Starting /dee2/code/volunteer_pipeline.sh SRR7169852 current disk space = 3052331061248 free memory = 1473600452 SRR7169852 SRAfilesize 0b195ce9dadb5286a0d11462d4cd3dca SRR7169852.sra SRR7169852.sra file validated SRR7169852 is paired end SRR7169852 is conventional basespace SRR7169852 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.52925 25.0 18.0 33.0 18.0 33.0 2 27.0365 28.0 25.0 31.0 18.0 33.0 3 29.725 31.0 29.0 33.0 25.0 33.0 4 31.94175 33.0 31.0 33.0 29.0 33.0 5 32.68025 33.0 33.0 33.0 32.0 34.0 6 36.33375 38.0 36.0 38.0 34.0 38.0 7 35.71075 38.0 36.0 38.0 31.0 38.0 8 36.86625 38.0 37.0 38.0 35.0 38.0 9 37.29725 38.0 38.0 38.0 36.0 38.0 10-14 37.417049999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.4766 38.0 38.0 38.0 37.0 38.0 20-24 37.424400000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.451299999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.44245 38.0 38.0 38.0 37.0 38.0 35-39 37.44915 38.0 38.0 38.0 37.0 38.0 40-44 37.291999999999994 38.0 38.0 38.0 36.8 38.0 45-49 37.357600000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.25325 38.0 38.0 38.0 36.4 38.0 55-59 37.1841 38.0 38.0 38.0 36.0 38.0 60-64 37.11535 38.0 38.0 38.0 36.0 38.0 65-69 36.94865 38.0 38.0 38.0 35.4 38.0 70-74 36.9598 38.0 38.0 38.0 35.6 38.0 75-79 36.8743 38.0 38.0 38.0 35.2 38.0 80-84 36.7556 38.0 38.0 38.0 34.8 38.0 85-89 36.544599999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.15995 38.0 36.8 38.0 32.8 38.0 95-99 36.142100000000006 38.0 37.0 38.0 33.4 38.0 100-104 35.0677 38.0 35.6 38.0 27.2 38.0 105-109 35.790350000000004 38.0 36.6 38.0 31.4 38.0 110-114 35.72925 38.0 36.4 38.0 31.4 38.0 115-119 35.3313 38.0 35.8 38.0 29.4 38.0 120-124 34.527750000000005 38.0 34.4 38.0 24.8 38.0 125-129 34.82525 38.0 35.0 38.0 27.8 38.0 130-134 33.62555 37.6 33.2 38.0 21.8 38.0 135-139 34.2155 38.0 34.4 38.0 24.4 38.0 140-144 33.2352 37.6 33.6 38.0 18.8 38.0 145-149 31.608299999999996 35.8 30.4 38.0 13.6 38.0 150-151 28.067999999999998 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 4.0 20 0.0 21 2.0 22 7.0 23 8.0 24 10.0 25 13.0 26 17.0 27 31.0 28 15.0 29 33.0 30 43.0 31 76.0 32 104.0 33 141.0 34 278.0 35 499.0 36 1315.0 37 1395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.425 11.0 9.175 41.4 2 20.225 13.375 34.599999999999994 31.8 3 19.075 19.650000000000002 26.700000000000003 34.575 4 22.650000000000002 26.325 23.925 27.1 5 23.0 31.825 24.125 21.05 6 19.975 34.300000000000004 25.324999999999996 20.4 7 14.725 27.35 40.525 17.4 8 17.625 27.525 29.95 24.9 9 17.25 25.6 34.025 23.125 10-14 19.735 30.255 26.93 23.080000000000002 15-19 20.27 28.76 27.41 23.56 20-24 20.294999999999998 28.74 27.845 23.119999999999997 25-29 19.805 28.915000000000003 27.775 23.505000000000003 30-34 20.09 28.485 27.634999999999998 23.79 35-39 19.939999999999998 29.220000000000002 27.33 23.51 40-44 19.675 29.104999999999997 27.605 23.615 45-49 20.015 29.080000000000002 27.495000000000005 23.41 50-54 20.205000000000002 28.155 28.205000000000002 23.435 55-59 20.044999999999998 29.29 27.015 23.65 60-64 20.41 28.910000000000004 27.505000000000003 23.175 65-69 20.1 28.52 27.76 23.62 70-74 19.74 28.645 27.500000000000004 24.115000000000002 75-79 20.369999999999997 29.03 27.24 23.36 80-84 20.655 28.005000000000003 27.295 24.044999999999998 85-89 20.495 28.685 27.725 23.095 90-94 20.685000000000002 28.449999999999996 26.950000000000003 23.915 95-99 20.895 28.105000000000004 27.779999999999998 23.22 100-104 20.895 28.585 27.245 23.275000000000002 105-109 20.705000000000002 28.51 27.1 23.685000000000002 110-114 20.7 28.765 26.889999999999997 23.645 115-119 20.71 28.9 26.965 23.425 120-124 20.695 28.325 27.855 23.125 125-129 20.919999999999998 27.97 27.450000000000003 23.66 130-134 20.990000000000002 28.325 27.034999999999997 23.65 135-139 21.545 28.13 26.61 23.715 140-144 20.265 28.249999999999996 27.089999999999996 24.395 145-149 20.855 28.255000000000003 27.425 23.465 150-151 20.2875 27.450000000000003 27.9125 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.0 23 1.0 24 1.5 25 2.0 26 4.5 27 8.0 28 10.0 29 14.5 30 18.0 31 21.5 32 28.0 33 32.5 34 46.0 35 68.5 36 78.0 37 96.0 38 130.0 39 157.0 40 195.5 41 243.0 42 252.5 43 251.0 44 278.5 45 290.5 46 263.5 47 252.0 48 238.5 49 202.5 50 179.5 51 159.5 52 133.5 53 98.0 54 67.5 55 42.5 56 30.5 57 28.0 58 18.5 59 10.5 60 6.0 61 7.0 62 9.5 63 7.0 64 4.5 65 2.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6125 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 2.9375 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.7249999999999996 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169852 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169852_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.174 34.0 33.0 34.0 33.0 34.0 2 33.335 34.0 33.0 34.0 33.0 34.0 3 33.3775 34.0 33.0 34.0 33.0 34.0 4 33.3215 34.0 33.0 34.0 33.0 34.0 5 33.311 34.0 33.0 34.0 33.0 34.0 6 37.4005 38.0 38.0 38.0 38.0 38.0 7 37.41025 38.0 38.0 38.0 38.0 38.0 8 37.4715 38.0 38.0 38.0 38.0 38.0 9 37.4435 38.0 38.0 38.0 38.0 38.0 10-14 37.405899999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.39275 38.0 38.0 38.0 38.0 38.0 20-24 37.208000000000006 38.0 38.0 38.0 37.2 38.0 25-29 36.81340000000001 38.0 37.8 38.0 35.0 38.0 30-34 36.47425 38.0 37.8 38.0 33.8 38.0 35-39 37.1447 38.0 38.0 38.0 36.4 38.0 40-44 37.042 38.0 38.0 38.0 36.2 38.0 45-49 36.954649999999994 38.0 38.0 38.0 35.8 38.0 50-54 37.2197 38.0 38.0 38.0 36.8 38.0 55-59 37.28515 38.0 38.0 38.0 37.0 38.0 60-64 37.140699999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.1879 38.0 38.0 38.0 37.0 38.0 70-74 37.2183 38.0 38.0 38.0 37.0 38.0 75-79 37.198899999999995 38.0 38.0 38.0 36.8 38.0 80-84 37.002050000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.94245 38.0 38.0 38.0 36.0 38.0 90-94 36.972350000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.837900000000005 38.0 38.0 38.0 35.6 38.0 100-104 36.6879 38.0 38.0 38.0 35.0 38.0 105-109 36.6088 38.0 38.0 38.0 34.6 38.0 110-114 36.6412 38.0 38.0 38.0 34.4 38.0 115-119 36.43495 38.0 38.0 38.0 34.2 38.0 120-124 36.121300000000005 38.0 37.6 38.0 33.8 38.0 125-129 36.0521 38.0 37.4 38.0 33.4 38.0 130-134 35.706450000000004 38.0 36.6 38.0 32.2 38.0 135-139 35.3816 38.0 36.0 38.0 31.0 38.0 140-144 35.221 38.0 36.0 38.0 30.6 38.0 145-149 34.683350000000004 38.0 35.8 38.0 28.6 38.0 150-151 30.68925 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 4.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 5.0 20 5.0 21 7.0 22 9.0 23 7.0 24 7.0 25 10.0 26 9.0 27 12.0 28 18.0 29 27.0 30 32.0 31 39.0 32 56.0 33 79.0 34 132.0 35 207.0 36 593.0 37 2731.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.025 22.5 13.3 25.174999999999997 2 27.700000000000003 25.825 28.999999999999996 17.474999999999998 3 19.725 28.225 32.800000000000004 19.25 4 22.875 33.300000000000004 24.75 19.075 5 22.8 36.05 23.5 17.65 6 21.05 37.275000000000006 23.549999999999997 18.125 7 19.875 22.1 38.875 19.15 8 22.05 26.1 27.075 24.775 9 20.775 25.900000000000002 29.975 23.35 10-14 22.605 29.044999999999998 26.884999999999998 21.465 15-19 22.64 28.265 27.939999999999998 21.154999999999998 20-24 22.21 28.7 27.79 21.3 25-29 23.405 28.67 27.35 20.575 30-34 23.185 28.575 27.805000000000003 20.435 35-39 22.29 28.99 27.150000000000002 21.57 40-44 22.845 28.389999999999997 27.63 21.135 45-49 23.1 28.275 27.450000000000003 21.175 50-54 22.759999999999998 28.444999999999997 27.355 21.44 55-59 23.305 27.98 27.810000000000002 20.905 60-64 22.55 27.905 28.59 20.955 65-69 22.814999999999998 27.939999999999998 28.139999999999997 21.105 70-74 23.745 27.860000000000003 27.74 20.655 75-79 22.939999999999998 27.865000000000002 28.28 20.915 80-84 23.419999999999998 27.49 28.01 21.08 85-89 23.1 28.144999999999996 27.85 20.905 90-94 23.625 28.075 27.605 20.695 95-99 22.875 28.125 28.165000000000003 20.835 100-104 23.65 27.625 27.82 20.905 105-109 23.235 27.700000000000003 28.105000000000004 20.96 110-114 23.93 27.48 28.01 20.580000000000002 115-119 23.46 28.08 27.625 20.835 120-124 23.855 28.035 27.755000000000003 20.355 125-129 23.28 27.825 27.565 21.33 130-134 24.42 27.905 27.139999999999997 20.535 135-139 24.060000000000002 27.42 28.055000000000003 20.465 140-144 23.62 27.93 27.875 20.575 145-149 24.21 27.935 27.73 20.125 150-151 24.4 27.437499999999996 27.212500000000002 20.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 1.5 25 1.5 26 1.5 27 3.0 28 8.5 29 10.0 30 11.0 31 14.5 32 22.5 33 35.0 34 50.5 35 59.5 36 73.0 37 99.5 38 133.0 39 171.0 40 206.5 41 240.0 42 267.5 43 282.5 44 290.0 45 285.5 46 267.5 47 258.5 48 250.0 49 208.0 50 172.5 51 148.0 52 121.0 53 93.5 54 59.0 55 42.5 56 29.5 57 23.0 58 16.5 59 10.5 60 7.0 61 6.5 62 6.5 63 2.5 64 1.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.2875 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra Read 633681 spots for SRR7169852.sra Written 633681 spots for SRR7169852.sra Read 633665 spots for SRR7169852.sra Written 633665 spots for SRR7169852.sra SRR ids: ['SRR7169852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d3iz973x SRR7169852.sra spots: 12673316 blocks: [[1, 633665], [633666, 1267330], [1267331, 1900995], [1900996, 2534660], [2534661, 3168325], [3168326, 3801990], [3801991, 4435655], [4435656, 5069320], [5069321, 5702985], [5702986, 6336650], [6336651, 6970315], [6970316, 7603980], [7603981, 8237645], [8237646, 8871310], [8871311, 9504975], [9504976, 10138640], [10138641, 10772305], [10772306, 11405970], [11405971, 12039635], [12039636, 12673316]] SRR7169852 file size 4272870 SRR7169852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169852 SRR7169852_1.fastq SRR7169852_2.fastq Input file: SRR7169852_1.fastq Paired file: SRR7169852_2.fastq trimmed: SRR7169852-trimmed-pair1.fastq, SRR7169852-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:19:57 2025 >> started Tue Feb 11 23:20:14 2025 >> done (17.082s) 12673316 read pairs processed; of these: 10148 ( 0.08%) short read pairs filtered out after trimming by size control 8404 ( 0.07%) empty read pairs filtered out after trimming by size control 12654764 (99.85%) read pairs available; of these: 5609480 (44.33%) trimmed read pairs available after processing 7045284 (55.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 2 0.00% 29 1 0.00% 30 7 0.00% 31 5 0.00% 32 6 0.00% 33 6 0.00% 34 5 0.00% 35 7 0.00% 36 7 0.00% 37 8 0.00% 38 12 0.00% 39 5 0.00% 40 13 0.00% 41 11 0.00% 42 15 0.00% 43 9 0.00% 44 15 0.00% 45 22 0.00% 46 14 0.00% 47 23 0.00% 48 40 0.00% 49 36 0.00% 50 32 0.00% 51 40 0.00% 52 38 0.00% 53 50 0.00% 54 63 0.00% 55 66 0.00% 56 81 0.00% 57 97 0.00% 58 114 0.00% 59 143 0.00% 60 167 0.00% 61 202 0.00% 62 218 0.00% 63 252 0.00% 64 255 0.00% 65 291 0.00% 66 304 0.00% 67 387 0.00% 68 410 0.00% 69 488 0.00% 70 570 0.00% 71 670 0.01% 72 762 0.01% 73 853 0.01% 74 953 0.01% 75 1082 0.01% 76 1224 0.01% 77 1345 0.01% 78 1433 0.01% 79 1581 0.01% 80 1706 0.01% 81 2031 0.02% 82 2278 0.02% 83 2645 0.02% 84 3313 0.03% 85 3781 0.03% 86 3947 0.03% 87 4026 0.03% 88 4436 0.04% 89 4691 0.04% 90 4951 0.04% 91 5198 0.04% 92 5500 0.04% 93 6012 0.05% 94 6473 0.05% 95 6910 0.05% 96 7116 0.06% 97 7472 0.06% 98 7532 0.06% 99 7868 0.06% 100 8239 0.07% 101 8761 0.07% 102 9141 0.07% 103 9684 0.08% 104 10033 0.08% 105 10611 0.08% 106 10712 0.08% 107 11166 0.09% 108 11203 0.09% 109 11559 0.09% 110 11953 0.09% 111 12366 0.10% 112 13068 0.10% 113 13454 0.11% 114 14187 0.11% 115 14490 0.11% 116 14842 0.12% 117 15715 0.12% 118 15889 0.13% 119 15909 0.13% 120 16586 0.13% 121 16963 0.13% 122 17656 0.14% 123 18215 0.14% 124 19270 0.15% 125 20193 0.16% 126 20716 0.16% 127 21565 0.17% 128 22470 0.18% 129 23197 0.18% 130 24616 0.19% 131 25361 0.20% 132 26877 0.21% 133 28570 0.23% 134 29972 0.24% 135 31956 0.25% 136 34260 0.27% 137 37456 0.30% 138 40371 0.32% 139 44343 0.35% 140 48459 0.38% 141 53682 0.42% 142 60643 0.48% 143 70410 0.56% 144 85543 0.68% 145 105958 0.84% 146 138817 1.10% 147 194455 1.54% 148 309937 2.45% 149 640090 5.06% 150 3025546 23.91% 151 7045284 55.67% 12654764 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=46.08 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.6 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=32 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.16 sequence-density-rank=10 fanout-score=36.40 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.0 sequence=TGTTGGTGGTGG SRR7169852 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:21:04 Started mapping on | Feb 11 23:21:04 Finished on | Feb 11 23:22:12 Mapping speed, Million of reads per hour | 669.96 Number of input reads | 12654764 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12023315 Uniquely mapped reads % | 95.01% Average mapped length | 295.53 Number of splices: Total | 11402523 Number of splices: Annotated (sjdb) | 11218441 Number of splices: GT/AG | 11242810 Number of splices: GC/AG | 129238 Number of splices: AT/AC | 9080 Number of splices: Non-canonical | 21395 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205692 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 50394 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435126 435126 435126 N_multimapping 205692 205692 205692 N_noFeature 269096 11886939 323020 N_ambiguous 134130 530 51375 UnstrandedReadsAssigned:11620089 PositiveStrandReadsAssigned:135846 NegativeStrandReadsAssigned:11648920 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169852 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169852-trimmed-pair1.fastq SRR7169852-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,654,764 reads, 11,591,968 reads pseudoaligned [quant] estimated average fragment length: 291.861 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7169852.ke.tsv 34699 SRR7169852.se.tsv 87100 total ==> SRR7169852.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.14 233 12.5244 Potri.005G024800.1.v4.1 1035 744.139 35 4.3666 Potri.004G059700.1.v4.1 961 670.165 1 0.138531 Potri.007G009000.2.v4.1 1416 1125.14 0 0 Potri.003G141000.2.v4.1 2943 2652.14 274 9.59143 Potri.016G087400.1.v4.1 270 76.5981 994.041 1204.8 Potri.015G069301.1.v4.1 564 282.76 0 0 Potri.010G195200.1.v4.1 1773 1482.14 46 2.88136 Potri.012G127500.1.v4.1 977 686.152 1570 212.426 ==> SRR7169852.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1878 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169852 completed mapping pipeline successfully