Starting /dee2/code/volunteer_pipeline.sh SRR7169850 current disk space = 3052358410240 free memory = 1513905028 SRR7169850 SRAfilesize 67ef0ebff0ccf1f60a870d451b52791d SRR7169850.sra SRR7169850.sra file validated SRR7169850 is paired end SRR7169850 is conventional basespace SRR7169850 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.8345 18.0 18.0 18.0 18.0 32.0 2 28.0905 29.0 27.0 31.0 25.0 33.0 3 29.914 31.0 29.0 33.0 27.0 33.0 4 31.95125 33.0 31.0 33.0 29.0 33.0 5 32.643 33.0 33.0 33.0 32.0 34.0 6 36.5835 38.0 37.0 38.0 34.0 38.0 7 37.1785 38.0 38.0 38.0 36.0 38.0 8 37.4075 38.0 38.0 38.0 37.0 38.0 9 37.53175 38.0 38.0 38.0 37.0 38.0 10-14 37.597899999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.6025 38.0 38.0 38.0 38.0 38.0 20-24 37.59545 38.0 38.0 38.0 38.0 38.0 25-29 37.5538 38.0 38.0 38.0 38.0 38.0 30-34 37.5525 38.0 38.0 38.0 38.0 38.0 35-39 37.517849999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.4809 38.0 38.0 38.0 37.2 38.0 45-49 37.456399999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.360299999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.302749999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.23555 38.0 38.0 38.0 36.6 38.0 65-69 37.1862 38.0 38.0 38.0 36.2 38.0 70-74 37.08725 38.0 38.0 38.0 36.0 38.0 75-79 37.09435 38.0 38.0 38.0 36.0 38.0 80-84 36.9601 38.0 38.0 38.0 35.8 38.0 85-89 36.8886 38.0 38.0 38.0 35.4 38.0 90-94 36.824349999999995 38.0 38.0 38.0 35.0 38.0 95-99 36.6984 38.0 38.0 38.0 34.4 38.0 100-104 36.5004 38.0 38.0 38.0 34.0 38.0 105-109 36.2567 38.0 37.8 38.0 34.0 38.0 110-114 36.0423 38.0 37.0 38.0 33.0 38.0 115-119 36.036500000000004 38.0 37.0 38.0 33.2 38.0 120-124 35.68935 38.0 36.8 38.0 30.6 38.0 125-129 35.2278 38.0 36.0 38.0 29.0 38.0 130-134 35.1122 38.0 36.0 38.0 28.2 38.0 135-139 34.99335 38.0 35.4 38.0 29.2 38.0 140-144 34.39495 38.0 35.0 38.0 26.2 38.0 145-149 33.91025 38.0 35.0 38.0 23.0 38.0 150-151 30.034125000000003 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 1.0 19 0.0 20 3.0 21 3.0 22 4.0 23 10.0 24 13.0 25 13.0 26 13.0 27 25.0 28 23.0 29 31.0 30 42.0 31 44.0 32 62.0 33 110.0 34 142.0 35 305.0 36 825.0 37 2324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.916030534351144 16.259541984732824 8.3206106870229 34.50381679389313 2 21.375 14.124999999999998 34.9 29.599999999999998 3 19.05 19.825 26.6 34.525 4 23.1 26.6 23.400000000000002 26.900000000000002 5 22.525000000000002 33.7 23.325000000000003 20.45 6 18.4 35.4 25.0 21.2 7 14.45 26.224999999999998 41.675000000000004 17.65 8 18.625 27.0 30.225 24.15 9 18.0 23.724999999999998 33.825 24.45 10-14 19.525000000000002 30.080000000000002 26.795 23.599999999999998 15-19 19.12 28.93 27.939999999999998 24.01 20-24 20.07 29.509999999999998 26.865 23.555 25-29 19.42 30.104999999999997 27.13 23.345 30-34 19.814999999999998 29.044999999999998 27.52 23.62 35-39 20.665 28.525 27.605 23.205000000000002 40-44 20.305 29.325000000000003 27.139999999999997 23.23 45-49 20.265 28.505000000000003 27.005000000000003 24.224999999999998 50-54 19.744999999999997 29.015 27.589999999999996 23.65 55-59 20.075000000000003 29.354999999999997 26.97 23.599999999999998 60-64 20.14 29.044999999999998 27.155 23.66 65-69 20.474999999999998 28.499999999999996 27.529999999999998 23.494999999999997 70-74 20.195 28.74 27.58 23.485 75-79 20.16 28.694999999999997 27.384999999999998 23.76 80-84 20.07 29.404999999999998 26.935 23.59 85-89 20.565 28.244999999999997 27.55 23.64 90-94 20.095 28.78 27.229999999999997 23.895 95-99 19.73 28.82 27.334999999999997 24.115000000000002 100-104 20.45 28.485 27.395000000000003 23.669999999999998 105-109 19.595000000000002 28.389999999999997 27.625 24.39 110-114 20.19 27.88 28.08 23.849999999999998 115-119 19.900000000000002 28.225 27.655 24.22 120-124 20.544999999999998 28.29 27.065 24.099999999999998 125-129 20.465 28.395 27.445000000000004 23.695 130-134 20.549999999999997 28.299999999999997 27.339999999999996 23.810000000000002 135-139 20.355 28.050000000000004 27.650000000000002 23.945 140-144 20.3 28.42 27.279999999999998 24.0 145-149 20.445 28.12 27.55 23.885 150-151 21.125 27.525 26.650000000000002 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 2.0 25 2.5 26 4.0 27 9.0 28 12.5 29 13.5 30 19.5 31 32.0 32 40.0 33 51.0 34 63.0 35 69.0 36 84.0 37 112.0 38 131.5 39 152.5 40 186.0 41 210.0 42 237.5 43 259.0 44 258.5 45 269.0 46 280.0 47 244.5 48 203.0 49 194.0 50 181.5 51 148.0 52 114.0 53 101.0 54 87.0 55 63.0 56 47.5 57 37.5 58 26.0 59 15.5 60 9.5 61 5.5 62 4.5 63 4.5 64 3.0 65 0.5 66 0.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1 0.0 0.0 0.0 0.0 134-135 2.225 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTAT 10 0.006830828 145.0 6 >>END_MODULE SRR7169850 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169850_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.698 33.0 33.0 34.0 32.0 34.0 2 32.7275 33.0 33.0 34.0 32.0 34.0 3 32.8225 34.0 33.0 34.0 32.0 34.0 4 32.72525 34.0 33.0 34.0 32.0 34.0 5 32.67175 34.0 33.0 34.0 32.0 34.0 6 36.9785 38.0 38.0 38.0 37.0 38.0 7 36.9765 38.0 38.0 38.0 37.0 38.0 8 36.97325 38.0 38.0 38.0 37.0 38.0 9 36.8585 38.0 38.0 38.0 37.0 38.0 10-14 36.87565 38.0 38.0 38.0 37.0 38.0 15-19 36.86065 38.0 38.0 38.0 36.8 38.0 20-24 36.845150000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.8346 38.0 38.0 38.0 37.0 38.0 30-34 36.8007 38.0 38.0 38.0 36.4 38.0 35-39 36.752300000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.69515 38.0 38.0 38.0 36.0 38.0 45-49 36.72619999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.6594 38.0 38.0 38.0 36.0 38.0 55-59 36.61925 38.0 38.0 38.0 36.0 38.0 60-64 36.5658 38.0 38.0 38.0 36.0 38.0 65-69 36.487550000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.3739 38.0 38.0 38.0 34.8 38.0 75-79 36.2864 38.0 38.0 38.0 34.4 38.0 80-84 36.281600000000005 38.0 38.0 38.0 34.2 38.0 85-89 36.2615 38.0 38.0 38.0 34.2 38.0 90-94 36.158 38.0 38.0 38.0 34.0 38.0 95-99 36.0344 38.0 38.0 38.0 34.0 38.0 100-104 36.010850000000005 38.0 38.0 38.0 34.0 38.0 105-109 35.85235 38.0 38.0 38.0 33.4 38.0 110-114 35.7055 38.0 38.0 38.0 32.8 38.0 115-119 35.5308 38.0 37.6 38.0 31.2 38.0 120-124 35.27585 38.0 37.0 38.0 30.2 38.0 125-129 35.0905 38.0 36.6 38.0 29.0 38.0 130-134 34.808499999999995 38.0 36.0 38.0 28.0 38.0 135-139 34.39960000000001 38.0 35.8 38.0 25.4 38.0 140-144 34.1064 38.0 35.2 38.0 23.0 38.0 145-149 33.429449999999996 38.0 35.0 38.0 18.2 38.0 150-151 29.648375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 9.0 4 3.0 5 0.0 6 2.0 7 0.0 8 1.0 9 4.0 10 3.0 11 0.0 12 0.0 13 5.0 14 3.0 15 2.0 16 4.0 17 9.0 18 5.0 19 5.0 20 5.0 21 13.0 22 5.0 23 11.0 24 15.0 25 13.0 26 20.0 27 33.0 28 26.0 29 26.0 30 32.0 31 41.0 32 59.0 33 90.0 34 124.0 35 207.0 36 490.0 37 2699.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.72979734801101 20.740555416562422 14.36077057793345 25.168876657493122 2 26.77046710195882 26.971371170266195 28.578603716725265 17.67955801104972 3 21.848317428427926 28.980411853340033 30.160723254645905 19.01054746358614 4 24.045226130653266 32.41206030150754 24.849246231155778 18.693467336683415 5 24.296482412060303 35.37688442211056 22.311557788944725 18.015075376884422 6 20.84379708689101 37.61928679055751 23.556002009040682 17.9809141135108 7 21.01958814665997 22.827724761426417 37.44349573078855 18.709191361125065 8 23.380210949271724 24.987443495730787 26.268206931190356 25.36413862380713 9 21.120040180813664 25.916624811652433 29.884480160723253 23.07885484681065 10-14 23.188187434081662 28.637436592838128 26.518005122796446 21.656370850283764 15-19 23.79206428930186 27.518834756403816 27.810145655449524 20.8789552988448 20-24 23.340030135610245 27.56403817177298 28.021094927172275 21.0748367654445 25-29 23.189352084379706 28.252134605725765 28.046207935710697 20.51230537418383 30-34 23.385233550979407 28.046207935710697 27.30286288297338 21.265695630336516 35-39 23.053741838272224 28.021094927172275 27.99598191863385 20.929181315921646 40-44 23.676544450025112 27.835258663987943 27.76996484178805 20.718232044198896 45-49 23.601205424409844 28.036162732295328 27.388247112004017 20.97438473129081 50-54 23.445504771471622 28.22199899547966 27.388247112004017 20.9442491210447 55-59 24.093420391762933 28.593671521848318 27.127071823204417 20.185836263184328 60-64 23.711702661978904 28.166750376695127 27.7197388247112 20.401808136614765 65-69 24.324460070316423 27.60924158714214 27.60924158714214 20.457056755399297 70-74 24.118533400301356 28.201908588648923 27.36815670517328 20.311401305876444 75-79 24.294324460070314 28.503264691109997 27.383224510296333 19.819186338523355 80-84 23.495730788548467 28.392767453540934 27.493721747865397 20.617780010045202 85-89 24.31943746860874 27.684580612757408 27.945755901557007 20.05022601707685 90-94 23.872425916624813 28.262179809141134 27.56403817177298 20.301356102461074 95-99 24.083375188347564 27.835258663987943 27.68960321446509 20.3917629331994 100-104 23.716725263686588 28.006027122049222 27.96082370668006 20.316423907584127 105-109 23.822199899547964 28.24711200401808 27.674535409342038 20.256152687091912 110-114 23.345052737317932 27.95077850326469 28.176795580110497 20.52737317930688 115-119 23.874824191279885 28.15451074944746 27.00924251557163 20.961422543701026 120-124 24.388283173390946 27.97065768979551 27.37778224388283 20.263276892930715 125-129 24.291457286432163 28.07537688442211 27.467336683417088 20.165829145728644 130-134 24.204653967934863 27.32070161330854 27.979092325476202 20.495552093280395 135-139 24.766308171675544 27.66107146446879 27.625892049452204 19.946728314403458 140-144 24.645621795516238 27.465567507791295 27.72192620890721 20.16688448778526 145-149 24.425677373950634 27.552405368722667 27.52727089931132 20.49464635801538 150-151 24.324663902500316 27.81756502073125 27.96833773087071 19.889433345897725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 9.0 2 4.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 2.0 25 2.0 26 2.5 27 3.5 28 6.0 29 8.0 30 10.0 31 14.0 32 16.5 33 25.5 34 39.5 35 53.0 36 76.5 37 100.0 38 112.0 39 138.0 40 183.0 41 226.0 42 275.5 43 295.5 44 282.5 45 269.0 46 288.5 47 282.5 48 246.0 49 221.5 50 186.5 51 154.5 52 120.0 53 101.5 54 70.0 55 42.0 56 34.5 57 23.0 58 16.5 59 14.0 60 10.0 61 6.0 62 3.5 63 5.0 64 4.0 65 1.0 66 1.0 67 0.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.44999999999999996 3 0.44999999999999996 4 0.5 5 0.5 6 0.44999999999999996 7 0.44999999999999996 8 0.44999999999999996 9 0.44999999999999996 10-14 0.445 15-19 0.44999999999999996 20-24 0.44999999999999996 25-29 0.44999999999999996 30-34 0.44999999999999996 35-39 0.44999999999999996 40-44 0.44999999999999996 45-49 0.44999999999999996 50-54 0.44999999999999996 55-59 0.44999999999999996 60-64 0.44999999999999996 65-69 0.44999999999999996 70-74 0.44999999999999996 75-79 0.44999999999999996 80-84 0.44999999999999996 85-89 0.44999999999999996 90-94 0.44999999999999996 95-99 0.44999999999999996 100-104 0.44999999999999996 105-109 0.44999999999999996 110-114 0.44999999999999996 115-119 0.45999999999999996 120-124 0.485 125-129 0.5 130-134 0.515 135-139 0.51 140-144 0.53 145-149 0.5349999999999999 150-151 0.5125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67328474491079 99.15 2 0.2261874842925358 0.44999999999999996 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.037500000000000006 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.0625 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.1 0.0 0.0 0.025 0.0 90-91 0.125 0.0 0.0 0.025 0.0 92-93 0.15 0.0 0.0 0.025 0.0 94-95 0.2 0.0 0.0 0.025 0.0 96-97 0.25 0.0 0.0 0.025 0.0 98-99 0.3 0.0 0.0 0.025 0.0 100-101 0.3125 0.0 0.0 0.025 0.0 102-103 0.3875 0.0 0.0 0.025 0.0 104-105 0.42500000000000004 0.0 0.0 0.025 0.0 106-107 0.45 0.0 0.0 0.025 0.0 108-109 0.525 0.0 0.0 0.025 0.0 110-111 0.625 0.0 0.0 0.025 0.0 112-113 0.75 0.0 0.0 0.025 0.0 114-115 0.85 0.0 0.0 0.025 0.0 116-117 0.9125000000000001 0.0 0.0 0.025 0.0 118-119 1.0499999999999998 0.0 0.0 0.025 0.0 120-121 1.1875 0.0 0.0 0.025 0.0 122-123 1.2375 0.0 0.0 0.025 0.0 124-125 1.3250000000000002 0.0 0.0 0.025 0.0 126-127 1.4 0.0 0.0 0.025 0.0 128-129 1.5875 0.0 0.0 0.025 0.0 130-131 1.8624999999999998 0.0 0.0 0.025 0.0 132-133 2.0375 0.0 0.0 0.025 0.0 134-135 2.175 0.0 0.0 0.025 0.0 136-137 2.3125 0.0 0.0 0.025 0.0 138-139 2.5625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATG 10 0.0068857023 144.61249 2 >>END_MODULE Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653474 spots for SRR7169850.sra Written 653474 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra Read 653462 spots for SRR7169850.sra Written 653462 spots for SRR7169850.sra SRR ids: ['SRR7169850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_j_t8fs SRR7169850.sra spots: 13069252 blocks: [[1, 653462], [653463, 1306924], [1306925, 1960386], [1960387, 2613848], [2613849, 3267310], [3267311, 3920772], [3920773, 4574234], [4574235, 5227696], [5227697, 5881158], [5881159, 6534620], [6534621, 7188082], [7188083, 7841544], [7841545, 8495006], [8495007, 9148468], [9148469, 9801930], [9801931, 10455392], [10455393, 11108854], [11108855, 11762316], [11762317, 12415778], [12415779, 13069252]] SRR7169850 file size 4407040 SRR7169850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169850 SRR7169850_1.fastq SRR7169850_2.fastq Input file: SRR7169850_1.fastq Paired file: SRR7169850_2.fastq trimmed: SRR7169850-trimmed-pair1.fastq, SRR7169850-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:10:06 2025 >> started Tue Feb 11 23:10:19 2025 >> done (13.536s) 13069252 read pairs processed; of these: 30799 ( 0.24%) short read pairs filtered out after trimming by size control 54215 ( 0.41%) empty read pairs filtered out after trimming by size control 12984238 (99.35%) read pairs available; of these: 5335728 (41.09%) trimmed read pairs available after processing 7648510 (58.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 4 0.00% 23 3 0.00% 24 1 0.00% 25 4 0.00% 26 3 0.00% 27 6 0.00% 28 3 0.00% 29 2 0.00% 30 6 0.00% 31 5 0.00% 32 1 0.00% 33 7 0.00% 34 5 0.00% 35 11 0.00% 36 8 0.00% 37 14 0.00% 38 16 0.00% 39 16 0.00% 40 16 0.00% 41 12 0.00% 42 9 0.00% 43 16 0.00% 44 17 0.00% 45 20 0.00% 46 21 0.00% 47 19 0.00% 48 19 0.00% 49 33 0.00% 50 34 0.00% 51 35 0.00% 52 36 0.00% 53 44 0.00% 54 57 0.00% 55 59 0.00% 56 69 0.00% 57 62 0.00% 58 92 0.00% 59 106 0.00% 60 86 0.00% 61 115 0.00% 62 128 0.00% 63 151 0.00% 64 154 0.00% 65 197 0.00% 66 198 0.00% 67 222 0.00% 68 232 0.00% 69 262 0.00% 70 319 0.00% 71 356 0.00% 72 435 0.00% 73 426 0.00% 74 541 0.00% 75 641 0.00% 76 714 0.01% 77 753 0.01% 78 766 0.01% 79 855 0.01% 80 1017 0.01% 81 1087 0.01% 82 1263 0.01% 83 1425 0.01% 84 2423 0.02% 85 3006 0.02% 86 3081 0.02% 87 3211 0.02% 88 3315 0.03% 89 3412 0.03% 90 3512 0.03% 91 3688 0.03% 92 3976 0.03% 93 4076 0.03% 94 4289 0.03% 95 4542 0.03% 96 4766 0.04% 97 4767 0.04% 98 5012 0.04% 99 5180 0.04% 100 5459 0.04% 101 5698 0.04% 102 6038 0.05% 103 6304 0.05% 104 6897 0.05% 105 7063 0.05% 106 7532 0.06% 107 7882 0.06% 108 8087 0.06% 109 8151 0.06% 110 8670 0.07% 111 8970 0.07% 112 9627 0.07% 113 10252 0.08% 114 10938 0.08% 115 11517 0.09% 116 12051 0.09% 117 12591 0.10% 118 13243 0.10% 119 13433 0.10% 120 13987 0.11% 121 14448 0.11% 122 15018 0.12% 123 16315 0.13% 124 17118 0.13% 125 18069 0.14% 126 19470 0.15% 127 20228 0.16% 128 21008 0.16% 129 21850 0.17% 130 23275 0.18% 131 24667 0.19% 132 26322 0.20% 133 28080 0.22% 134 30028 0.23% 135 32533 0.25% 136 34553 0.27% 137 37091 0.29% 138 40728 0.31% 139 44422 0.34% 140 48947 0.38% 141 53503 0.41% 142 61045 0.47% 143 68979 0.53% 144 82026 0.63% 145 99355 0.77% 146 127585 0.98% 147 175896 1.35% 148 273631 2.11% 149 597709 4.60% 150 2991937 23.04% 151 7648510 58.91% 12984238 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.6 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=234.93 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=132.35 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169850 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:11:05 Started mapping on | Feb 11 23:11:05 Finished on | Feb 11 23:12:10 Mapping speed, Million of reads per hour | 719.13 Number of input reads | 12984238 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12360915 Uniquely mapped reads % | 95.20% Average mapped length | 296.54 Number of splices: Total | 11462553 Number of splices: Annotated (sjdb) | 11273846 Number of splices: GT/AG | 11298494 Number of splices: GC/AG | 131990 Number of splices: AT/AC | 9067 Number of splices: Non-canonical | 23002 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226640 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 24702 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414017 414017 414017 N_multimapping 226640 226640 226640 N_noFeature 271394 12223396 318746 N_ambiguous 138753 690 48210 UnstrandedReadsAssigned:11950768 PositiveStrandReadsAssigned:136829 NegativeStrandReadsAssigned:11993959 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169850 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169850-trimmed-pair1.fastq SRR7169850-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,984,238 reads, 11,889,162 reads pseudoaligned [quant] estimated average fragment length: 277.664 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7169850.ke.tsv 34699 SRR7169850.se.tsv 87100 total ==> SRR7169850.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.34 203 9.11246 Potri.005G024800.1.v4.1 1035 758.336 43 4.4323 Potri.004G059700.1.v4.1 961 684.359 3 0.342657 Potri.007G009000.2.v4.1 1416 1139.34 0 0 Potri.003G141000.2.v4.1 2943 2666.34 192.032 5.62965 Potri.016G087400.1.v4.1 270 66.0948 1066 1260.7 Potri.015G069301.1.v4.1 564 294.086 0 0 Potri.010G195200.1.v4.1 1773 1496.34 22 1.14925 Potri.012G127500.1.v4.1 977 700.347 4553 508.167 ==> SRR7169850.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1471 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169850 completed mapping pipeline successfully