Starting /dee2/code/volunteer_pipeline.sh SRR7169851 current disk space = 3052045414400 free memory = 1576011436 SRR7169851 SRAfilesize 3ca1fc272f9a19825ddb9e2c2114ac68 SRR7169851.sra SRR7169851.sra file validated SRR7169851 is paired end SRR7169851 is conventional basespace SRR7169851 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0405 28.0 18.0 33.0 18.0 33.0 2 27.47 29.0 25.0 31.0 18.0 33.0 3 30.2095 31.0 29.0 33.0 27.0 33.0 4 32.134 33.0 31.0 33.0 30.0 33.0 5 32.76875 33.0 33.0 33.0 32.0 34.0 6 36.63625 38.0 37.0 38.0 34.0 38.0 7 35.97175 38.0 37.0 38.0 32.0 38.0 8 36.99 38.0 38.0 38.0 35.0 38.0 9 37.36025 38.0 38.0 38.0 37.0 38.0 10-14 37.5406 38.0 38.0 38.0 37.4 38.0 15-19 37.587399999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.5613 38.0 38.0 38.0 37.8 38.0 25-29 37.6262 38.0 38.0 38.0 38.0 38.0 30-34 37.54205 38.0 38.0 38.0 38.0 38.0 35-39 37.5253 38.0 38.0 38.0 38.0 38.0 40-44 37.41735 38.0 38.0 38.0 37.0 38.0 45-49 37.4893 38.0 38.0 38.0 37.2 38.0 50-54 37.41445 38.0 38.0 38.0 37.0 38.0 55-59 37.310700000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.27719999999999 38.0 38.0 38.0 36.6 38.0 65-69 37.151500000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.120400000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.994299999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.908249999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.72375000000001 38.0 38.0 38.0 34.6 38.0 90-94 36.342200000000005 38.0 37.6 38.0 33.0 38.0 95-99 36.3818 38.0 37.6 38.0 33.8 38.0 100-104 35.46545 38.0 36.2 38.0 29.4 38.0 105-109 36.0077 38.0 36.8 38.0 32.6 38.0 110-114 36.0372 38.0 37.0 38.0 33.2 38.0 115-119 35.5067 38.0 36.2 38.0 30.4 38.0 120-124 34.6978 38.0 34.8 38.0 25.4 38.0 125-129 35.14135 38.0 35.4 38.0 28.2 38.0 130-134 34.0184 37.8 34.0 38.0 23.4 38.0 135-139 34.58415 38.0 35.0 38.0 27.4 38.0 140-144 33.628499999999995 38.0 34.0 38.0 20.0 38.0 145-149 32.16165 36.8 31.6 38.0 15.6 38.0 150-151 28.495125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 0.0 17 2.0 18 3.0 19 0.0 20 3.0 21 4.0 22 5.0 23 9.0 24 13.0 25 8.0 26 7.0 27 17.0 28 16.0 29 22.0 30 49.0 31 58.0 32 85.0 33 139.0 34 217.0 35 480.0 36 1241.0 37 1619.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.25 11.075 9.225 43.45 2 19.979994998749685 14.528632158039509 35.033758439609905 30.457614403600903 3 18.475 18.325 26.575 36.625 4 21.8 26.875 23.925 27.400000000000002 5 22.650000000000002 32.175 24.0 21.175 6 18.8 35.725 24.15 21.325 7 14.05 26.025 41.875 18.05 8 19.075 24.5 31.775 24.65 9 17.625 24.525 33.75 24.099999999999998 10-14 19.86 30.075000000000003 27.245 22.82 15-19 19.33 28.645 28.000000000000004 24.025 20-24 19.975 28.754999999999995 27.834999999999997 23.435 25-29 19.52 29.125 27.66 23.695 30-34 19.675 29.285 27.6 23.44 35-39 19.765 29.110000000000003 27.04 24.085 40-44 20.03 29.294999999999998 27.26 23.415 45-49 19.93 28.665000000000003 27.750000000000004 23.655 50-54 20.044999999999998 28.29 27.560000000000002 24.104999999999997 55-59 20.14 28.810000000000002 27.189999999999998 23.86 60-64 19.919999999999998 28.835 27.389999999999997 23.855 65-69 19.775000000000002 28.060000000000002 27.79 24.375 70-74 20.16 28.68 27.655 23.505000000000003 75-79 19.985 28.315 27.644999999999996 24.055 80-84 19.81 29.409999999999997 27.35 23.43 85-89 20.349999999999998 28.365000000000002 27.54 23.745 90-94 20.485 28.715000000000003 27.35 23.45 95-99 20.14 28.189999999999998 27.88 23.79 100-104 19.805 28.939999999999998 27.18 24.075 105-109 20.28 28.794999999999998 26.795 24.13 110-114 20.535 28.095 27.689999999999998 23.68 115-119 20.36 28.735 27.255000000000003 23.65 120-124 20.09 28.235 27.68 23.995 125-129 20.46 27.935 27.505000000000003 24.099999999999998 130-134 20.41 28.765 27.07 23.755000000000003 135-139 21.2 28.84 26.945000000000004 23.015 140-144 20.785 28.360000000000003 27.115000000000002 23.74 145-149 20.68 28.23 27.21 23.880000000000003 150-151 20.875 28.025 26.9625 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 1.5 27 9.0 28 14.5 29 11.0 30 12.5 31 24.0 32 36.5 33 44.0 34 52.0 35 67.5 36 85.0 37 111.5 38 134.0 39 149.0 40 182.5 41 222.5 42 244.0 43 259.5 44 283.5 45 284.0 46 265.0 47 256.0 48 240.5 49 209.0 50 174.5 51 138.0 52 117.0 53 95.0 54 68.5 55 55.0 56 39.5 57 27.0 58 21.5 59 15.0 60 10.0 61 5.0 62 2.5 63 3.0 64 3.5 65 3.0 66 3.5 67 5.0 68 3.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.375 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.8375 0.0 0.0 0.0 0.0 132-133 4.012499999999999 0.0 0.0 0.0 0.0 134-135 4.325 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATCA 10 0.006830828 145.0 1 TGGGTGA 10 0.006830828 145.0 3 >>END_MODULE SRR7169851 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169851_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.214 34.0 33.0 34.0 33.0 34.0 2 33.292 34.0 33.0 34.0 33.0 34.0 3 33.36025 34.0 33.0 34.0 33.0 34.0 4 33.3245 34.0 33.0 34.0 33.0 34.0 5 33.24875 34.0 33.0 34.0 33.0 34.0 6 37.3355 38.0 38.0 38.0 38.0 38.0 7 37.398 38.0 38.0 38.0 38.0 38.0 8 37.40225 38.0 38.0 38.0 38.0 38.0 9 37.43325 38.0 38.0 38.0 38.0 38.0 10-14 37.4645 38.0 38.0 38.0 38.0 38.0 15-19 37.42745 38.0 38.0 38.0 38.0 38.0 20-24 37.187149999999995 38.0 38.0 38.0 36.8 38.0 25-29 36.79195 38.0 37.8 38.0 35.0 38.0 30-34 36.40375 38.0 37.8 38.0 33.6 38.0 35-39 37.1035 38.0 38.0 38.0 36.2 38.0 40-44 37.067350000000005 38.0 38.0 38.0 36.2 38.0 45-49 37.01105 38.0 38.0 38.0 36.0 38.0 50-54 37.187799999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.2635 38.0 38.0 38.0 37.0 38.0 60-64 37.1081 38.0 38.0 38.0 36.6 38.0 65-69 37.147549999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.15235 38.0 38.0 38.0 37.0 38.0 75-79 37.1203 38.0 38.0 38.0 36.6 38.0 80-84 36.91545 38.0 38.0 38.0 36.0 38.0 85-89 36.8431 38.0 38.0 38.0 35.8 38.0 90-94 36.83825 38.0 38.0 38.0 35.8 38.0 95-99 36.71915 38.0 38.0 38.0 35.2 38.0 100-104 36.59015 38.0 38.0 38.0 34.6 38.0 105-109 36.5543 38.0 38.0 38.0 34.2 38.0 110-114 36.48775 38.0 38.0 38.0 34.6 38.0 115-119 36.2786 38.0 37.8 38.0 34.0 38.0 120-124 36.0371 38.0 37.6 38.0 33.4 38.0 125-129 35.97429999999999 38.0 37.0 38.0 33.2 38.0 130-134 35.5883 38.0 36.4 38.0 31.4 38.0 135-139 35.265 38.0 36.0 38.0 31.0 38.0 140-144 35.1238 38.0 36.0 38.0 29.8 38.0 145-149 34.48165 38.0 35.2 38.0 27.4 38.0 150-151 30.153125000000003 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 2.0 12 2.0 13 0.0 14 1.0 15 4.0 16 3.0 17 6.0 18 2.0 19 6.0 20 1.0 21 6.0 22 5.0 23 7.0 24 8.0 25 9.0 26 16.0 27 12.0 28 28.0 29 27.0 30 29.0 31 43.0 32 44.0 33 75.0 34 120.0 35 236.0 36 604.0 37 2697.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.949999999999996 20.875 15.15 28.025 2 26.088044022011005 25.587793896948476 32.266133066533264 16.05802901450725 3 18.929732433108278 28.557139284821204 31.257814453613403 21.255313828457115 4 21.310655327663834 34.092046023011505 25.087543771885944 19.50975487743872 5 23.686843421710854 36.46823411705853 22.311155577788895 17.53376688344172 6 20.474999999999998 37.45 23.625 18.45 7 19.625 22.275 38.324999999999996 19.775000000000002 8 21.325 25.775 27.775 25.124999999999996 9 21.25 26.325 28.975 23.45 10-14 23.150000000000002 28.199999999999996 27.015 21.634999999999998 15-19 22.605 28.005000000000003 28.485 20.905 20-24 22.720000000000002 28.04 27.994999999999997 21.245 25-29 22.125 28.67 27.99 21.215 30-34 22.264999999999997 28.544999999999998 28.32 20.87 35-39 22.46 27.96 28.205000000000002 21.375 40-44 22.994999999999997 28.055000000000003 28.125 20.825 45-49 22.994999999999997 27.315 28.76 20.93 50-54 23.18 27.634999999999998 28.34 20.845 55-59 23.189999999999998 27.93 28.4 20.48 60-64 23.34 27.72 28.144999999999996 20.794999999999998 65-69 22.865 28.575 28.23 20.330000000000002 70-74 22.765 28.335 28.055000000000003 20.845 75-79 23.064999999999998 27.939999999999998 27.99 21.005 80-84 23.025000000000002 28.285 27.67 21.02 85-89 23.54 27.765 28.27 20.424999999999997 90-94 23.21 28.005000000000003 28.249999999999996 20.535 95-99 23.990000000000002 27.96 27.57 20.48 100-104 23.375 27.750000000000004 28.194999999999997 20.68 105-109 24.205 27.689999999999998 28.095 20.01 110-114 24.095 28.62 27.105 20.18 115-119 23.49 28.52 27.815 20.175 120-124 24.154999999999998 28.22 27.22 20.405 125-129 24.8 28.299999999999997 26.6 20.3 130-134 24.5 28.299999999999997 27.439999999999998 19.759999999999998 135-139 24.959999999999997 28.060000000000002 26.784999999999997 20.195 140-144 24.795 28.299999999999997 27.139999999999997 19.765 145-149 25.21 28.23 27.084999999999997 19.475 150-151 25.074999999999996 28.125 26.887499999999996 19.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 3.5 26 4.0 27 2.0 28 5.0 29 10.5 30 14.0 31 20.5 32 23.0 33 31.0 34 49.5 35 64.5 36 80.0 37 113.0 38 147.5 39 188.0 40 230.5 41 243.5 42 254.0 43 279.0 44 297.0 45 275.0 46 270.5 47 261.0 48 211.0 49 193.0 50 160.0 51 127.5 52 112.0 53 79.5 54 58.5 55 50.0 56 36.5 57 27.5 58 22.5 59 13.5 60 11.0 61 7.5 62 3.5 63 2.0 64 2.5 65 2.0 66 1.5 67 2.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.8375 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649705 spots for SRR7169851.sra Written 649705 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra Read 649701 spots for SRR7169851.sra Written 649701 spots for SRR7169851.sra SRR ids: ['SRR7169851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p_wp029d SRR7169851.sra spots: 12994024 blocks: [[1, 649701], [649702, 1299402], [1299403, 1949103], [1949104, 2598804], [2598805, 3248505], [3248506, 3898206], [3898207, 4547907], [4547908, 5197608], [5197609, 5847309], [5847310, 6497010], [6497011, 7146711], [7146712, 7796412], [7796413, 8446113], [8446114, 9095814], [9095815, 9745515], [9745516, 10395216], [10395217, 11044917], [11044918, 11694618], [11694619, 12344319], [12344320, 12994024]] SRR7169851 file size 4381547 SRR7169851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169851 SRR7169851_1.fastq SRR7169851_2.fastq Input file: SRR7169851_1.fastq Paired file: SRR7169851_2.fastq trimmed: SRR7169851-trimmed-pair1.fastq, SRR7169851-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:51:40 2025 >> started Tue Feb 11 23:51:54 2025 >> done (14.303s) 12994024 read pairs processed; of these: 8290 ( 0.06%) short read pairs filtered out after trimming by size control 12111 ( 0.09%) empty read pairs filtered out after trimming by size control 12973623 (99.84%) read pairs available; of these: 5891084 (45.41%) trimmed read pairs available after processing 7082539 (54.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 6 0.00% 26 4 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 5 0.00% 31 4 0.00% 32 9 0.00% 33 7 0.00% 34 7 0.00% 35 7 0.00% 36 9 0.00% 37 11 0.00% 38 13 0.00% 39 10 0.00% 40 10 0.00% 41 18 0.00% 42 17 0.00% 43 11 0.00% 44 23 0.00% 45 25 0.00% 46 29 0.00% 47 32 0.00% 48 47 0.00% 49 64 0.00% 50 59 0.00% 51 81 0.00% 52 81 0.00% 53 88 0.00% 54 78 0.00% 55 122 0.00% 56 127 0.00% 57 123 0.00% 58 179 0.00% 59 205 0.00% 60 227 0.00% 61 300 0.00% 62 270 0.00% 63 336 0.00% 64 379 0.00% 65 385 0.00% 66 465 0.00% 67 508 0.00% 68 587 0.00% 69 687 0.01% 70 790 0.01% 71 955 0.01% 72 1063 0.01% 73 1288 0.01% 74 1397 0.01% 75 1491 0.01% 76 1594 0.01% 77 1804 0.01% 78 1931 0.01% 79 2174 0.02% 80 2386 0.02% 81 2730 0.02% 82 3121 0.02% 83 3450 0.03% 84 4082 0.03% 85 4636 0.04% 86 4955 0.04% 87 5255 0.04% 88 5642 0.04% 89 5977 0.05% 90 6191 0.05% 91 6826 0.05% 92 7437 0.06% 93 7963 0.06% 94 8524 0.07% 95 8912 0.07% 96 9323 0.07% 97 9616 0.07% 98 9662 0.07% 99 9973 0.08% 100 10617 0.08% 101 11049 0.09% 102 11837 0.09% 103 12378 0.10% 104 12922 0.10% 105 13447 0.10% 106 14055 0.11% 107 14205 0.11% 108 14393 0.11% 109 14443 0.11% 110 14841 0.11% 111 15466 0.12% 112 15978 0.12% 113 16640 0.13% 114 17561 0.14% 115 18222 0.14% 116 18243 0.14% 117 18922 0.15% 118 19290 0.15% 119 19254 0.15% 120 19490 0.15% 121 20008 0.15% 122 20399 0.16% 123 21514 0.17% 124 22354 0.17% 125 23085 0.18% 126 23940 0.18% 127 24608 0.19% 128 25124 0.19% 129 26328 0.20% 130 27104 0.21% 131 28257 0.22% 132 29728 0.23% 133 31577 0.24% 134 32782 0.25% 135 35225 0.27% 136 37441 0.29% 137 39552 0.30% 138 43346 0.33% 139 46964 0.36% 140 51120 0.39% 141 56989 0.44% 142 64075 0.49% 143 73578 0.57% 144 88360 0.68% 145 109957 0.85% 146 143027 1.10% 147 200204 1.54% 148 319524 2.46% 149 656093 5.06% 150 3098746 23.88% 151 7082539 54.59% 12973623 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=45 prefix-density=0.19 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=6 fanout-score=93.30 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=19.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=34 prefix-density=0.43 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=61.27 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7169851 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:52:38 Started mapping on | Feb 11 23:52:39 Finished on | Feb 11 23:53:50 Mapping speed, Million of reads per hour | 657.82 Number of input reads | 12973623 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12363227 Uniquely mapped reads % | 95.30% Average mapped length | 294.79 Number of splices: Total | 12253110 Number of splices: Annotated (sjdb) | 12055211 Number of splices: GT/AG | 12074406 Number of splices: GC/AG | 143273 Number of splices: AT/AC | 9352 Number of splices: Non-canonical | 26079 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232306 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 77708 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.23% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 384963 384963 384963 N_multimapping 232306 232306 232306 N_noFeature 279794 12245057 334249 N_ambiguous 121658 594 57552 UnstrandedReadsAssigned:11961775 PositiveStrandReadsAssigned:117576 NegativeStrandReadsAssigned:11971426 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169851 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169851-trimmed-pair1.fastq SRR7169851-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,973,623 reads, 11,896,822 reads pseudoaligned [quant] estimated average fragment length: 288.451 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7169851.ke.tsv 34699 SRR7169851.se.tsv 87100 total ==> SRR7169851.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.55 208 10.5315 Potri.005G024800.1.v4.1 1035 747.549 29 3.39913 Potri.004G059700.1.v4.1 961 673.588 0 0 Potri.007G009000.2.v4.1 1416 1128.55 0 0 Potri.003G141000.2.v4.1 2943 2655.55 199.056 6.56795 Potri.016G087400.1.v4.1 270 81.5163 1127.61 1212.06 Potri.015G069301.1.v4.1 564 286.245 0 0 Potri.010G195200.1.v4.1 1773 1485.55 17 1.0027 Potri.012G127500.1.v4.1 977 689.576 4024 511.311 ==> SRR7169851.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1114 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169851 completed mapping pipeline successfully