99 28.865000000000002 27.445000000000004 23.7 85-89 20.095 28.395 28.345 23.165 90-94 20.235 28.32 27.42 24.025 95-99 20.465 28.53 27.495000000000005 23.51 100-104 20.645 28.74 27.284999999999997 23.330000000000002 105-109 20.365 27.935 27.165 24.535 110-114 20.36 27.450000000000003 27.975 24.215 115-119 20.349999999999998 28.53 27.589999999999996 23.53 120-124 20.919999999999998 28.765 26.465 23.849999999999998 125-129 20.325 28.4 26.88 24.395 130-134 20.585 28.285 27.265 23.865 135-139 20.69 28.305000000000003 27.005000000000003 24.0 140-144 20.880000000000003 27.675 27.065 24.38 145-149 20.674999999999997 27.97 27.169999999999998 24.185000000000002 150-151 20.225 28.1 26.85 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.0 24 0.5 25 2.5 26 6.5 27 8.0 28 7.0 29 13.5 30 20.0 31 26.0 32 38.5 33 46.5 34 57.0 35 73.5 36 83.0 37 103.5 38 142.0 39 168.5 40 186.0 41 209.0 42 220.5 43 235.5 44 277.5 45 279.5 46 255.5 47 240.5 48 239.0 49 221.0 50 180.5 51 146.5 52 121.5 53 106.5 54 77.5 55 55.0 56 40.5 57 29.5 58 20.0 59 15.5 60 13.5 61 8.5 62 5.0 63 4.5 64 2.0 65 0.5 66 1.5 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.9749999999999996 0.0 0.0 0.0 0.0 124-125 4.362500000000001 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.199999999999999 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 6.025 0.0 0.0 0.0 0.0 134-135 6.4625 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7169849 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169849_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7455 33.0 33.0 34.0 32.0 34.0 2 32.79425 34.0 33.0 34.0 32.0 34.0 3 32.8325 34.0 33.0 34.0 33.0 34.0 4 32.8085 34.0 33.0 34.0 33.0 34.0 5 32.784 34.0 33.0 34.0 32.0 34.0 6 37.0025 38.0 38.0 38.0 37.0 38.0 7 37.003 38.0 38.0 38.0 37.0 38.0 8 37.047 38.0 38.0 38.0 37.0 38.0 9 37.03625 38.0 38.0 38.0 37.0 38.0 10-14 36.99435 38.0 38.0 38.0 37.0 38.0 15-19 36.94395 38.0 38.0 38.0 37.0 38.0 20-24 36.97475 38.0 38.0 38.0 37.0 38.0 25-29 36.9345 38.0 38.0 38.0 37.0 38.0 30-34 36.887100000000004 38.0 38.0 38.0 37.0 38.0 35-39 36.8489 38.0 38.0 38.0 37.0 38.0 40-44 36.8178 38.0 38.0 38.0 37.0 38.0 45-49 36.7913 38.0 38.0 38.0 37.0 38.0 50-54 36.789300000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.736900000000006 38.0 38.0 38.0 36.8 38.0 60-64 36.651050000000005 38.0 38.0 38.0 36.2 38.0 65-69 36.55395 38.0 38.0 38.0 36.0 38.0 70-74 36.4901 38.0 38.0 38.0 35.8 38.0 75-79 36.39255 38.0 38.0 38.0 35.2 38.0 80-84 36.36405 38.0 38.0 38.0 35.2 38.0 85-89 36.34625 38.0 38.0 38.0 35.2 38.0 90-94 36.2414 38.0 38.0 38.0 35.0 38.0 95-99 36.10955 38.0 38.0 38.0 34.0 38.0 100-104 36.06695 38.0 38.0 38.0 34.0 38.0 105-109 35.932550000000006 38.0 38.0 38.0 34.0 38.0 110-114 35.8626 38.0 38.0 38.0 34.0 38.0 115-119 35.591550000000005 38.0 38.0 38.0 32.8 38.0 120-124 35.43535 38.0 38.0 38.0 31.6 38.0 125-129 35.167500000000004 38.0 37.4 38.0 30.0 38.0 130-134 35.016650000000006 38.0 36.4 38.0 30.0 38.0 135-139 34.7128 38.0 36.2 38.0 28.4 38.0 140-144 34.33745 38.0 35.8 38.0 25.8 38.0 145-149 33.727250000000005 38.0 35.0 38.0 21.0 38.0 150-151 29.756999999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 9.0 4 3.0 5 3.0 6 1.0 7 1.0 8 1.0 9 4.0 10 1.0 11 3.0 12 3.0 13 3.0 14 1.0 15 4.0 16 1.0 17 7.0 18 7.0 19 8.0 20 7.0 21 4.0 22 8.0 23 13.0 24 6.0 25 14.0 26 21.0 27 27.0 28 20.0 29 21.0 30 33.0 31 42.0 32 60.0 33 71.0 34 97.0 35 170.0 36 420.0 37 2869.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.76938469234617 20.08504252126063 14.85742871435718 26.28814407203602 2 28.416813491064687 24.137931034482758 29.146740498363954 18.298514976088597 3 22.004028197381672 27.442094662638468 31.017119838872105 19.536757301107755 4 25.12600806451613 32.434475806451616 23.084677419354836 19.35483870967742 5 25.623582766439913 35.52532123960695 21.239606953892668 17.61148904006047 6 21.036738802214394 39.003522898842476 23.326623049823855 16.633115249119275 7 20.372233400402415 23.038229376257547 37.19818913480885 19.39134808853119 8 22.711267605633804 26.156941649899395 27.062374245472835 24.069416498993963 9 21.40880503144654 25.0062893081761 29.861635220125788 23.72327044025157 10-14 23.813116073224702 29.08368537517602 26.297525648762825 20.80567290283645 15-19 23.957337626402374 27.604769331388034 27.594707450822558 20.84318559138703 20-24 23.397726129389273 28.40325988530033 26.878961666163597 21.320052319146797 25-29 23.71969010966898 28.609518060167016 26.67270349129691 20.99808833886709 30-34 23.700759671982695 27.806006942697593 27.282789153292754 21.210444232026965 35-39 23.337357883086828 28.186940336049904 27.49270550357179 20.982996277291477 40-44 23.7937106918239 28.181132075471698 27.12452830188679 20.90062893081761 45-49 23.73307835539228 27.613104524180965 27.834532736148155 20.819284384278596 50-54 24.042478232422365 28.169510292415325 27.25854345966078 20.529468015501536 55-59 23.711755233494365 28.633252818035427 26.982689210950078 20.67230273752013 60-64 23.518462621994164 27.84485360700272 28.036019720293794 20.600664050709327 65-69 24.067643062056472 28.053752076098444 27.550455483416375 20.32814937842871 70-74 23.904944114389288 27.967979055482832 27.570234618870202 20.556842211257678 75-79 23.78411036149431 27.474574564495015 28.129090726009466 20.61222434800121 80-84 24.32908715573234 27.79819747243341 27.657217662756157 20.215497709078093 85-89 23.605236656596173 27.920443101711985 28.066465256797585 20.40785498489426 90-94 24.08479782466388 27.75064202628531 27.86645853265522 20.298101616395588 95-99 23.63132712163183 27.917401158398388 27.660538907076305 20.790732812893477 100-104 24.133937562940584 27.381671701913397 28.288016112789528 20.196374622356494 105-109 24.457315537647947 28.128934777134223 26.930244270964494 20.483505414253337 110-114 24.36407595829346 28.161990631138874 27.028660655820282 20.445272754747393 115-119 24.115869017632242 28.59949622166247 26.816120906801004 20.468513853904284 120-124 24.42159383033419 28.15666112203236 27.022531377589598 20.399213670043853 125-129 24.834921114975554 27.80886133373658 27.748374414032966 19.607843137254903 130-134 24.928164541009227 28.03347280334728 27.41846045268942 19.619902202954076 135-139 25.58983666061706 27.893728574309335 27.25851986287558 19.257914902198024 140-144 25.01890788080472 28.38703171481874 26.59204356375737 20.00201684061917 145-149 25.29500756429652 28.164397377710536 27.372667675239537 19.167927382753405 150-151 25.822306238185256 26.94391934467549 27.385003150598614 19.848771266540645 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 11.5 2 8.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 3.0 26 3.5 27 6.0 28 8.5 29 9.0 30 10.5 31 17.0 32 21.5 33 28.0 34 37.5 35 48.5 36 63.5 37 84.5 38 112.0 39 148.5 40 186.0 41 215.0 42 241.5 43 273.0 44 295.5 45 293.0 46 284.0 47 279.0 48 255.5 49 210.5 50 173.5 51 149.0 52 117.0 53 93.0 54 85.5 55 68.0 56 44.5 57 27.0 58 19.0 59 15.0 60 12.0 61 9.5 62 5.5 63 3.0 64 3.0 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.675 3 0.7000000000000001 4 0.8 5 0.775 6 0.65 7 0.6 8 0.6 9 0.625 10-14 0.58 15-19 0.615 20-24 0.61 25-29 0.61 30-34 0.615 35-39 0.61 40-44 0.625 45-49 0.645 50-54 0.655 55-59 0.64 60-64 0.61 65-69 0.655 70-74 0.69 75-79 0.69 80-84 0.695 85-89 0.7000000000000001 90-94 0.705 95-99 0.7250000000000001 100-104 0.7000000000000001 105-109 0.7250000000000001 110-114 0.735 115-119 0.75 120-124 0.8049999999999999 125-129 0.8049999999999999 130-134 0.815 135-139 0.8200000000000001 140-144 0.835 145-149 0.8500000000000001 150-151 0.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44514501891551 98.575 2 0.45397225725094575 0.8999999999999999 3 0.025220680958385876 0.075 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025220680958385876 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.7249999999999996 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.075 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACAAA 10 0.00682755 145.0 5 >>END_MODULE Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710320 spots for SRR7169849.sra Written 710320 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra Read 710306 spots for SRR7169849.sra Written 710306 spots for SRR7169849.sra SRR ids: ['SRR7169849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e7cyt3se SRR7169849.sra spots: 14206134 blocks: [[1, 710306], [710307, 1420612], [1420613, 2130918], [2130919, 2841224], [2841225, 3551530], [3551531, 4261836], [4261837, 4972142], [4972143, 5682448], [5682449, 6392754], [6392755, 7103060], [7103061, 7813366], [7813367, 8523672], [8523673, 9233978], [9233979, 9944284], [9944285, 10654590], [10654591, 11364896], [11364897, 12075202], [12075203, 12785508], [12785509, 13495814], [13495815, 14206134]] SRR7169849 file size 4792292 SRR7169849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169849 SRR7169849_1.fastq SRR7169849_2.fastq Input file: SRR7169849_1.fastq Paired file: SRR7169849_2.fastq trimmed: SRR7169849-trimmed-pair1.fastq, SRR7169849-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:43:29 2025 >> started Tue Feb 11 22:43:52 2025 >> done (22.290s) 14206134 read pairs processed; of these: 30673 ( 0.22%) short read pairs filtered out after trimming by size control 65338 ( 0.46%) empty read pairs filtered out after trimming by size control 14110123 (99.32%) read pairs available; of these: 5995153 (42.49%) trimmed read pairs available after processing 8114970 (57.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 7 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 8 0.00% 31 4 0.00% 32 5 0.00% 33 5 0.00% 34 8 0.00% 35 9 0.00% 36 7 0.00% 37 6 0.00% 38 9 0.00% 39 18 0.00% 40 24 0.00% 41 11 0.00% 42 19 0.00% 43 26 0.00% 44 29 0.00% 45 31 0.00% 46 24 0.00% 47 48 0.00% 48 42 0.00% 49 70 0.00% 50 60 0.00% 51 85 0.00% 52 94 0.00% 53 115 0.00% 54 127 0.00% 55 160 0.00% 56 163 0.00% 57 196 0.00% 58 192 0.00% 59 250 0.00% 60 263 0.00% 61 364 0.00% 62 433 0.00% 63 470 0.00% 64 547 0.00% 65 571 0.00% 66 673 0.00% 67 745 0.01% 68 830 0.01% 69 1056 0.01% 70 1127 0.01% 71 1319 0.01% 72 1512 0.01% 73 1798 0.01% 74 1939 0.01% 75 2221 0.02% 76 2417 0.02% 77 2726 0.02% 78 2963 0.02% 79 3320 0.02% 80 3649 0.03% 81 4156 0.03% 82 4559 0.03% 83 5126 0.04% 84 6447 0.05% 85 7452 0.05% 86 7714 0.05% 87 8297 0.06% 88 8953 0.06% 89 9313 0.07% 90 9793 0.07% 91 10210 0.07% 92 10881 0.08% 93 11832 0.08% 94 12437 0.09% 95 13085 0.09% 96 13595 0.10% 97 14129 0.10% 98 14480 0.10% 99 14848 0.11% 100 15448 0.11% 101 16158 0.11% 102 16942 0.12% 103 17761 0.13% 104 18547 0.13% 105 19700 0.14% 106 20309 0.14% 107 20772 0.15% 108 21164 0.15% 109 21905 0.16% 110 22305 0.16% 111 22704 0.16% 112 23983 0.17% 113 24859 0.18% 114 25488 0.18% 115 26770 0.19% 116 27510 0.19% 117 28277 0.20% 118 28955 0.21% 119 29355 0.21% 120 29936 0.21% 121 30689 0.22% 122 31773 0.23% 123 32722 0.23% 124 33987 0.24% 125 35628 0.25% 126 37379 0.26% 127 38039 0.27% 128 38992 0.28% 129 39662 0.28% 130 40717 0.29% 131 42624 0.30% 132 43760 0.31% 133 45481 0.32% 134 47368 0.34% 135 49776 0.35% 136 51851 0.37% 137 54359 0.39% 138 57650 0.41% 139 60902 0.43% 140 64496 0.46% 141 68687 0.49% 142 75422 0.53% 143 82444 0.58% 144 93719 0.66% 145 108457 0.77% 146 132058 0.94% 147 172409 1.22% 148 255156 1.81% 149 541199 3.84% 150 2888762 20.47% 151 8114970 57.51% 14110123 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=28 prefix-density=0.16 prefix-fanout=2.7 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=154.68 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.6 sequence=AAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=37 prefix-density=0.23 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=227.69 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.2 sequence=GAAGAAGAAGAAA SRR7169849 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:44:37 Started mapping on | Feb 11 22:44:37 Finished on | Feb 11 22:46:08 Mapping speed, Million of reads per hour | 558.20 Number of input reads | 14110123 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13313747 Uniquely mapped reads % | 94.36% Average mapped length | 293.12 Number of splices: Total | 11636424 Number of splices: Annotated (sjdb) | 11406680 Number of splices: GT/AG | 11455071 Number of splices: GC/AG | 144216 Number of splices: AT/AC | 10058 Number of splices: Non-canonical | 27079 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253202 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 19076 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 557052 557052 557052 N_multimapping 253202 253202 253202 N_noFeature 392478 13160877 458480 N_ambiguous 144112 1291 56346 UnstrandedReadsAssigned:12777157 PositiveStrandReadsAssigned:151579 NegativeStrandReadsAssigned:12798921 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169849 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169849-trimmed-pair1.fastq SRR7169849-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,110,123 reads, 12,747,014 reads pseudoaligned [quant] estimated average fragment length: 235.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7169849.ke.tsv 34699 SRR7169849.se.tsv 87100 total ==> SRR7169849.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.99 259 11.4703 Potri.005G024800.1.v4.1 1035 800.988 38 3.74822 Potri.004G059700.1.v4.1 961 726.993 3 0.326031 Potri.007G009000.2.v4.1 1416 1181.99 0 0 Potri.003G141000.2.v4.1 2943 2708.99 243.044 7.08834 Potri.016G087400.1.v4.1 270 82.2343 1186 1139.46 Potri.015G069301.1.v4.1 564 332.941 0 0 Potri.010G195200.1.v4.1 1773 1538.99 53 2.72087 Potri.012G127500.1.v4.1 977 742.993 6283 668.112 ==> SRR7169849.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2344 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169849 completed mapping pipeline successfully