Starting /dee2/code/volunteer_pipeline.sh SRR7169854 current disk space = 3052565016576 free memory = 1380221256 SRR7169854 SRAfilesize 1e4dfbfce132c2edec7b2a661135603d SRR7169854.sra SRR7169854.sra file validated SRR7169854 is paired end SRR7169854 is conventional basespace SRR7169854 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.19475 25.0 18.0 33.0 18.0 33.0 2 26.80125 28.0 25.0 31.0 18.0 33.0 3 30.26175 31.0 29.0 33.0 27.0 33.0 4 32.0505 33.0 31.0 33.0 30.0 33.0 5 32.511 33.0 33.0 33.0 31.0 34.0 6 36.177 38.0 36.0 38.0 33.0 38.0 7 36.75275 38.0 37.0 38.0 34.0 38.0 8 37.255 38.0 38.0 38.0 36.0 38.0 9 37.28975 38.0 38.0 38.0 37.0 38.0 10-14 37.43875 38.0 38.0 38.0 36.8 38.0 15-19 37.4554 38.0 38.0 38.0 37.0 38.0 20-24 37.46545 38.0 38.0 38.0 37.0 38.0 25-29 37.4645 38.0 38.0 38.0 37.6 38.0 30-34 37.3597 38.0 38.0 38.0 37.0 38.0 35-39 37.163050000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.3667 38.0 38.0 38.0 37.0 38.0 45-49 37.3217 38.0 38.0 38.0 37.0 38.0 50-54 37.131299999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.023450000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.86175 38.0 38.0 38.0 35.2 38.0 65-69 36.80615 38.0 38.0 38.0 35.0 38.0 70-74 36.3712 38.0 37.6 38.0 33.2 38.0 75-79 36.155449999999995 38.0 37.2 38.0 32.8 38.0 80-84 36.3977 38.0 37.8 38.0 34.0 38.0 85-89 36.4067 38.0 37.8 38.0 33.8 38.0 90-94 36.2884 38.0 37.4 38.0 33.8 38.0 95-99 36.11325 38.0 37.0 38.0 33.4 38.0 100-104 35.7404 38.0 37.0 38.0 31.6 38.0 105-109 34.5891 38.0 35.0 38.0 24.8 38.0 110-114 34.501400000000004 38.0 34.6 38.0 25.2 38.0 115-119 35.1168 38.0 35.8 38.0 28.6 38.0 120-124 34.8444 38.0 35.0 38.0 27.4 38.0 125-129 34.23285 38.0 34.6 38.0 24.2 38.0 130-134 33.7961 38.0 33.6 38.0 23.0 38.0 135-139 32.74375 37.6 32.0 38.0 16.4 38.0 140-144 32.2033 36.4 31.0 38.0 14.2 38.0 145-149 31.25605 36.0 30.8 38.0 10.8 38.0 150-151 26.266375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 2.0 10 1.0 11 1.0 12 3.0 13 2.0 14 1.0 15 3.0 16 4.0 17 3.0 18 2.0 19 7.0 20 9.0 21 6.0 22 3.0 23 9.0 24 26.0 25 13.0 26 18.0 27 27.0 28 29.0 29 31.0 30 47.0 31 74.0 32 94.0 33 158.0 34 303.0 35 549.0 36 1291.0 37 1281.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.58439609902476 12.003000750187546 11.802950737684421 38.60965241310328 2 21.3 13.4 32.525 32.775 3 18.75 20.150000000000002 27.650000000000002 33.45 4 21.725 28.925 23.525 25.825 5 22.1 31.15 24.675 22.075 6 19.375 35.475 24.55 20.599999999999998 7 14.000000000000002 29.325000000000003 39.675 17.0 8 18.175 26.724999999999998 30.099999999999998 25.0 9 16.8925702811245 25.92871485943775 34.437751004016064 22.740963855421686 10-14 19.259999999999998 31.435000000000002 27.0 22.305 15-19 19.314999999999998 29.98 27.13 23.575 20-24 19.16 29.709999999999997 27.485 23.645 25-29 19.650000000000002 29.770000000000003 27.58 23.0 30-34 19.2 30.09 27.435 23.275000000000002 35-39 19.869999999999997 30.095 26.939999999999998 23.095 40-44 19.93 30.159999999999997 26.825 23.085 45-49 19.765 29.270000000000003 27.500000000000004 23.465 50-54 19.950000000000003 29.385 27.644999999999996 23.02 55-59 19.8 29.270000000000003 27.034999999999997 23.895 60-64 19.09 29.615000000000002 27.37 23.925 65-69 19.835 29.345 27.08 23.74 70-74 19.564999999999998 29.365000000000002 27.51 23.56 75-79 20.015 29.235 27.3 23.45 80-84 19.74 28.685 27.845 23.73 85-89 19.875 28.785 27.57 23.77 90-94 20.06 29.555 26.945000000000004 23.44 95-99 19.965 29.165000000000003 27.505000000000003 23.365 100-104 20.265 29.060000000000002 27.534999999999997 23.14 105-109 19.915 28.910000000000004 27.439999999999998 23.735 110-114 20.03 29.03 27.275 23.665 115-119 19.605 29.49 26.71 24.195 120-124 19.833925266369867 29.67835525986694 26.972137461857837 23.51558201190536 125-129 20.07412601422418 29.234698988280076 27.055995191826103 23.635179805669637 130-134 20.435 28.794999999999998 27.43 23.34 135-139 20.305 28.645 28.125 22.925 140-144 20.27 28.415000000000003 27.47 23.845 145-149 20.845 28.349999999999998 27.450000000000003 23.355 150-151 20.225 28.4375 27.975 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 1.5 20 0.5 21 1.5 22 3.0 23 3.0 24 4.5 25 6.0 26 8.5 27 12.0 28 11.5 29 22.0 30 34.5 31 39.5 32 44.0 33 59.5 34 73.5 35 81.0 36 96.0 37 118.5 38 138.0 39 159.0 40 185.0 41 217.5 42 246.0 43 244.5 44 254.0 45 269.0 46 258.5 47 233.0 48 211.5 49 196.0 50 159.0 51 121.5 52 104.0 53 92.0 54 78.5 55 60.5 56 38.5 57 28.5 58 23.0 59 15.0 60 12.5 61 9.5 62 7.5 63 4.0 64 2.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.4 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.045 125-129 0.16999999999999998 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.6305170239596469 1.25 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTACG 10 0.006830828 145.0 6 CAACTGA 10 0.006830828 145.0 1 TCTGGAT 10 0.006830828 145.0 2 CTGGATA 10 0.006830828 145.0 3 TCTGAAC 10 0.006830828 145.0 145 >>END_MODULE SRR7169854 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1895 34.0 33.0 34.0 33.0 34.0 2 33.27975 34.0 33.0 34.0 33.0 34.0 3 33.283 34.0 33.0 34.0 33.0 34.0 4 33.27725 34.0 33.0 34.0 33.0 34.0 5 33.3335 34.0 33.0 34.0 33.0 34.0 6 37.43225 38.0 38.0 38.0 38.0 38.0 7 37.36425 38.0 38.0 38.0 38.0 38.0 8 37.42475 38.0 38.0 38.0 38.0 38.0 9 37.395 38.0 38.0 38.0 38.0 38.0 10-14 37.34065 38.0 38.0 38.0 38.0 38.0 15-19 37.35705 38.0 38.0 38.0 38.0 38.0 20-24 37.04015 38.0 38.0 38.0 36.8 38.0 25-29 37.115899999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.82495 38.0 38.0 38.0 35.2 38.0 35-39 37.3005 38.0 38.0 38.0 37.6 38.0 40-44 37.0915 38.0 38.0 38.0 36.8 38.0 45-49 37.0338 38.0 38.0 38.0 36.8 38.0 50-54 37.14785 38.0 38.0 38.0 37.0 38.0 55-59 37.18385000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.06045 38.0 38.0 38.0 37.0 38.0 65-69 37.0391 38.0 38.0 38.0 36.6 38.0 70-74 35.98805 38.0 37.0 38.0 30.0 38.0 75-79 36.712199999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.91445 38.0 38.0 38.0 36.2 38.0 85-89 36.83565 38.0 38.0 38.0 36.0 38.0 90-94 36.786500000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.7443 38.0 38.0 38.0 35.6 38.0 100-104 36.5675 38.0 38.0 38.0 35.0 38.0 105-109 36.4222 38.0 38.0 38.0 34.2 38.0 110-114 35.77890000000001 38.0 37.2 38.0 30.6 38.0 115-119 36.19705 38.0 38.0 38.0 34.0 38.0 120-124 35.99945 38.0 37.6 38.0 33.4 38.0 125-129 35.81425 38.0 37.4 38.0 32.4 38.0 130-134 35.39175 38.0 36.4 38.0 31.0 38.0 135-139 35.00475 38.0 35.8 38.0 30.4 38.0 140-144 30.8368 35.6 26.6 38.0 14.4 38.0 145-149 33.5821 38.0 34.2 38.0 23.4 38.0 150-151 29.244 35.5 26.5 38.0 6.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 2.0 5 3.0 6 2.0 7 0.0 8 2.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 3.0 15 1.0 16 2.0 17 3.0 18 5.0 19 6.0 20 7.0 21 4.0 22 7.0 23 6.0 24 16.0 25 15.0 26 17.0 27 12.0 28 20.0 29 20.0 30 37.0 31 48.0 32 54.0 33 95.0 34 133.0 35 265.0 36 789.0 37 2412.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 20.925 16.3 24.15 2 27.206801700425103 26.70667666916729 28.232058014503625 17.854463615903978 3 20.555138784696176 30.182545636409102 30.407601900475118 18.854713678419603 4 23.88097024256064 32.808202050512634 24.056014003500874 19.254813703425857 5 24.50612653163291 35.55888972243061 21.605401350337583 18.3295823955989 6 21.825 36.75 22.75 18.675 7 20.80520130032508 23.455863965991497 35.93398349587397 19.80495123780945 8 23.305826456614152 25.256314078519633 27.131782945736433 24.306076519129782 9 21.95 26.025 29.7 22.325 10-14 23.936196809840492 28.50142507125356 26.146307315365767 21.416070803540176 15-19 23.75 27.615000000000002 27.77 20.865000000000002 20-24 23.51617580879044 27.891394569728483 27.556377818890944 21.03605180259013 25-29 23.72 27.939999999999998 27.735 20.605 30-34 23.635 27.900000000000002 27.63 20.835 35-39 23.465 27.93 27.265 21.34 40-44 24.163624543681554 28.32924938740811 26.724008601290194 20.783117467620144 45-49 23.74 28.42 27.139999999999997 20.7 50-54 23.163474521178177 28.259238885832875 27.914187128069212 20.66309946491974 55-59 24.302430243024304 27.96279627962796 27.202720272027204 20.532053205320533 60-64 22.994999999999997 27.61 28.549999999999997 20.845 65-69 23.851192559627982 27.45137256862843 28.21641082054103 20.48102405120256 70-74 23.585 27.935 27.655 20.825 75-79 22.735 27.705000000000002 28.32 21.240000000000002 80-84 22.985 28.275 28.03 20.71 85-89 23.77 27.85 28.175 20.205000000000002 90-94 24.13 27.715 27.785 20.369999999999997 95-99 23.5 28.23 28.46 19.81 100-104 24.16 28.07 27.735 20.035 105-109 23.313497024553683 27.78916837525629 28.3842576386458 20.513076961544233 110-114 23.630000000000003 28.15 27.755000000000003 20.465 115-119 24.19 28.12 27.685 20.005 120-124 23.82 28.835 26.974999999999998 20.369999999999997 125-129 23.575 28.705000000000002 27.810000000000002 19.91 130-134 24.01 28.18 28.03 19.78 135-139 24.060000000000002 27.91 27.725 20.305 140-144 24.635 27.975 27.229999999999997 20.16 145-149 24.48 28.134999999999998 27.6 19.785 150-151 24.224999999999998 28.025 28.249999999999996 19.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.5 25 1.5 26 1.5 27 2.0 28 4.0 29 8.5 30 9.5 31 9.5 32 19.0 33 27.0 34 35.5 35 52.5 36 66.0 37 81.0 38 108.5 39 156.5 40 208.5 41 248.0 42 278.5 43 301.0 44 300.0 45 291.5 46 292.0 47 264.5 48 240.5 49 220.0 50 171.5 51 134.0 52 113.5 53 97.0 54 75.5 55 53.0 56 33.5 57 23.0 58 21.0 59 13.5 60 8.0 61 5.0 62 4.5 63 4.0 64 3.0 65 2.0 66 1.0 67 0.5 68 1.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.025 8 0.025 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.015 55-59 0.01 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5292338709677419 1.05 3 0.10080645161290322 0.3 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.6 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGGGA 10 0.006830828 145.0 145 >>END_MODULE Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886773 spots for SRR7169854.sra Written 886773 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra Read 886762 spots for SRR7169854.sra Written 886762 spots for SRR7169854.sra SRR ids: ['SRR7169854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__q18tskn SRR7169854.sra spots: 17735251 blocks: [[1, 886762], [886763, 1773524], [1773525, 2660286], [2660287, 3547048], [3547049, 4433810], [4433811, 5320572], [5320573, 6207334], [6207335, 7094096], [7094097, 7980858], [7980859, 8867620], [8867621, 9754382], [9754383, 10641144], [10641145, 11527906], [11527907, 12414668], [12414669, 13301430], [13301431, 14188192], [14188193, 15074954], [15074955, 15961716], [15961717, 16848478], [16848479, 17735251]] SRR7169854 file size 5988194 SRR7169854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169854 SRR7169854_1.fastq SRR7169854_2.fastq Input file: SRR7169854_1.fastq Paired file: SRR7169854_2.fastq trimmed: SRR7169854-trimmed-pair1.fastq, SRR7169854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:49:17 2025 >> started Tue Feb 11 22:49:37 2025 >> done (19.842s) 17735251 read pairs processed; of these: 21774 ( 0.12%) short read pairs filtered out after trimming by size control 30610 ( 0.17%) empty read pairs filtered out after trimming by size control 17682867 (99.70%) read pairs available; of these: 8365578 (47.31%) trimmed read pairs available after processing 9317289 (52.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 10 0.00% 22 8 0.00% 23 10 0.00% 24 4 0.00% 25 13 0.00% 26 10 0.00% 27 6 0.00% 28 12 0.00% 29 9 0.00% 30 13 0.00% 31 25 0.00% 32 12 0.00% 33 12 0.00% 34 8 0.00% 35 8 0.00% 36 11 0.00% 37 15 0.00% 38 21 0.00% 39 12 0.00% 40 12 0.00% 41 12 0.00% 42 13 0.00% 43 21 0.00% 44 21 0.00% 45 26 0.00% 46 22 0.00% 47 29 0.00% 48 38 0.00% 49 40 0.00% 50 55 0.00% 51 69 0.00% 52 48 0.00% 53 70 0.00% 54 85 0.00% 55 85 0.00% 56 118 0.00% 57 124 0.00% 58 138 0.00% 59 197 0.00% 60 203 0.00% 61 223 0.00% 62 245 0.00% 63 323 0.00% 64 344 0.00% 65 405 0.00% 66 413 0.00% 67 451 0.00% 68 567 0.00% 69 602 0.00% 70 731 0.00% 71 853 0.00% 72 996 0.01% 73 1108 0.01% 74 1188 0.01% 75 1422 0.01% 76 1566 0.01% 77 1691 0.01% 78 1881 0.01% 79 2182 0.01% 80 2397 0.01% 81 2768 0.02% 82 3067 0.02% 83 3463 0.02% 84 4811 0.03% 85 5693 0.03% 86 6365 0.04% 87 7093 0.04% 88 7766 0.04% 89 7783 0.04% 90 8064 0.05% 91 8290 0.05% 92 8575 0.05% 93 9113 0.05% 94 9592 0.05% 95 10299 0.06% 96 10738 0.06% 97 10947 0.06% 98 11294 0.06% 99 11615 0.07% 100 12323 0.07% 101 12627 0.07% 102 13524 0.08% 103 13942 0.08% 104 14913 0.08% 105 15835 0.09% 106 16539 0.09% 107 16674 0.09% 108 17632 0.10% 109 17949 0.10% 110 18718 0.11% 111 19245 0.11% 112 20066 0.11% 113 21210 0.12% 114 22518 0.13% 115 23119 0.13% 116 23607 0.13% 117 24124 0.14% 118 24315 0.14% 119 25053 0.14% 120 25965 0.15% 121 26062 0.15% 122 27065 0.15% 123 27787 0.16% 124 29248 0.17% 125 30851 0.17% 126 31611 0.18% 127 32866 0.19% 128 33791 0.19% 129 35217 0.20% 130 36318 0.21% 131 37607 0.21% 132 39777 0.22% 133 42143 0.24% 134 44840 0.25% 135 47712 0.27% 136 51222 0.29% 137 55355 0.31% 138 60029 0.34% 139 65283 0.37% 140 71572 0.40% 141 80377 0.45% 142 93748 0.53% 143 116163 0.66% 144 128412 0.73% 145 165997 0.94% 146 205362 1.16% 147 291137 1.65% 148 482923 2.73% 149 988066 5.59% 150 4418562 24.99% 151 9317289 52.69% 17682867 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=42 prefix-density=0.26 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=50.20 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=14.4 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGTTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=7.91 fanout-score-rank=15 prefix-density=0.43 prefix-fanout=4.1 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=146.28 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169854 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:50:30 Started mapping on | Feb 11 22:50:31 Finished on | Feb 11 22:53:23 Mapping speed, Million of reads per hour | 370.11 Number of input reads | 17682867 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16105656 Uniquely mapped reads % | 91.08% Average mapped length | 295.16 Number of splices: Total | 14600873 Number of splices: Annotated (sjdb) | 14354382 Number of splices: GT/AG | 14388262 Number of splices: GC/AG | 169841 Number of splices: AT/AC | 12086 Number of splices: Non-canonical | 30684 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278175 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 16080 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.22% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1319643 1319643 1319643 N_multimapping 278175 278175 278175 N_noFeature 319792 15913254 380182 N_ambiguous 201157 911 68628 UnstrandedReadsAssigned:15584707 PositiveStrandReadsAssigned:191491 NegativeStrandReadsAssigned:15656846 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169854-trimmed-pair1.fastq SRR7169854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,682,867 reads, 15,578,215 reads pseudoaligned [quant] estimated average fragment length: 269.136 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR7169854.ke.tsv 34699 SRR7169854.se.tsv 87100 total ==> SRR7169854.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.86 226 7.43137 Potri.005G024800.1.v4.1 1035 766.864 50 3.7516 Potri.004G059700.1.v4.1 961 692.864 4 0.332183 Potri.007G009000.2.v4.1 1416 1147.86 0 0 Potri.003G141000.2.v4.1 2943 2674.86 227.029 4.88366 Potri.016G087400.1.v4.1 270 72.036 2354 1880.28 Potri.015G069301.1.v4.1 564 300.568 0 0 Potri.010G195200.1.v4.1 1773 1504.86 20 0.764712 Potri.012G127500.1.v4.1 977 708.864 3966 321.925 ==> SRR7169854.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1665 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169854 completed mapping pipeline successfully