Starting /dee2/code/volunteer_pipeline.sh SRR7169853 current disk space = 3052430118912 free memory = 1484958088 SRR7169853 SRAfilesize b6ecf06d230ca037a3e0b0355c18b612 SRR7169853.sra SRR7169853.sra file validated SRR7169853 is paired end SRR7169853 is conventional basespace SRR7169853 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.24125 25.0 18.0 33.0 18.0 33.0 2 26.7415 28.0 25.0 31.0 18.0 33.0 3 30.34925 31.0 29.0 33.0 27.0 33.0 4 32.156 33.0 31.0 33.0 30.0 33.0 5 32.58775 33.0 33.0 33.0 31.0 34.0 6 36.37475 38.0 36.0 38.0 34.0 38.0 7 36.9215 38.0 37.0 38.0 35.0 38.0 8 37.33525 38.0 38.0 38.0 36.0 38.0 9 37.45875 38.0 38.0 38.0 37.0 38.0 10-14 37.53255 38.0 38.0 38.0 37.8 38.0 15-19 37.54735000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.56849999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.556349999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.445350000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.354350000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.40455 38.0 38.0 38.0 37.0 38.0 45-49 37.39205 38.0 38.0 38.0 37.0 38.0 50-54 37.28294999999999 38.0 38.0 38.0 36.6 38.0 55-59 37.115700000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.0111 38.0 38.0 38.0 36.0 38.0 65-69 36.9061 38.0 38.0 38.0 35.6 38.0 70-74 36.65785 38.0 38.0 38.0 35.0 38.0 75-79 36.3995 38.0 37.6 38.0 33.8 38.0 80-84 36.39145 38.0 37.6 38.0 33.4 38.0 85-89 36.433350000000004 38.0 37.8 38.0 33.8 38.0 90-94 36.3688 38.0 37.2 38.0 34.0 38.0 95-99 36.242650000000005 38.0 37.2 38.0 33.8 38.0 100-104 35.7448 38.0 37.0 38.0 31.0 38.0 105-109 34.580799999999996 38.0 35.0 38.0 24.6 38.0 110-114 34.979150000000004 38.0 35.4 38.0 27.8 38.0 115-119 35.2758 38.0 36.0 38.0 29.0 38.0 120-124 35.0373 38.0 35.4 38.0 28.4 38.0 125-129 34.3814 38.0 34.4 38.0 25.4 38.0 130-134 33.94215 38.0 33.6 38.0 23.4 38.0 135-139 33.08970000000001 37.8 33.0 38.0 18.0 38.0 140-144 32.61595 37.4 31.8 38.0 15.8 38.0 145-149 31.216700000000003 36.2 30.6 38.0 10.6 38.0 150-151 26.401875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 1.0 15 3.0 16 1.0 17 4.0 18 5.0 19 7.0 20 2.0 21 4.0 22 15.0 23 13.0 24 16.0 25 18.0 26 16.0 27 17.0 28 31.0 29 29.0 30 48.0 31 63.0 32 86.0 33 152.0 34 272.0 35 512.0 36 1262.0 37 1416.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.96196196196196 13.588588588588587 11.511511511511511 37.93793793793794 2 21.349999999999998 15.225 31.05 32.375 3 18.575 19.85 29.049999999999997 32.525 4 19.025 26.85 25.624999999999996 28.499999999999996 5 20.45 32.875 25.0 21.675 6 21.099999999999998 34.225 26.0 18.675 7 13.850000000000001 28.275 40.150000000000006 17.724999999999998 8 16.475 28.425 31.624999999999996 23.474999999999998 9 16.266266266266268 26.976976976976978 34.034034034034036 22.722722722722725 10-14 17.93 31.009999999999998 28.125 22.935 15-19 18.295 30.145 28.425 23.135 20-24 18.77 30.43 27.74 23.06 25-29 18.63 30.035 28.449999999999996 22.884999999999998 30-34 19.035 30.745 27.11 23.11 35-39 19.005 30.18 27.49 23.325000000000003 40-44 19.115 30.29 27.474999999999998 23.119999999999997 45-49 18.78 29.385 28.23 23.605 50-54 19.305 29.630000000000003 27.689999999999998 23.375 55-59 18.970000000000002 29.604999999999997 28.050000000000004 23.375 60-64 19.61 29.494999999999997 28.12 22.775000000000002 65-69 19.235 29.244999999999997 28.050000000000004 23.47 70-74 19.37 29.68 27.665 23.285 75-79 19.085 29.935000000000002 27.32 23.66 80-84 19.744999999999997 29.38 27.544999999999998 23.330000000000002 85-89 19.845 29.315 27.560000000000002 23.28 90-94 19.115 29.404999999999998 27.389999999999997 24.09 95-99 19.21 29.735 27.305 23.75 100-104 20.235 28.82 27.400000000000002 23.544999999999998 105-109 19.545 28.845 28.04 23.57 110-114 19.18 28.92 27.860000000000003 24.04 115-119 19.794999999999998 28.349999999999998 27.715 24.14 120-124 20.115 28.65 27.51 23.724999999999998 125-129 19.593715600920643 28.800160112078455 27.654358050635448 23.951766236365458 130-134 20.53 28.134999999999998 27.705000000000002 23.630000000000003 135-139 19.755 28.705000000000002 27.555000000000003 23.985 140-144 19.45 28.53 27.68 24.34 145-149 20.355 28.51 27.08 24.055 150-151 19.6875 28.3375 28.499999999999996 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 2.5 23 5.5 24 7.0 25 7.0 26 5.5 27 10.5 28 19.0 29 25.0 30 31.0 31 41.5 32 55.0 33 75.0 34 92.0 35 103.5 36 113.5 37 136.5 38 180.0 39 190.5 40 212.0 41 233.0 42 231.0 43 242.5 44 247.0 45 239.5 46 223.0 47 217.0 48 195.5 49 170.5 50 149.0 51 121.0 52 103.5 53 76.0 54 51.5 55 45.0 56 34.5 57 25.0 58 18.5 59 14.0 60 11.0 61 5.0 62 6.0 63 6.0 64 2.5 65 3.0 66 2.5 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.1 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.06999999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5790533736153072 1.15 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.4000000000000004 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAC 10 0.0068555363 144.825 2 >>END_MODULE SRR7169853 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1215 34.0 33.0 34.0 33.0 34.0 2 33.282 34.0 33.0 34.0 33.0 34.0 3 33.3115 34.0 33.0 34.0 33.0 34.0 4 33.327 34.0 33.0 34.0 33.0 34.0 5 33.32325 34.0 33.0 34.0 33.0 34.0 6 37.40625 38.0 38.0 38.0 38.0 38.0 7 37.46325 38.0 38.0 38.0 38.0 38.0 8 37.49625 38.0 38.0 38.0 38.0 38.0 9 37.428 38.0 38.0 38.0 38.0 38.0 10-14 37.40245 38.0 38.0 38.0 38.0 38.0 15-19 37.352050000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.05475 38.0 38.0 38.0 36.6 38.0 25-29 37.2687 38.0 38.0 38.0 37.6 38.0 30-34 37.094449999999995 38.0 38.0 38.0 36.6 38.0 35-39 37.302949999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.2452 38.0 38.0 38.0 37.0 38.0 45-49 37.114 38.0 38.0 38.0 36.8 38.0 50-54 37.2301 38.0 38.0 38.0 37.2 38.0 55-59 37.228899999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.0747 38.0 38.0 38.0 36.8 38.0 65-69 37.06905 38.0 38.0 38.0 37.0 38.0 70-74 36.5221 38.0 37.8 38.0 34.0 38.0 75-79 36.58239999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.910000000000004 38.0 38.0 38.0 36.4 38.0 85-89 36.884499999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.8521 38.0 38.0 38.0 36.0 38.0 95-99 36.7364 38.0 38.0 38.0 36.0 38.0 100-104 36.598349999999996 38.0 38.0 38.0 35.4 38.0 105-109 36.449400000000004 38.0 38.0 38.0 34.6 38.0 110-114 35.98795 38.0 37.4 38.0 33.0 38.0 115-119 36.2309 38.0 38.0 38.0 34.0 38.0 120-124 36.0505 38.0 38.0 38.0 33.8 38.0 125-129 35.83365 38.0 37.4 38.0 33.0 38.0 130-134 35.3742 38.0 36.6 38.0 31.0 38.0 135-139 35.125299999999996 38.0 36.0 38.0 30.6 38.0 140-144 31.885450000000002 37.2 29.8 38.0 14.8 38.0 145-149 33.53295 38.0 34.0 38.0 22.2 38.0 150-151 29.018124999999998 35.5 18.5 38.0 6.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 2.0 6 1.0 7 2.0 8 1.0 9 3.0 10 3.0 11 2.0 12 0.0 13 0.0 14 3.0 15 5.0 16 2.0 17 3.0 18 9.0 19 3.0 20 7.0 21 5.0 22 4.0 23 2.0 24 15.0 25 9.0 26 11.0 27 15.0 28 16.0 29 30.0 30 36.0 31 30.0 32 48.0 33 90.0 34 123.0 35 221.0 36 740.0 37 2549.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 21.85 15.55 22.725 2 28.075 27.85 27.125 16.950000000000003 3 20.974999999999998 30.15 30.75 18.125 4 23.78094523630908 35.13378344586147 22.83070767691923 18.254563640910227 5 24.431107776944234 36.05901475368842 22.1055263815954 17.404351087771943 6 22.375 37.35 23.325000000000003 16.950000000000003 7 20.349999999999998 22.5 38.2 18.95 8 22.55563890972743 26.206551637909474 27.231807951987996 24.006001500375092 9 22.900000000000002 26.8 27.3 23.0 10-14 23.9 28.96 26.27 20.87 15-19 23.630000000000003 28.59 27.384999999999998 20.395 20-24 23.57 29.225 26.810000000000002 20.395 25-29 23.86 29.154999999999998 27.26 19.725 30-34 23.605 28.749999999999996 27.42 20.225 35-39 23.145 28.810000000000002 27.425 20.62 40-44 23.705000000000002 28.904999999999998 27.400000000000002 19.99 45-49 23.84 27.939999999999998 28.325 19.895 50-54 23.256162808140406 28.616430821541076 27.706385319265962 20.421021051052552 55-59 23.78 28.13 27.415 20.674999999999997 60-64 23.155 28.63 27.87 20.345 65-69 23.36 27.715 28.24 20.685000000000002 70-74 24.345 28.27 27.095000000000002 20.29 75-79 23.72 28.01 28.189999999999998 20.080000000000002 80-84 23.965 28.194999999999997 27.35 20.49 85-89 24.065 28.775000000000002 27.425 19.735 90-94 23.9 28.005000000000003 27.96 20.135 95-99 23.76 28.095 28.060000000000002 20.085 100-104 23.849999999999998 28.255000000000003 28.199999999999996 19.695 105-109 23.761188059402972 27.791389569478476 28.056402820141006 20.39101955097755 110-114 24.044999999999998 27.93 27.79 20.235 115-119 23.97 27.91 28.165000000000003 19.955000000000002 120-124 24.42 27.595 28.095 19.89 125-129 24.29 28.16 28.51 19.040000000000003 130-134 24.349999999999998 27.67 28.48 19.5 135-139 24.565 28.62 27.779999999999998 19.035 140-144 24.57 27.85 28.384999999999998 19.195 145-149 24.81 27.925 27.785 19.48 150-151 25.0 27.187499999999996 28.249999999999996 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.0 27 6.0 28 7.0 29 9.0 30 15.0 31 19.0 32 19.5 33 31.5 34 45.5 35 61.5 36 82.5 37 97.0 38 114.0 39 160.0 40 205.0 41 244.0 42 279.0 43 286.0 44 299.0 45 323.5 46 308.0 47 251.5 48 217.5 49 198.0 50 156.0 51 119.0 52 101.0 53 87.0 54 61.5 55 39.0 56 36.5 57 29.5 58 21.0 59 14.0 60 9.0 61 9.5 62 8.0 63 3.0 64 0.5 65 0.5 66 2.5 67 4.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.8375000000000004 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529961 spots for SRR7169853.sra Written 529961 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra Read 529958 spots for SRR7169853.sra Written 529958 spots for SRR7169853.sra SRR ids: ['SRR7169853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wb7wiyne SRR7169853.sra spots: 10599163 blocks: [[1, 529958], [529959, 1059916], [1059917, 1589874], [1589875, 2119832], [2119833, 2649790], [2649791, 3179748], [3179749, 3709706], [3709707, 4239664], [4239665, 4769622], [4769623, 5299580], [5299581, 5829538], [5829539, 6359496], [6359497, 6889454], [6889455, 7419412], [7419413, 7949370], [7949371, 8479328], [8479329, 9009286], [9009287, 9539244], [9539245, 10069202], [10069203, 10599163]] SRR7169853 file size 3570008 SRR7169853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169853 SRR7169853_1.fastq SRR7169853_2.fastq Input file: SRR7169853_1.fastq Paired file: SRR7169853_2.fastq trimmed: SRR7169853-trimmed-pair1.fastq, SRR7169853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:02:47 2025 >> started Tue Feb 11 23:02:58 2025 >> done (10.842s) 10599163 read pairs processed; of these: 18224 ( 0.17%) short read pairs filtered out after trimming by size control 26712 ( 0.25%) empty read pairs filtered out after trimming by size control 10554227 (99.58%) read pairs available; of these: 4988236 (47.26%) trimmed read pairs available after processing 5565991 (52.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 8 0.00% 21 4 0.00% 22 6 0.00% 23 3 0.00% 24 4 0.00% 25 4 0.00% 26 7 0.00% 27 4 0.00% 28 6 0.00% 29 7 0.00% 30 5 0.00% 31 11 0.00% 32 9 0.00% 33 6 0.00% 34 6 0.00% 35 8 0.00% 36 12 0.00% 37 11 0.00% 38 15 0.00% 39 13 0.00% 40 12 0.00% 41 16 0.00% 42 23 0.00% 43 25 0.00% 44 29 0.00% 45 29 0.00% 46 36 0.00% 47 35 0.00% 48 44 0.00% 49 54 0.00% 50 59 0.00% 51 60 0.00% 52 74 0.00% 53 77 0.00% 54 89 0.00% 55 105 0.00% 56 90 0.00% 57 117 0.00% 58 142 0.00% 59 155 0.00% 60 147 0.00% 61 231 0.00% 62 230 0.00% 63 266 0.00% 64 306 0.00% 65 325 0.00% 66 337 0.00% 67 415 0.00% 68 445 0.00% 69 511 0.00% 70 637 0.01% 71 661 0.01% 72 754 0.01% 73 858 0.01% 74 1019 0.01% 75 1117 0.01% 76 1316 0.01% 77 1502 0.01% 78 1540 0.01% 79 1645 0.02% 80 1747 0.02% 81 1999 0.02% 82 2332 0.02% 83 2641 0.03% 84 3466 0.03% 85 4028 0.04% 86 4425 0.04% 87 4842 0.05% 88 5036 0.05% 89 5144 0.05% 90 5411 0.05% 91 5576 0.05% 92 5856 0.06% 93 6306 0.06% 94 6544 0.06% 95 7148 0.07% 96 7331 0.07% 97 7466 0.07% 98 7672 0.07% 99 7905 0.07% 100 8407 0.08% 101 8557 0.08% 102 9215 0.09% 103 9467 0.09% 104 9970 0.09% 105 10287 0.10% 106 10725 0.10% 107 10809 0.10% 108 11242 0.11% 109 11618 0.11% 110 11809 0.11% 111 12297 0.12% 112 12848 0.12% 113 13386 0.13% 114 13664 0.13% 115 14395 0.14% 116 14800 0.14% 117 15173 0.14% 118 15390 0.15% 119 15482 0.15% 120 15818 0.15% 121 16312 0.15% 122 16903 0.16% 123 17744 0.17% 124 18294 0.17% 125 18927 0.18% 126 19680 0.19% 127 20439 0.19% 128 21053 0.20% 129 21831 0.21% 130 22345 0.21% 131 22890 0.22% 132 24479 0.23% 133 25665 0.24% 134 27149 0.26% 135 29003 0.27% 136 30576 0.29% 137 33091 0.31% 138 35740 0.34% 139 38672 0.37% 140 42176 0.40% 141 47537 0.45% 142 54715 0.52% 143 67950 0.64% 144 76260 0.72% 145 96744 0.92% 146 121534 1.15% 147 169526 1.61% 148 281513 2.67% 149 576187 5.46% 150 2619375 24.82% 151 5565991 52.74% 10554227 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=34 prefix-density=0.12 prefix-fanout=3.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=391.32 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=33.6 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=3.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=5 fanout-score=310.57 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=28.4 sequence=AAGAAGAAGAAA SRR7169853 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:03:44 Started mapping on | Feb 11 23:03:44 Finished on | Feb 11 23:04:45 Mapping speed, Million of reads per hour | 622.87 Number of input reads | 10554227 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9948555 Uniquely mapped reads % | 94.26% Average mapped length | 294.72 Number of splices: Total | 8673440 Number of splices: Annotated (sjdb) | 8499725 Number of splices: GT/AG | 8517176 Number of splices: GC/AG | 124130 Number of splices: AT/AC | 7620 Number of splices: Non-canonical | 24514 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201003 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 30500 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 420283 420283 420283 N_multimapping 201003 201003 201003 N_noFeature 255933 9841063 296981 N_ambiguous 116058 616 49305 UnstrandedReadsAssigned:9576564 PositiveStrandReadsAssigned:106876 NegativeStrandReadsAssigned:9602269 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169853-trimmed-pair1.fastq SRR7169853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,554,227 reads, 9,588,512 reads pseudoaligned [quant] estimated average fragment length: 270.32 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7169853.ke.tsv 34699 SRR7169853.se.tsv 87100 total ==> SRR7169853.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.68 224 12.5201 Potri.005G024800.1.v4.1 1035 765.68 163 20.8071 Potri.004G059700.1.v4.1 961 691.695 13 1.83696 Potri.007G009000.2.v4.1 1416 1146.68 0 0 Potri.003G141000.2.v4.1 2943 2673.68 238 8.70038 Potri.016G087400.1.v4.1 270 72.505 775 1044.73 Potri.015G069301.1.v4.1 564 298.237 0 0 Potri.010G195200.1.v4.1 1773 1503.68 129 8.38504 Potri.012G127500.1.v4.1 977 707.695 14862 2052.59 ==> SRR7169853.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1193 Potri.001G233950.v4.1 9 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7169853 completed mapping pipeline successfully